Impact of Anaerobic Fermentation Liquid on Bok Choy and Mechanism of Combined Vitamin C from Bok Choy and Allicin in Treatment of DSS Colitis
Abstract
:1. Introduction
2. Materials and Methods
2.1. Materials
2.2. Experimental Design of AFL Application in Alternative Fertilizers
2.2.1. Experimental Design
2.2.2. Determination of Bok Choy
2.3. Optimal Extraction Experiment of Vitamin C
2.4. Animal Experiment
2.4.1. Experimental Group Design and Sample Collection
2.4.2. Disease Activity Index (DAI) Analysis
2.4.3. RNA Extraction and RT qPCR
2.4.4. Fecal DNA Extraction and 16S DNA Sequencing
2.5. Statistical Analysis
3. Results
3.1. Effects of Different Fertilization Treatments on Bok Choy
3.1.1. Effects of Different Fertilization Treatments on Plant Height and Leaf Number of Bok Choy
3.1.2. Effects of Different Fertilization Treatments on the Yield of Bok Choy
3.1.3. Effect of Different Fertilization Treatments on Vitamin C Content in Bok Choy
3.2. Optimization of Extraction Process of Vitamin C from Bok Choy
3.3. Effects of Vitamin C/Allicin Combined Treatment on Colitis
3.3.1. Impact of Vitamin C/Allicin Combined Treatment on the Phenotype of Colitis
3.3.2. Regulation of Vitamin C/Allicin Combined Treatment on the Promotion of Pro-Inflammatory Cytokines
3.3.3. Impact of Vitamin C/Allicin Combined Treatment on the Fecal Microbial Diversity of DSS-Treated Mice
3.3.4. Impact of Vitamin C/Allicin Combined Treatment on the Fecal Microbial Composition of DSS-Treated Mice
3.3.5. Impact of Vitamin C/Allicin Combined Treatment on the Fecal Microbial Functions of DSS-Treated Mice
4. Discussion
4.1. Vitamin C/Allicin Can Ameliorate the Symptoms of Colitis in Mice
4.2. Vitamin C/Allicin Can Diminish the Expression of Inflammatory Factors in the Colon of Mice with Colitis
4.3. Vitamin C/Allicin Can Effectively Regulate the Fecal Microbial Diversity, Composition, and Function in DSS-Treated Mice
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Wang, H.; Wang, H.; Liang, X.; Wang, J.; Qiu, X.; Wang, C.; Li, G. Infiltration Simulation and System Design of Biogas Slurry Drip Irrigation Using HYDRUS Model. Comput. Electron. Agric. 2024, 218, 108682. [Google Scholar] [CrossRef]
- Tang, Y.; Luo, L.; Carswell, A.; Misselbrook, T.; Shen, J.; Han, J. Changes in Soil Organic Carbon Status and Microbial Community Structure Following Biogas Slurry Application in a Wheat-Rice Rotation. Sci. Total Environ. 2021, 757, 143786. [Google Scholar] [CrossRef] [PubMed]
- Wang, Z.; Sanusi, I.A.; Wang, J.; Ye, X.; Kana, E.B.G.; Olaniran, A.O.; Shao, H. Developments and Prospects of Farmland Application of Biogas Slurry in China—A Review. Microorganisms 2023, 11, 2675. [Google Scholar] [CrossRef]
- Liang, X.; Wang, C.; Wang, H.; Yao, Z.; Qiu, X.; Wang, J.; He, W. Biogas Slurry Topdressing as Replacement of Chemical Fertilizers Reduces Leaf Senescence of Maize by Up-Regulating Tolerance Mechanisms. J. Environ. Manag. 2023, 344, 118433. [Google Scholar] [CrossRef]
- Zhang, M.; Yao, Y.; Tian, Y.; Ceng, K.; Zhao, M.; Zhao, M.; Yin, B. Increasing Yield and N Use Efficiency with Organic Fertilizer in Chinese Intensive Rice Cropping Systems. Field Crops Res. 2018, 227, 102–109. [Google Scholar] [CrossRef]
- Ibrahim, M.; Khan, A.; Anjum; Ali, W.; Akbar, H. Mulching Techniques: An Approach for Offsetting Soil Moisture Deficit and Enhancing Manure Mineralization during Maize Cultivation. Soil Tillage Res. 2020, 200, 104631. [Google Scholar] [CrossRef]
- Li, N.; Yang, X.; Liu, J.; Liu, Y.; Chen, Q.; Wu, F.; Chang, R. Effect of Raw Material and Application Rate of Biogas Slurry on Cucumber Growth, Fusarium Wilt Suppression, and Soil Properties. Environ. Technol. Innov. 2023, 32, 103396. [Google Scholar] [CrossRef]
- Harbaum-Piayda, B.; Walter, B.; Bengtsson, G.B.; Hubbermann, E.M.; Bilger, W.; Schwarz, K. Influence of Pre-Harvest UV-B Irradiation and Normal or Controlled Atmosphere Storage on Flavonoid and Hydroxycinnamic Acid Contents of Pak Choi (Brassica campestris L. Ssp. Chinensis Var. Communis). Postharvest Biol. Technol. 2010, 56, 202–208. [Google Scholar] [CrossRef]
- Yu, K.; Zhou, L.; Xu, J.; Jiang, F.; Zhong, Z.; Zou, L.; Liu, W. Carboxymethyl Cellulose-Based Water Barrier Coating Regulated Postharvest Quality and ROS Metabolism of Pakchoi (Brassica chinensis L.). Postharvest Biol. Technol. 2022, 185, 111804. [Google Scholar] [CrossRef]
- Susa, F.; Pisano, R. Advances in Ascorbic Acid (Vitamin C) Manufacturing: Green Extraction Techniques from Natural Sources. Processes 2023, 11, 3167. [Google Scholar] [CrossRef]
- Mazzara, E.; Caprioli, G.; Simonelli, G.; Mustafa, A.M.; Maggi, F.; Cespi, M. Microwave Hydrodiffusion and Gravity Extraction of Vitamin C and Antioxidant Compounds from Rosehips (Rosa canina L.). Foods 2023, 12, 3051. [Google Scholar] [CrossRef] [PubMed]
- Khan, I.; Ullah, N.; Zha, L.; Bai, Y.; Khan, A.; Zhao, T.; Che, T.; Zhang, C. Alteration of Gut Microbiota in Inflammatory Bowel Disease (IBD): Cause or Consequence? IBD Treatment Targeting the Gut Microbiome. Pathogens 2019, 8, 126. [Google Scholar] [CrossRef]
- Bhol, N.K.; Bhanjadeo, M.M.; Singh, A.K.; Dash, U.C.; Ojha, R.R.; Majhi, S.; Duttaroy, A.K.; Jena, A.B. The Interplay between Cytokines, Inflammation, and Antioxidants: Mechanistic Insights and Therapeutic Potentials of Various Antioxidants and Anti-Cytokine Compounds. Biomed. Pharmacother. 2024, 178, 117177. [Google Scholar] [CrossRef]
- Lykkesfeldt, J.; Carr, A.C. Vitamin C. Adv. Nutr. 2024, 15, 100155. [Google Scholar] [CrossRef] [PubMed]
- Zhitkovich, A. Nuclear and Cytoplasmic Functions of Vitamin C. Chem. Res. Toxicol. 2020, 33, 2515–2526. [Google Scholar] [CrossRef] [PubMed]
- De Nuccio, F.; Cianciulli, A.; Porro, C.; Kashyrina, M.; Ruggiero, M.; Calvello, R.; Miraglia, A.; Nicolardi, G.; Lofrumento, D.D.; Panaro, M.A. Inflammatory Response Modulation by Vitamin C in an MPTP Mouse Model of Parkinson’s Disease. Biology 2021, 10, 1155. [Google Scholar] [CrossRef] [PubMed]
- Salehi, B.; Zucca, P.; Orhan, I.E.; Azzini, E.; Adetunji, C.O.; Mohammed, S.A.; Banerjee, S.K.; Sharopov, F.; Rigano, D.; Sharifi-Rad, J.; et al. Allicin and Health: A Comprehensive Review. Trends Food Sci. Technol. 2019, 86, 502–516. [Google Scholar] [CrossRef]
- Zhang, C.; He, X.; Sheng, Y.; Yang, C.; Xu, J.; Zheng, S.; Liu, J.; Xu, W.; Luo, Y.; Huang, K. Allicin-Induced Host-Gut Microbe Interactions Improves Energy Homeostasis. FASEB J. 2020, 34, 10682–10698. [Google Scholar] [CrossRef]
- Yuan, Y.; Lu, L.; Bo, N.; Chaoyue, Y.; Haiyang, Y. Allicin Ameliorates Intestinal Barrier Damage via Microbiota-Regulated Short-Chain Fatty Acids-TLR4/MyD88/NF-κB Cascade Response in Acrylamide-Induced Rats. J. Agric. Food Chem. 2021, 69, 12837–12852. [Google Scholar] [CrossRef]
- Shi, L.; Lin, Q.; Li, X.; Nie, Y.; Sun, S.; Deng, X.; Wang, L.; Lu, J.; Tang, Y.; Luo, F. Alliin, a Garlic Organosulfur Compound, Ameliorates Gut Inflammation through MAPK-NF-κB/AP-1/STAT-1 Inactivation and PPAR-γ Activation. Mol. Nutr. Food Res. 2017, 61, 1601013. [Google Scholar] [CrossRef]
- Pan, J.; Shen, J.; Zhou, Z.; Xin, Y.; Huang, Z.; Xiong, J.; Liu, Y.; Cui, X.; Liu, Y. Sustainable Management of Biogas Slurry Discharge in Biogas Engineering: As a Chemical Fertilizer Substitute for Garlic Cultivation. BioRes 2024, 20, 790–808. [Google Scholar] [CrossRef]
- Yan, H.; Lu, R.; Liu, Y.; Cui, X.; Wang, Y.; Yu, Z.; Ruan, R.; Zhang, Q. Development of Microalgae-Bacteria Symbiosis System for Enhanced Treatment of Biogas Slurry. Bioresour. Technol. 2022, 354, 127187. [Google Scholar] [CrossRef] [PubMed]
- Yan, H.; Gu, Z.; Zhang, Q.; Wang, Y.; Cui, X.; Liu, Y.; Yu, Z.; Ruan, R. Detoxification of Copper and Zinc from Anaerobic Digestate Effluent by Indigenous Bacteria: Mechanisms, Pathways and Metagenomic Analysis. J. Hazard. Mater. 2024, 469, 133993. [Google Scholar] [CrossRef]
- Klimczak, I.; Gliszczyńska-Świgło, A. Comparison of UPLC and HPLC Methods for Determination of Vitamin C. Food Chem. 2015, 175, 100–105. [Google Scholar] [CrossRef]
- Li, X.; Luo, J.; Zhang, C.; Liu, L.; Ou, S.; Zhang, G.; Peng, X. Alliin Protects against Inflammatory Bowel Disease by Preserving the Gene Expression in Colonic Epithelial Cells Rather than Altering Gut Microbiota. J. Funct. Foods 2019, 59, 309–318. [Google Scholar] [CrossRef]
- Han, D.; Guan, X.; Zhu, F.; Yang, Q.; Su, D. Oral Aged Garlic (Allium sativum) Alleviates Ulcerative Colitis in Mice by Improving Gut Homeostasis. Food Funct. 2024, 15, 8935–8951. [Google Scholar] [CrossRef]
- Dai, W.; Song, X.; Wang, R.; He, W.; Yin, J.; Nie, S. Mechanism Exploration of Intestinal Mucus Penetration of Nano-Se: Regulated by Polysaccharides with Different Functional Groups and Molecular Weights. J. Control. Release 2025, 379, 524–536. [Google Scholar] [CrossRef]
- Ma, L.; Ni, L.; Yang, T.; Mao, P.; Huang, X.; Luo, Y.; Jiang, Z.; Hu, L.; Zhao, Y.; Fu, Z.; et al. Preventive and Therapeutic Spermidine Treatment Attenuates Acute Colitis in Mice. J. Agric. Food Chem. 2021, 69, 1864–1876. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Gao, R.; Tian, S.; Wang, J.; Zhu, W. Galacto-Oligosaccharides Improve Barrier Function and Relieve Colonic Inflammation via Modulating Mucosa-Associated Microbiota Composition in Lipopolysaccharides-Challenged Piglets. J. Anim. Sci. Biotechnol. 2021, 12, 92. [Google Scholar] [CrossRef]
- Jiang, H.; Deng, F.; Luo, Y.; Xie, Z.; Chen, Y.; Zhou, P.; Liu, X.; Li, D. Hydrothermal Carbonization of Corn Straw in Biogas Slurry. J. Clean. Prod. 2022, 353, 131682. [Google Scholar] [CrossRef]
- Lin, Y.; Zhang, Y.; Zhang, F.; Li, R.; Hu, Y.; Yu, H.; Tuyiringire, D.; Wang, L. Effects of Bok Choy on the Dissipation of Dibutyl Phthalate (DBP) in Mollisol and Its Possible Mechanisms of Biochemistry and Microorganisms. Ecotoxicol. Environ. Saf. 2019, 181, 284–291. [Google Scholar] [CrossRef] [PubMed]
- Solti, Á.; Kovács, K.; Müller, B.; Vázquez, S.; Hamar, É.; Pham, H.D.; Tóth, B.; Abadía, J.; Fodor, F. Does a Voltage-Sensitive Outer Envelope Transport Mechanism Contributes to the Chloroplast Iron Uptake? Planta 2016, 244, 1303–1313. [Google Scholar] [CrossRef] [PubMed]
- Zhou, Q.; Zang, S.; Zhao, Z.; Li, X. Dynamic Changes of Bacterial Communities and Nitrite Character during Northeastern Chinese Sauerkraut Fermentation. Food Sci. Biotechnol. 2017, 27, 79–85. [Google Scholar] [CrossRef]
- Yi, Z.; Cui, J.; Fu, Y.; Yu, J.; Liu, H. Optimization of Light Intensity and Nitrogen Concentration in Solutions Regulating Yield, Vitamin C, and Nitrate Content of Lettuce. J. Hortic. Sci. Biotechnol. 2021, 96, 62–72. [Google Scholar] [CrossRef]
- Lee, S.K.; Kader, A.A. Preharvest and Postharvest Factors Influencing Vitamin C Content of Horticultural Crops. Postharvest Biol. Technol. 2000, 20, 207–220. [Google Scholar] [CrossRef]
- Belayneh Asfaw, T.; Getachew Tadesse, M.; Beshah Tessema, F.; Woldemichael Woldemariam, H.; Chinchkar, A.V.; Singh, A.; Upadhyay, A.; Mehari, B. Ultrasonic-Assisted Extraction and UHPLC Determination of Ascorbic Acid, Polyphenols, and Half-Maximum Effective Concentration in Citrus Medica and Ziziphus Spina-Christi Fruits Using Multivariate Experimental Design. Food Chem. X 2024, 22, 101310. [Google Scholar] [CrossRef]
- Um, M.; Han, T.-H.; Lee, J.-W. Ultrasound-Assisted Extraction and Antioxidant Activity of Phenolic and Flavonoid Compounds and Ascorbic Acid from Rugosa Rose (Rosa rugosa Thunb.) Fruit. Food Sci. Biotechnol. 2018, 27, 375–382. [Google Scholar] [CrossRef]
- Ma, C.; Yang, D.; Wang, B.; Wu, C.; Wu, Y.; Li, S.; Liu, X.; Lassen, K.; Dai, L.; Yang, S. Gasdermin D in Macrophages Restrains Colitis by Controlling cGAS-Mediated Inflammation. Sci. Adv. 2020, 6, eaaz6717. [Google Scholar] [CrossRef]
- Khan, I.; Wei, J.; Li, A.; Liu, Z.; Yang, P.; Jing, Y.; Chen, X.; Zhao, T.; Bai, Y.; Zha, L.; et al. Lactobacillus Plantarum Strains Attenuated DSS-Induced Colitis in Mice by Modulating the Gut Microbiota and Immune Response. Int. Microbiol. 2022, 25, 587–603. [Google Scholar] [CrossRef]
- Dieleman, L.A.; Palmen, M.J.H.J.; Akol, H.; Bloemena, E.; PEña, A.S.; Meuwissen, S.G.M.; Van Rees, E.P. Chronic Experimental Colitis Induced by Dextran Sulphate Sodium (DSS) Is Characterized by Th1 and TH2 Cytokines. Clin. Exp. Immunol. 1998, 114, 385–391. [Google Scholar] [CrossRef] [PubMed]
- Strober, W.; Fuss, I.J. Proinflammatory Cytokines in the Pathogenesis of Inflammatory Bowel Diseases. Gastroenterology 2011, 140, 1756–1767.e1. [Google Scholar] [CrossRef] [PubMed]
- Meduri, G.U.; Headley, S.; Kohler, G.; Stentz, F.; Tolley, E.; Umberger, R.; Leeper, K. Persistent Elevation of Inflammatory Cytokines Predicts a Poor Outcome in ARDS: Plasma IL-1β and IL-6 Levels Are Consistent and Efficient Predictors of Outcome over Time. Chest 1995, 107, 1062–1073. [Google Scholar] [CrossRef] [PubMed]
- Li, S.; Wu, B.; Fu, W.; Reddivari, L. The Anti-Inflammatory Effects of Dietary Anthocyanins against Ulcerative Colitis. Int. J. Mol. Sci. 2019, 20, 2588. [Google Scholar] [CrossRef]
- Szkaradkiewicz, A.; Marciniak, R.; Chudzicka-Strugała, I.; Wasilewska, A.; Drews, M.; Majewski, P.; Karpiński, T.; Zwoździak, B. Proinflammatory Cytokines and IL-10 in Inflammatory Bowel Disease and Colorectal Cancer Patients. Arch. Immunol. Ther. Exp. 2009, 57, 291–294. [Google Scholar] [CrossRef]
- Okayasu, I.; Hatakeyama, S.; Yamada, M.; Ohkusa, T.; Inagaki, Y.; Nakaya, R. A Novel Method in the Induction of Reliable Experimental Acute and Chronic Ulcerative Colitis in Mice. Gastroenterology 1990, 98, 694–702. [Google Scholar] [CrossRef]
- Wirtz, S.; Popp, V.; Kindermann, M.; Gerlach, K.; Weigmann, B.; Fichtner-Feigl, S.; Neurath, M.F. Chemically Induced Mouse Models of Acute and Chronic Intestinal Inflammation. Nat. Protoc. 2017, 12, 1295–1309. [Google Scholar] [CrossRef]
- Jeon, H.-J.; Yeom, Y.; Kim, Y.-S.; Kim, E.; Shin, J.-H.; Seok, P.R.; Woo, M.J.; Kim, Y. Effect of Vitamin C on Azoxymethane (AOM)/Dextran Sulfate Sodium (DSS)-Induced Colitis-Associated Early Colon Cancer in Mice. Nutr. Res. Pract. 2018, 12, 101–109. [Google Scholar] [CrossRef]
- Lai, H.; Yang, Z.; Lou, Z.; Li, F.; Xie, F.; Pan, W.; Xu, C.; Zhang, L.; Zhang, S.; Zhang, L.; et al. Root Extract of Lindera Aggregata (Sims) Kosterm. Modulates the Th17/Treg Balance to Attenuate DSS-Induced Colitis in Mice by IL-6/STAT3 Signaling Pathway. Front. Pharmacol. 2021, 12, 615506. [Google Scholar] [CrossRef]
- Dilxat, T.; Shi, Q.; Chen, X.; Liu, X. Garlic Oil Supplementation Blocks Inflammatory Pyroptosis-Related Acute Lung Injury by Suppressing the NF-κB/NLRP3 Signaling Pathway via H2S Generation. Aging 2024, 16, 6521–6536. [Google Scholar] [CrossRef]
- Jo, H.; Lee, D.; Go, C.; Jang, Y.; Chu, N.; Bae, S.; Kang, D.; Im, J.P.; Kim, Y.; Kang, J.S. Preventive Effect of Vitamin C on Dextran Sulfate Sodium (DSS)-Induced Colitis via the Regulation of IL-22 and IL-6 Production in Gulo(−/−) Mice. Int. J. Mol. Sci. 2022, 23, 10612. [Google Scholar] [CrossRef] [PubMed]
- de Vos, W.M.; Tilg, H.; Hul, M.V.; Cani, P.D. Gut Microbiome and Health: Mechanistic Insights. Gut 2022, 71, 1020–1032. [Google Scholar] [CrossRef] [PubMed]
- Torres, J.; Hu, J.; Seki, A.; Eisele, C.; Nair, N.; Huang, R.; Tarassishin, L.; Jharap, B.; Cote-Daigneault, J.; Mao, Q.; et al. Infants Born to Mothers with IBD Present with Altered Gut Microbiome That Transfers Abnormalities of the Adaptive Immune System to Germ-Free Mice. Gut 2020, 69, 42–51. [Google Scholar] [CrossRef] [PubMed]
- Wang, L.; Cen, S.; Wang, G.; Lee, Y.; Zhao, J.; Zhang, H.; Chen, W. Acetic Acid and Butyric Acid Released in Large Intestine Play Different Roles in the Alleviation of Constipation. J. Funct. Foods 2020, 69, 103953. [Google Scholar] [CrossRef]
- Balakrishnan, B.; Luckey, D.; Bodhke, R.; Chen, J.; Marietta, E.; Jeraldo, P.; Murray, J.; Taneja, V. Prevotella Histicola Protects from Arthritis by Expansion of Allobaculum and Augmenting Butyrate Production in Humanized Mice. Front. Immunol. 2021, 12, 609644. [Google Scholar] [CrossRef]
- Wang, J.; Tian, S.; Yu, H.; Wang, J.; Zhu, W. Response of Colonic Mucosa-Associated Microbiota Composition, Mucosal Immune Homeostasis, and Barrier Function to Early Life Galactooligosaccharides Intervention in Suckling Piglets. J. Agric. Food Chem. 2019, 67, 578–588. [Google Scholar] [CrossRef]
- Ouyang, J.; Lin, J.; Isnard, S.; Fombuena, B.; Peng, X.; Marette, A.; Routy, B.; Messaoudene, M.; Chen, Y.; Routy, J.-P. The Bacterium Akkermansia Muciniphila: A Sentinel for Gut Permeability and Its Relevance to HIV-Related Inflammation. Front. Immunol. 2020, 11, 645. [Google Scholar] [CrossRef]
- Dao, M.C.; Everard, A.; Aron-Wisnewsky, J.; Sokolovska, N.; Prifti, E.; Verger, E.O.; Kayser, B.D.; Levenez, F.; Chilloux, J.; Hoyles, L.; et al. Akkermansia Muciniphila and Improved Metabolic Health during a Dietary Intervention in Obesity: Relationship with Gut Microbiome Richness and Ecology. Gut 2016, 65, 426–436. [Google Scholar] [CrossRef]
- Lima, S.F.; Gogokhia, L.; Viladomiu, M.; Chou, L.; Putzel, G.; Jin, W.-B.; Pires, S.; Guo, C.-J.; Gerardin, Y.; Crawford, C.V.; et al. Transferable Immunoglobulin a–Coated Odoribacter splanchnicus in Responders to Fecal Microbiota Transplantation for Ulcerative Colitis Limits Colonic Inflammation. Gastroenterology 2022, 162, 166–178. [Google Scholar] [CrossRef]
- Konieczna, P.; Akdis, C.A.; Quigley, E.M.M.; Shanahan, F.; O’Mahony, L. Portrait of an Immunoregulatory Bifidobacterium. Gut Microbes 2012, 3, 261–266. [Google Scholar] [CrossRef]
- Duan, J.; Li, Q.; Cheng, Y.; Zhu, W.; Liu, H.; Li, F. Therapeutic Potential of Parabacteroides Distasonis in Gastrointestinal and Hepatic Disease. MedComm 2024, 5, e70017. [Google Scholar] [CrossRef] [PubMed]
- Koropatkin, N.M.; Cameron, E.A.; Martens, E.C. How Glycan Metabolism Shapes the Human Gut Microbiota. Nat. Rev. Microbiol. 2012, 10, 323–335. [Google Scholar] [CrossRef] [PubMed]
- Rawat, P.S.; Seyed Hameed, A.S.; Meng, X.; Liu, W. Utilization of Glycosaminoglycans by the Human Gut Microbiota: Participating Bacteria and Their Enzymatic Machineries. Gut Microbes 2022, 14, 2068367. [Google Scholar] [CrossRef] [PubMed]
Parameters | Value |
---|---|
Total Solids (TS in g/L) | 2.02 ± 0.12 |
Total Organic Compounds (TOC in g/L) | 1.65 ± 0.20 |
Humic Acids (HA in g/L) | 1.32 ± 0.08 |
Chemical Oxygen Demand (COD in mg/L) | 1307.58 ± 6.99 |
Name | Seedling Acceleration Stage | Strong Seedling Period | Harvesting Stage |
---|---|---|---|
BC | 2.33 | 0 | 0 |
CF | 0.0275 | 0.0355 | 0.0355 |
AFL-0.5 | 5.745912 | 7.39817 | 7.39817 |
AFL-1 | 11.49182 | 14.79634 | 14.79634 |
AFL-2 | 22.98365 | 29.59268 | 29.59268 |
Factors | Code Character | Level | ||
---|---|---|---|---|
−1 | 0 | 1 | ||
Microwave power (W) | A | 280 | 380 | 480 |
Microwave time (min) | B | 1 | 1.5 | 2 |
Liquid-to-material ratio (v/w) | C | 10 | 15 | 20 |
Gene | Primer Pairs Sequence | Product Length (bp) |
---|---|---|
IL-1β | F: TGCCACCTTTTGACAGTGATG | 138 |
R: TGATGTGCTGCTGCGAGATT | ||
IL-6 | F: TAGTCCTTCCTACCCCAATTTCC | 76 |
R: TTGGTCCTTAGCCACTCCTTC | ||
TNF-α | F: CCCTCACACTCAGATCATCTTCT | 61 |
R: GCTACGACGTGGGCTACAG | ||
GAPDH | F: AGGTCGGTGTGAACGGATTTG | 123 |
R: TGTAGACCATGTAGTTGAGGTCA |
Microwave Power (W) | Microwave Time (min) | Liquid–Solid Ratio (v/w) | Extraction Rate (%) | |
---|---|---|---|---|
1 | 413 | 1.3 | 16.4:1 | 90.51 |
2 | 413 | 1.3 | 16.4:1 | 91.25 |
3 | 413 | 1.3 | 16.4:1 | 90.29 |
Average value | 90.68 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Pan, J.; Peng, K.; Ruan, R.; Liu, Y.; Cui, X. Impact of Anaerobic Fermentation Liquid on Bok Choy and Mechanism of Combined Vitamin C from Bok Choy and Allicin in Treatment of DSS Colitis. Foods 2025, 14, 785. https://doi.org/10.3390/foods14050785
Pan J, Peng K, Ruan R, Liu Y, Cui X. Impact of Anaerobic Fermentation Liquid on Bok Choy and Mechanism of Combined Vitamin C from Bok Choy and Allicin in Treatment of DSS Colitis. Foods. 2025; 14(5):785. https://doi.org/10.3390/foods14050785
Chicago/Turabian StylePan, Junhui, Kaitao Peng, Roger Ruan, Yuhuan Liu, and Xian Cui. 2025. "Impact of Anaerobic Fermentation Liquid on Bok Choy and Mechanism of Combined Vitamin C from Bok Choy and Allicin in Treatment of DSS Colitis" Foods 14, no. 5: 785. https://doi.org/10.3390/foods14050785
APA StylePan, J., Peng, K., Ruan, R., Liu, Y., & Cui, X. (2025). Impact of Anaerobic Fermentation Liquid on Bok Choy and Mechanism of Combined Vitamin C from Bok Choy and Allicin in Treatment of DSS Colitis. Foods, 14(5), 785. https://doi.org/10.3390/foods14050785