Molecular Survey on A, B, C and New Avian Metapneumovirus (aMPV) Subtypes in Wild Birds of Northern-Central Italy
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Sample and Data Collection
2.2. Molecular Analyses
2.3. Phylogenetic Analyses
3. Results
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Acknowledgments
Conflicts of Interest
References
- Buys, S.B.; Du Preez, J.H. A preliminary report on the isolation of a virus causing sinusitis in turkeys in South Africa and attempts to attenuate the virus. Turkeys 1980, 28, 36. [Google Scholar]
- Cook, J.K.A. Avian Pneumovirus Infections of Turkeys and Chickens. Vet. J. 2000, 160, 118–125. [Google Scholar] [CrossRef]
- Suarez, D.L.; Miller, P.J.; Koch, G.; Mundt, E.; Rautenschlein, S. Newcastle Disease, Other Avian Paramyxoviruses, and Avian Metapneumovirus Infections. In Diseases of Poultry; Wiley: Hoboken, NJ, USA, 2020; pp. 109–166. ISBN 9781119371199. [Google Scholar]
- Htut Aung, Y.; Liman, M.; Neumann, U.; Rautenschlein, S. Reproducibility of swollen sinuses in broilers by experimental infection with avian metapneumovirus subtypes A and B of turkey origin and their comparative pathogenesis. Avian Pathol. 2008, 37, 65–74. [Google Scholar] [CrossRef] [Green Version]
- Cook, J.K.A. Avian rhinotracheitis. Rev. Sci. Tech. L’OIE 2000, 19, 602–613. [Google Scholar] [CrossRef] [PubMed]
- Cook, J.K.A.; Orthel, F.; Woods, M.A.; Orbell, S.J.; Baxendale, W.; Huggins, M.B. Avian pneumovirus infection of laying hens: Experimental studies. Avian Pathol. 2000, 29, 545–556. [Google Scholar] [CrossRef] [PubMed]
- Cook, J.K.A.; Cavanagh, D. Detection and differentiation of avian pneumoviruses (metapneumoviruses). Avian Pathol. 2002, 31, 117–132. [Google Scholar] [CrossRef] [PubMed]
- Collins, M.S.; Gough, R.E.; Alexander, D.J. Antigenic differentiation of avian pneumovirus isolates using polyclonal antisera and mouse monoclonal antibodies. Avian Pathol. 1993, 22, 469–479. [Google Scholar] [CrossRef]
- Juhasz, K.; Easton, A.J. Extensive sequence variation in the attachment (G) protein gene of avian pneumovirus: Evidence for two distinct subgroups. J. Gen. Virol. 1994, 75, 2873–2880. [Google Scholar] [CrossRef]
- McDougall, J.S.; Cook, J.K. Turkey rhinotracheitis: Preliminary investigations. Vet. Rec. 1986, 118, 206–207. [Google Scholar] [CrossRef]
- Giraud, P.; Bennejean, G.; Guittet, M.; Toquin, D. Turkey rhinotracheitis in France: Preliminary investigations on a ciliostatic virus. Vet. Rec. 1986, 119, 606–607. [Google Scholar]
- Seal, B.S. Matrix protein gene nucleotide and predicted amino acid sequence demonstrate that the first US avian pneumovirus isolate is distinct from European strains. Virus Res. 1998, 58, 45–52. [Google Scholar] [CrossRef]
- Bennett, R.S.; Nezworski, J.; Velayudhan, B.T.; Nagaraja, K.V.; Zeman, D.H.; Dyer, N.; Graham, T.; Lauer, D.C.; Njenga, M.K.; Halvorson, D.A. Evidence of avian pneumovirus spread beyond minnesota among wild and domestic birds in central North America. Avian Dis. 2004, 48, 902–908. [Google Scholar] [CrossRef]
- Turpin†, E.A.; Stallknecht, D.E.; Slemons, R.D.D.; Zsak, L.; Swayne, D.E.; Turpin, E.A.; Stallknecht, D.E.; Slemons, R.D.D.; Zsak, L.; Swayne, D.E. Evidence of avian metapneumovirus subtype C infection of wild birds in Georgia, South Carolina, Arkansas and Ohio, USA. Avian Pathol. 2008, 37, 343–351. [Google Scholar] [CrossRef] [PubMed]
- Toquin, D.; Guionie, A.O.; Jestin, A.V.; Zwingelstein, A.F.; Allee, A.C.; Eterradossi, A.N.; Guionie, O.; Jestin, V.; Zwingelstein, F.; Allee, C.; et al. European and American subgroup C isolates of avian metapneumovirus belong to different genetic lineages. Virus Genes 2006, 32, 97–103. [Google Scholar] [CrossRef]
- Bayon-Auboyer, M.H.; Arnauld, C.; Toquin, D.; Eterradossi, N. Nucleotide sequences of the F, L and G protein genes of two non-A/non-B avian pneumoviruses (APV) reveal a novel APV subgroup. J. Gen. Virol. 2000, 81, 2723–2733. [Google Scholar] [CrossRef] [PubMed]
- Brown, P.A.; Allée, C.; Courtillon, C.; Szerman, N.; Lemaitre, E.; Toquin, D.; Mangart, J.-M.M.; Amelot, M.; Eterradossi, N. Host specificity of avian metapneumoviruses. Avian Pathol. 2019, 48, 311–318. [Google Scholar] [CrossRef]
- Franzo, G.; Legnardi, M.; Mescolini, G.; Tucciarone, C.M.; Lupini, C.; Quaglia, G.; Catelli, E.; Cecchinato, M. Avian Metapneumovirus subtype B around Europe: A phylodynamic reconstruction. Vet. Res. 2020, 51, 88. [Google Scholar] [CrossRef]
- Mescolini, G.; Lupini, C.; Franzo, G.; Quaglia, G.; Legnardi, M.; Cecchinato, M.; Tucciarone, C.M.; Blanco, A.; Turblin, V.; Biarnés, M.; et al. What is new on molecular characteristics of Avian metapneumovirus strains circulating in Europe? Transbound. Emerg. Dis. 2021, 68, 1314–1322. [Google Scholar] [CrossRef]
- Goyal, S.M.; Lauer, D.; Friendshuh, K.; Halvorson, D.A. Seroprevalence of avian pneumovirus in Minnesota turkeys. Avian Dis. 2003, 47, 700–706. [Google Scholar] [CrossRef]
- van Boheemen, S.; Bestebroer, T.M.; Verhagen, J.H.; Osterhaus, A.D.M.E.M.E.; Pas, S.D.; Herfst, S.; Fouchier, R.A.M.M. A family-wide rt-pcr assay for detection of paramyxoviruses and application to a large-scale surveillance study. PLoS ONE 2012, 7, e34961. [Google Scholar] [CrossRef] [Green Version]
- Graziosi, G.; Mescolini, G.; Silveira, F.; Lupini, C.; Tucciarone, C.M.; Franzo, G.; Cecchinato, M.; Legnardi, M.; Gobbo, F.; Terregino, C.; et al. First detection of avian metapneumovirus subtype C Eurasian lineage in a Eurasian wigeon (Mareca penelope) wintering in Northeastern Italy: An additional hint on the role of migrating birds in the viral epidemiology. Avian Pathol. 2022, 51, 1–8. [Google Scholar] [CrossRef] [PubMed]
- Lee, E.H.; Song, M.S.; Shin, J.Y.; Lee, Y.M.; Kim, C.J.; Lee, Y.S.; Kim, H.; Choi, Y.K. Genetic characterization of avian metapneumovirus subtype C isolated from pheasants in a live bird market. Virus Res. 2007, 128, 18–25. [Google Scholar] [CrossRef] [PubMed]
- Sun, S.; Chen, F.; Cao, S.; Liu, J.; Lei, W.; Li, G.; Song, Y.; Lu, J.; Liu, C.; Qin, J.; et al. Isolation and characterization of a subtype C avian metapneumovirus circulating in Muscovy ducks in China. Vet. Res. 2014, 45, 1–13. [Google Scholar] [CrossRef] [PubMed]
- Wei, L.; Zhu, S.; Yan, X.; Wang, J.; Zhang, C.; Liu, S.; She, R.; Hu, F.; Quan, R.; Liu, J. Avian metapneumovirus subgroup C infection in chickens, China. Emerg. Infect. Dis. 2013, 19, 1092–1094. [Google Scholar] [CrossRef] [PubMed]
- Rizotto, L.S.; Simão, R.M.; Scagion, G.P.; Simasaki, A.A.; Caserta, L.C.; Benassi, J.C.; Arns, C.W.; Ferreira, H.L. Detection of avian metapneumovirus subtype A from wild birds in the State of São Paulo, Brazil. Pesqui. Veterinária Bras. 2019, 39, 209–213. [Google Scholar] [CrossRef]
- Felippe, P.A.; da Silva, L.H.A.; dos Santos, M.B.; Sakata, S.T.; Arns, C.W. Detection of and phylogenetic studies with avian metapneumovirus recovered from feral pigeons and wild birds in Brazil. Avian Pathol. 2011, 40, 445–452. [Google Scholar] [CrossRef] [Green Version]
- Jardine, C.M.; Parmley, E.J.; Buchanan, T.; Nituch, L.; Ojkic, D. Avian metapneumovirus subtype C in Wild Waterfowl in Ontario, Canada. Transbound. Emerg. Dis. 2018, 65, 1098–1102. [Google Scholar] [CrossRef]
- Shin, H.J.; Njenga, M.K.; McComb, B.; Halvorson, D.A.; Nagaraja, K.V. Avian pneumovirus (APV) RNA from wild and sentinel birds in the United States has genetic homology with RNA from APV isolates from domestic turkeys. J. Clin. Microbiol. 2000, 38, 4282–4284. [Google Scholar] [CrossRef] [Green Version]
- Heffels-Redmann, U.; Neumann, U.; Braune, S.; Cook, J.K.A.; Pruter, J. Serological Evidence for Susceptibility of Sea Gulls to Avian Pneumovirus (APV) Infection. In Proceedings of the International Symposium on Infectious Bronchitis and Pneumovirus Infections in Poultry, Rauischholzhausen, Germany, 15–18 June 1998; World Veterinary Poultry Association and Institut fur Geflugelkrankheiten: Rauischholzhausen, Germany, 1998; pp. 23–25. [Google Scholar]
- Canuti, M.; Kroyer, A.N.K.; Ojkic, D.; Whitney, H.G.; Robertson, G.J.; Lang, A.S. Discovery and characterization of novel rna viruses in aquatic North American wild birds. Viruses 2019, 11, 768. [Google Scholar] [CrossRef] [Green Version]
- Retallack, H.; Clubb, S.; DeRisi, J.L. Genome sequence of a divergent avian Metapneumovirus from a monk parakeet (Myiopsitta monachus). Microbiol. Resour. Announc. 2019, 8, e00284-19. [Google Scholar] [CrossRef] [Green Version]
- Cecchinato, M.; Catelli, E.; Lupini, C.; Ricchizzi, E.; Clubbe, J.; Battilani, M.; Naylor, C.J. Avian metapneumovirus (AMPV) attachment protein involvement in probable virus evolution concurrent with mass live vaccine introduction. Vet. Microbiol. 2010, 146, 24–34. [Google Scholar] [CrossRef] [PubMed]
- Shin, H.J.; Rajashekara, G.; Jirjis, F.F.; Shaw, D.P.; Goyal, S.M.; Halvorson, D.A.; Nagaraja, K.V. Specific detection of avian pneumovirus (APV) US isolates by RT-PCR. Arch. Virol. 2000, 145, 1239–1246. [Google Scholar] [CrossRef] [PubMed]
- Bäyon-Auboyer, M.H.; Jestin, V.; Toquin, D.; Cherbonnel, M.; Eterradossi, N. Comparison of F-, G- and N-based RT-PCR protocols with conventional virological procedures for the detection and typing of turkey rhinotracheitis virus. Arch. Virol. 1999, 144, 1091–1109. [Google Scholar] [CrossRef] [PubMed]
- Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular evolutionary genetics analysis across computing platforms. Mol. Biol. Evol. 2018, 35, 1547–1549. [Google Scholar] [CrossRef]
- Gobbo, F.; Fornasiero, D.; De Marco, M.A.; Zecchin, B.; Mulatti, P.; Delogu, M.; Terregino, C. Active surveillance for highly pathogenic avian influenza viruses in wintering waterbirds in northeast Italy, 2020–2021. Microorganisms 2021, 9, 2188. [Google Scholar] [CrossRef]
- Adlhoch, C.; Fusaro, A.; Gonzales, J.L.; Kuiken, T.; Marangon, S.; Niqueux, É.; Staubach, C.; Terregino, C.; Aznar, I.; Muñoz Guajardo, I.; et al. Avian influenza overview September–December 2021. EFSA J. 2021, 19, e07108. [Google Scholar] [CrossRef]
- Legnardi, M.; Allée, C.; Franzo, G.; Cecchinato, M.; Brown, P. Research Note: Detection of Avian metapneumovirus subgroup C specific antibodies in a mallard flock in Italy. Poult. Sci. 2021, 100, 101186. [Google Scholar] [CrossRef]
- Wille, M.; Lindqvist, K.; Muradrasoli, S.; Olsen, B.; Järhult, J.D. Urbanization and the dynamics of RNA viruses in Mallards (Anas platyrhynchos). Infect. Genet. Evol. 2017, 51, 89–97. [Google Scholar] [CrossRef]
- Baratti, M.; Baccetti, N.; Cordaro, M.; Mori, A.; Dessì-Fulgheri, F. Investigating the puzzling genetic structure of mallard populations (Anas platyrhynchos L.) in Italy. Eur. J. Wildl. Res. 2015, 61, 81–89. [Google Scholar] [CrossRef]
- Shin, H.J.; Cameron, K.T.; Jacobs, J.A.; Turpin, E.A.; Halvorson, D.A.; Goyal, S.M.; Nagaraja, K.V.; Kumar, M.C.; Lauer, D.C.; Seal, B.S.; et al. Molecular epidemiology of subgroup C avian pneumoviruses isolated in the United States and comparison with subgroup A and B viruses. J. Clin. Microbiol. 2002, 40, 1687–1693. [Google Scholar] [CrossRef] [Green Version]
- Latorre-Margalef, N.; Tolf, C.; Grosbois, V.; Avril, A.; Bengtsson, D.; Wille, M.; Osterhaus, A.D.M.E.; Fouchier, R.A.M.; Olsen, B.; Waldenström, J. Long-term variation in influenza A virus prevalence and subtype diversity in migratory mallards in northern Europe. Proc. R. Soc. B Biol. Sci. 2014, 281, 20140098. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tolf, C.; Wille, M.; Haidar, A.K.; Avril, A.; Zohari, S.; Waldenström, J. Prevalence of avian paramyxovirus type 1 in Mallards during autumn migration in the western Baltic Sea region. Virol. J. 2013, 10, 285. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Muradrasoli, S.; Mohamed, N.; Hornyák, Á.; Fohlman, J.; Olsen, B.; Belák, S.; Blomberg, J. Broadly targeted multiprobe QPCR for detection of coronaviruses: Coronavirus is common among mallard ducks (Anas platyrhynchos). J. Virol. Methods 2009, 159, 277–287. [Google Scholar] [CrossRef] [PubMed]
- Wille, M.; Avril, A.; Tolf, C.; Schager, A.; Larsson, S.; Borg, O.; Olsen, B.; Waldenström, J. Temporal dynamics, diversity, and interplay in three components of the virodiversity of a Mallard population: Influenza A virus, avian paramyxovirus and avian coronavirus. Infect. Genet. Evol. 2015, 29, 129–137. [Google Scholar] [CrossRef] [PubMed]
- Atkinson, P.; Clark, J.; Delany, S.; Diagana, C.; du Feu, C.; Fiedler, W.; Fransson, T.; Gaulthier-Clerc, M.; Grantham, M.; Gschweng, M.; et al. Urgent Preliminary Assessment of Ornithological Data Relevant to the Spread of Avian Influenza in Europe. Report to the European Comission. Study Contract N°07010401/2005/425926/MAR/B4. 2006. Available online: https://ec.europa.eu/environment/nature/conservation/wildbirds/birdflue/docs/rep_spread_avian_influenza_report.pdf (accessed on 17 July 2022).
Primer/Probe | Sequence 5′→3′ | Position |
---|---|---|
aMPV A Forward | CACCCAGGAGCAGCCAACTA | 6333–6352 a |
aMPV A Probe | 5′HEX TGCTGGAGTCGCACTTGGTGC 3′BHQ1 | 6355–6375 a |
aMPV A Reverse | TGTTCGAGCCGTTTGTAATCCTC | 6386–6408 a |
aMPV B Forward | TGGGCAGAAAATGGATCCTTACA | 6209–6231 b |
aMPV B Probe | 5′FAM GGCGACTGGAGCAGGAAAGTTTGA 3′BHQ1 | 6301–6324 b |
aMPV B Reverse | CCATCAACAACTTGCACATACCC | 6332–6354 b |
aMPV C Forward | CAAGGGATCCAGAGGTGAGG | 6427–6446 c |
aMPV C Probe | 5′TAMRA CAAGCCCCAGGCCAATGAAG 3′BHQ2 | 6461–6480 c |
aMPV C Reverse | GAGGTTCCTGCTTGGGTTTG | 6487–6506 c |
aMPV PAR-05 Forward | GCGAAACCGATCCAAGACTC | 6543–6562 d |
aMPV PAR-05 Probe | 5′CY5 CACACAAGCAGACCACAACAACAGA 3′BHQ3 | 6595–6619 d |
aMPV PAR-05 Reverse | GAATCTTTGGGGCTTGCTTG | 6629–6648 d |
aMPV GuMPV B29 Forward | AAGTTGCGGAGTCAGTGCAA | 12240–12259 e |
aMPV GuMPV B29 Probe | 5′FAM CAGGGAGGAGCCCTCGTCAA 3′BHQ1 | 12281–12300 e |
aMPV GuMPV B29 Reverse | CGGTGGCACTATGTCGATGT | 12326–12345 e |
Bird | Order | Species | N. of Samples |
---|---|---|---|
Mallard | Anseriformes | Anas platyrhynchos | 862 * |
Eurasian teal | Anseriformes | Anas crecca | 261 |
Garganey | Anseriformes | Spatula querquedula | 256 |
Eurasian wigeon | Anseriformes | Mareca penelope | 230 |
Northern shoveler | Anseriformes | Spatula clypeata | 70 |
Eurasian reed warbler | Passeriformes | Acrocephalus scirpaceus | 41 |
Eurasian blackcap | Passeriformes | Sylvia atricapilla | 41 |
Gadwall | Anseriformes | Mareca strepera | 37 |
Cetti’s warbler | Passeriformes | Cettia cetti | 24 |
Northern pintail | Anseriformes | Anas acuta | 21 |
Marsh warbler | Passeriformes | Acrocephalus palustris | 17 |
Great cormorant | Suliformes | Phalacrocorax carbo | 10 |
Melodious warbler | Passeriformes | Hippolais polyglotta | 8 |
Common nightingale | Passeriformes | Luscinia megarhynchos | 7 |
Common kingfisher | Coraciiformes | Alcedo atthis | 6 |
Great tit | Passeriformes | Parus major | 6 |
Common blackbird | Passeriformes | Turdus merula | 6 |
Long-tailed tit | Passeriformes | Aegithalos caudatus | 4 |
Common moorhen | Gruiformes | Gallinula chloropus | 4 |
Common pochard | Anseriformes | Aythya ferina | 3 |
Italian sparrow | Passeriformes | Passer italiae | 3 |
European robin | Passeriformes | Erithacus rubecula | 2 |
Common pheasant | Galliformes | Phasianus colchicus | 2 |
Great reed warbler | Passeriformes | Acrocephalus arundinaceus | 1 |
Greylag goose | Anseriformes | Anser anser | 1 |
Cattle egret | Pelecaniformes | Bubulcus ibis | 1 |
Black woodpecker | Piciformes | Dryocopus martius | 1 |
Eurasian coot | Gruiformes | Fulica atra | 1 |
Common chiffchaff | Passeriformes | Phylloscopus collybita | 1 |
European green woodpecker | Piciformes | Picus viridis | 1 |
Water rail | Gruiformes | Rallus aquaticus | 1 |
Common starling | Passeriformes | Sturnus vulgaris | 1 |
Unknown bird | - | - | 2 |
Total | 1932 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Tucciarone, C.M.; Franzo, G.; Legnardi, M.; Pasotto, D.; Lupini, C.; Catelli, E.; Quaglia, G.; Graziosi, G.; Dal Molin, E.; Gobbo, F.; et al. Molecular Survey on A, B, C and New Avian Metapneumovirus (aMPV) Subtypes in Wild Birds of Northern-Central Italy. Vet. Sci. 2022, 9, 373. https://doi.org/10.3390/vetsci9070373
Tucciarone CM, Franzo G, Legnardi M, Pasotto D, Lupini C, Catelli E, Quaglia G, Graziosi G, Dal Molin E, Gobbo F, et al. Molecular Survey on A, B, C and New Avian Metapneumovirus (aMPV) Subtypes in Wild Birds of Northern-Central Italy. Veterinary Sciences. 2022; 9(7):373. https://doi.org/10.3390/vetsci9070373
Chicago/Turabian StyleTucciarone, Claudia Maria, Giovanni Franzo, Matteo Legnardi, Daniela Pasotto, Caterina Lupini, Elena Catelli, Giulia Quaglia, Giulia Graziosi, Emanuela Dal Molin, Federica Gobbo, and et al. 2022. "Molecular Survey on A, B, C and New Avian Metapneumovirus (aMPV) Subtypes in Wild Birds of Northern-Central Italy" Veterinary Sciences 9, no. 7: 373. https://doi.org/10.3390/vetsci9070373