The Protein Response of Salt-Tolerant Zygosaccharomyces rouxii to High-Temperature Stress during the Lag Phase
Abstract
:1. Introduction
2. Materials and Methods
2.1. Measurement of Yeast Cultivation and Growth Curve
2.2. Analysis of Amino Acid of the Total Protein (AA-P)
2.3. Detection of Free Amino Acid (AA-F)
2.4. Determination of Amino Acid Composition
2.5. Eukaryotic Transcriptome Sequencing under HTS
2.5.1. Extraction and Quality Assessment of Total RNA
2.5.2. Library Preparation and Sequencing
2.5.3. Transcriptome Data Analysis
2.6. RT-qPCR Analysis
3. Results
3.1. The Effect of HTS on the Nutritional Requirements of Yeast Cells
3.2. Total Protein Content and Its Amino Acid (AA-P) Composition under Two Conditions
3.3. Free Amino Acid (AA-F) Composition under Two Conditions
3.4. Analysis from the KEGG Amino Acid Biosynthesis Pathway Map Combined with AA-F and AA-P under HTS
3.5. RT-qPCR Analysis of Proteolysis Genes under Two Conditions
4. Discussion
4.1. The Importance of the Lag Phase
4.2. The Significance of Proteolysis under Stress
4.3. Role of ARO8 Expression in Z. rouxii
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Wallace, E.W.; Kear-Scott, J.L.; Pilipenko, E.V.; Schwartz, M.H.; Laskowski, P.R.; Rojek, A.E.; Katanski, C.D.; Riback, J.A.; Dion, M.F.; Franks, A.M.; et al. Reversible, Specific, Active Aggregates of Endogenous Proteins Assemble upon Heat Stress. Cell 2015, 162, 1286–1298. [Google Scholar] [CrossRef] [PubMed]
- Leuenberger, P.; Ganscha, S.; Kahraman, A.; Cappelletti, V.; Boersema, P.J.; von Mering, C.; Claassen, M.; Picotti, P. Cell-wide analysis of protein thermal unfolding reveals determinants of thermostability. Science 2017, 355, eaai7825. [Google Scholar] [CrossRef] [PubMed]
- Thakre, P.K.; Sahu, R.K.; Tomar, R.S. Substitution of histone H3 arginine 72 to alanine leads to the deregulation of isoleucine biosynthesis in the budding yeast Saccharomyces cerevisiae. Biochem. Cell Biol. 2021, 99, 636–644. [Google Scholar] [CrossRef] [PubMed]
- Burns, G.D.; Hilal, O.E.; Sun, Z.; Reutter, K.-R.; Preston, G.M.; Augustine, A.A.; Brodsky, J.L.; Guerriero, C.J. Distinct classes of misfolded proteins differentially affect the growth of yeast compromised for proteasome function. FEBS Lett. 2021, 595, 2383–2394. [Google Scholar] [CrossRef]
- Kuechler, E.R.; Rose, A.; Bolten, M.; Madero, A.; Kammoonah, S.; Colborne, S.; Gsponer, J.; Morin, G.B.; Mayor, T. Protein feature analysis of heat shock induced ubiquitination sites reveals preferential modification site localization. J. Proteom. 2021, 239, 104182. [Google Scholar] [CrossRef]
- Benet, M.; Miguel, A.; Carrasco, F.; Li, T.; Planells, J.; Alepuz, P.; Tordera, V.; Pérez-Ortín, J.E. Modulation of protein synthesis and degradation maintains proteostasis during yeast growth at different temperatures. BBA Gene Regul. Mech. 2017, 1860, 794–802. [Google Scholar] [CrossRef]
- Mühlhofer, M.; Berchtold, E.; Stratil, C.G.; Csaba, G.; Kunold, E.; Bach, N.C.; Sieber, S.A.; Haslbeck, M.; Zimmer, R.; Buchner, J. The Heat Shock Response in Yeast Maintains Protein Homeostasis by Chaperoning and Replenishing Proteins. Cell Rep. 2019, 29, 4593–4607.e8. [Google Scholar] [CrossRef]
- Will, J.L.; Kim, H.S.; Clarke, J.; Painter, J.C.; Fay, J.C.; Gasch, A.P. Incipient Balancing Selection through Adaptive Loss of Aquaporins in Natural Saccharomyces cerevisiae Populations. PLoS Genet. 2010, 6, e1000893. [Google Scholar] [CrossRef]
- Guo, H.; Niu, C.; Liu, B.; Wei, J.; Wang, H.; Yuan, Y.; Yue, T. Protein abundance changes of Zygosaccharomyces rouxii in different sugar concentrations. Int. J. Food Microbiol. 2016, 233, 44–51. [Google Scholar] [CrossRef]
- Bertrand, R.L. Lag Phase Is a Dynamic, Organized, Adaptive, and Evolvable Period That Prepares Bacteria for Cell Division. J. Bacteriol. 2019, 201, e00697-18. [Google Scholar] [CrossRef]
- Takagi, H. Molecular mechanisms and highly functional development for stress tolerance of the yeast Saccharomyces cerevisiae. Biosci. Biotechnol. Biochem. 2021, 85, 1017–1037. [Google Scholar] [CrossRef] [PubMed]
- Zaman, K.; Pandey, P.; Shulaev, V.; Prokai, L. Global Comparative Label-Free Yeast Proteome Analysis by LC-MS/MS After High-pH Reversed-Phase Peptide Fractionation Using Solid-Phase Extraction Cartridges. Methods Mol. Biol. 2022, 2396, 71–84. [Google Scholar] [CrossRef] [PubMed]
- Canelas, A.B.; Ras, C.; ten Pierick, A.; van Dam, J.C.; Heijnen, J.J.; van Gulik, W.M. Leakage-free rapid quenching technique for yeast metabolomics. Metabolomics 2008, 4, 226–239. [Google Scholar] [CrossRef]
- Klikarova, L.F. Rapid analysis of phenyl isothiocyanate derivatives of amino acids present in Czech meads. J. Chromatogr. A 2021, 10, 462134. [Google Scholar] [CrossRef] [PubMed]
- Kim, D.; Pertea, G.; Trapnell, C.; Pimentel, H.; Kelley, R. TopHat2: Accurate alignment of transcriptomes in the presence of insertions, deletions and gene fusions. Genome Biol. 2013, 14, R36. [Google Scholar] [CrossRef] [PubMed]
- Mao, X.; Cai, T.; Olyarchuk, J.G.; Wei, L. Automated genome annotation and pathway identification using the KEGG Orthology (KO) as a controlled vocabulary. Bioinformatics 2005, 21, 3787–3793. [Google Scholar] [CrossRef]
- Love, M.I.; Huber, W.; Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014, 15, 550. [Google Scholar] [CrossRef]
- Dai, J.; Li, K.; Song, N.; Yao, W.; Xia, H.; Yang, Q.; Zhang, X.; Li, X.; Wang, Z.; Yao, L.; et al. Zygosaccharomyces rouxii, an Aromatic Yeast Isolated from Chili Sauce, Is Able to Biosynthesize 2-Phenylethanol via the Shikimate or Ehrlich Pathways. Front. Microbiol. 2020, 11, 597454. [Google Scholar] [CrossRef]
- Liu, J.; Gao, M.; He, J.; Wu, K.; Lin, S.; Jin, L.; Chen, Y.; Liu, H.; Shi, J.; Wang, X.; et al. The RNA m6A reader YTHDC1 silences retrotransposons and guards ES cell identity. Nature 2021, 591, 322–326. [Google Scholar] [CrossRef]
- Kanehisa, M.; Furumichi, M.; Sato, Y.; Kawashima, M.; Ishiguro-Watanabe, M. KEGG for taxonomy-based analysis of pathways and genomes. Nucleic Acids Res. 2022, 51, D587–D592. [Google Scholar] [CrossRef]
- Romero-Suarez, D.; Wulff, T.; Rong, Y.; Jakoiunas, T.; Jensen, M.K. A Reporter System for Cytosolic Protein Aggregates in Yeast. ACS Synth. Biol. 2021, 10, 466–477. [Google Scholar] [CrossRef] [PubMed]
- Wang, R.; Burton, J.L.; Solomon, M.J. Transcriptional and post-transcriptional regulation of Cdc20 during the spindle assembly checkpoint in S. cerevisiae. Cell. Signal. 2017, 33, 41–48. [Google Scholar] [CrossRef] [PubMed]
- Singh, B.; Bisht, K.K.; Upadhyay, U.; Kushwaha, A.C.; Nanda, J.S.; Srivastava, S.; Saini, J.K.; Klar, A.J.S.; Singh, J. Role of Cdc23/Mcm10 in generating the ribonucleotide imprint at the mat1 locus in fission yeast. Nucleic Acids Res. 2019, 47, 3422–3433. [Google Scholar] [CrossRef] [PubMed]
- Lutz, A.P.; Schladebeck, S.; Renicke, C.; Spadaccini, R.; Mösch, H.-U.; Taxis, C. Proteasome Activity Is Influenced by the HECT_2 Protein Ipa1 in Budding Yeast. Genetics 2018, 209, 157–171. [Google Scholar] [CrossRef]
- Feng, H.; Wang, S.; Dong, D.; Zhou, R.; Wang, H. Arabidopsis Ubiquitin-Conjugating Enzymes UBC7, UBC13, and UBC14 Are Required in Plant Responses to Multiple Stress Conditions. Nat. Plants 2020, 9, 723. [Google Scholar] [CrossRef] [PubMed]
- Ohkuni, K.; Suva, E.; Au, W.-C.; Walker, R.L.; Levy-Myers, R.; Meltzer, P.S.; Baker, R.E.; Basrai, M.A. Deposition of Centromeric Histone H3 Variant CENP-A/Cse4 into Chromatin Is Facilitated by Its C-Terminal Sumoylation. Genetics 2020, 214, 839–854. [Google Scholar] [CrossRef]
- Mishra, P.K.; Guo, J.; Dittman, L.E.; Haase, J.; Yeh, E.; Bloom, K.; Basrai, M.A. Pat1 protects centromere-specific histone H3 variant Cse4 from Psh1-mediated ubiquitination. Mol. Biol. Cell 2015, 26, 2067–2079. [Google Scholar] [CrossRef]
- Pick, E. The necessity of NEDD8/Rub1 for vitality and its association with mitochondria-derived oxidative stress. Redox. Biol. 2020, 37, 101765. [Google Scholar] [CrossRef]
- Malik-Chaudhry, H.K.; Gaieb, Z.; Saavedra, A.; Reyes, M.; Kung, R.; Le, F.; Morikis, D.; Liao, J. Dissecting Distinct Roles of NEDDylation E1 Ligase Heterodimer APPBP1 and UBA3 Reveals Potential Evolution Process for Activation of Ubiquitin-related Pathways. Sci. Rep. 2018, 8, 10108. [Google Scholar] [CrossRef]
- Brejning, J.; Jespersen, L.; Arneborg, N. Genome-wide transcriptional changes during the lag phase of Saccharomyces cerevisiae. Arch. Microbiol. 2003, 179, 278–294. [Google Scholar] [CrossRef]
- Alharbi, M.A.S. Aging and Recovery of Listeria Monocytogenes ScottA. Ph.D. Thesis, University of Tasmania, Hobart, Australia, 2018. [Google Scholar] [CrossRef]
- Singh, G.P.; Volpe, G.; Creely, C.M.; Grötsch, H.; Geli, I.M.; Petrov, D. The lag phase and G1 phase of a single yeast cell monitored by Raman microspectroscopy. J. Raman Spectrosc. 2006, 37, 858–864. [Google Scholar] [CrossRef]
- Shibata, K.; Obase, K.; Itoh, K.; Amemiya, T. The effects of starvation and acidification on lag phase duration of surviving yeast cells. J. Biotechnol. 2018, 275, 60–64. [Google Scholar] [CrossRef] [PubMed]
- Park, H.L.; Lee, H.Y.; Yoon, G.M.J.B.-P. In vitro Auto- and Substrate-Ubiquitination Assays. Bio-Protocol 2022, 12, e4368. [Google Scholar] [CrossRef] [PubMed]
- Cohen-Kaplan, V.; Livneh, I.; Avni, N.; Chen, C.R.; Ciechanover, A. The ubiquitin-proteasome system and autophagy: Coordinated and independent activities. Int. J. Biochem. Cell Biol. 2016, 79, 403–418. [Google Scholar] [CrossRef] [PubMed]
- Work, J.J.; Brandman, O. Adaptability of the ubiquitin-proteasome system to proteolytic and folding stressors. J. Cell Biol. 2021, 220, e201912041. [Google Scholar] [CrossRef] [PubMed]
- Hickey, C.M.; Breckel, C.; Zhang, M.; Theune, W.C.; Hochstrasser, M. Protein quality control degron-containing substrates are differentially targeted in the cytoplasm and nucleus by ubiquitin ligases. Genetics 2020, 217, iyaa031. [Google Scholar] [CrossRef]
- Cheng, H.; Bao, X.; Gan, X.; Luo, S.; Rao, H. Multiple E3s promote the degradation of histone H3 variant Cse4. Sci. Rep. 2017, 7, 8565. [Google Scholar] [CrossRef] [PubMed]
- Romagnoli, G.; Knijnenburg, T.A.; Liti, G.; Louis, E.J.; Pronk, J.T.; Daran, J.-M. Deletion of the Saccharomyces cerevisiae ARO8 gene, encoding an aromatic amino acid transaminase, enhances phenylethanol production from glucose. Yeast 2015, 32, 29–45. [Google Scholar] [CrossRef]
- Bulfer, S.L.; Brunzelle, J.S.; Trievel, R.C. Crystal structure of Saccharomyces cerevisiae Aro8, a putative α-aminoadipate aminotransferase. Protein Sci. 2013, 22, 1417–1424. [Google Scholar] [CrossRef]
- Guo, D.; Zhang, L.; Kong, S.; Liu, Z.; Hong, P. Synthesis of three major auxins from glucose in Engineered Escherichia coli. bioRxiv 2018. [Google Scholar] [CrossRef]
- Ohashi, K.; Chaleckis, R. High levels of Tryptophan reduce cell wall or membrane stress tolerance in Saccharomyces cerevisiae. Biosci. Biotechnol. Biochem. 2021, 85, 2131–2136. [Google Scholar] [CrossRef] [PubMed]
- Sun, Z.G.; Wang, M.Q.; Wang, Y.P.; Xing, S.; Xiao, D.G. Identification by comparative transcriptomics of core regulatory genes for higher alcohol production in a top-fermenting yeast at different temperatures in beer fermentation. Appl. Microbiol. Biotechnol. 2019, 103, 4917–4929. [Google Scholar] [CrossRef] [PubMed]
- Mohanan, G.; Das, A.; Rajyaguru, P.I. Genotoxic stress response: What is the role of cytoplasmic mRNA fate? Bioessays 2021, 43, 2000311. [Google Scholar] [CrossRef]
- Wang, R.; Zhao, T.; Zhuo, J.; Zhan, C.; Zhang, F.; Linhardt, R.J.; Bai, Z.; Yang, Y. MAPK/HOGsignaling pathway induced stress-responsive damage repair is a mechanism for Pichia pastoris to survive from hyperosmotic stress. J. Chem. Technol. Biotechnol. 2021, 96, 412–422. [Google Scholar] [CrossRef]
Gene | Primers | Sequence (5′→3′) |
---|---|---|
CDC20 | F | CTACATGGGCAGAGCACACA |
R | ACAGCAGCAGTATGCGTCTT | |
CDC23 | F | TTTGGTTTGGGCCAGGCTTA |
R | TCCGACGATCCCAAGGTTTC | |
PRE4 | F | CACACATGGCAAACCCACTG |
R | CGCCTCTTCAGCAACCTGTA | |
UBC7 | F | GCTGGTCCCAAATCGGAGAA |
R | CACCATCAGCGTATGGCGTA | |
CSE4 | F | AGCTTAAAGCGCGTCGAAAA |
R | CCTGTAACGCCATAATCGCC | |
PSH1 | F | GCGTCTACCAATCCGTTTGC |
R | TATGTTCTCGCATGGGCTCC | |
RUB1 | F | GAAGACACTGACTGGGAAGGAG |
R | TGTTGAGATGGTGGAATCCCT | |
UBA3 | F | CTCAAGTGGCAGCCCAGTAT |
R | TAAAAGCTCGGGGGCAAAGT | |
ARO8 | F | AACGCTACGCTATCCAGGTG |
R | CGATGGCACAGTCACGTTTC |
Gene | Enzyme Name | Function | References |
---|---|---|---|
CDC20 | A highly conserved activator of the anaphase-promoting complex (APC) | promoting cell cycle-regulated ubiquitination and proteolysis of several critical cell cycle-regulatory targets including securin and mitotic cyclins | [22] |
CDC23 | Anaphase-promoting complex subunit | shown to play a role in cyclin proteolysis | [23] |
PRE4 | Proteinase YscE | in cleavage of peptide bonds after acidic amino acids | [24] |
UBC7 | Ubiquitin-conjugating enzyme E2 | ubiquitination and proteolysis of D2 (type 2 mono deiodinase) | [25] |
CSE4 | Histone H3-like centromeric protein | the C-terminus of Cse4 contributes to CenH3 (centromeric histone H3) proteolysis | [26] |
PSH1 | an E3 ubiquitin ligase | contribute to CenH3 proteolysis | [27] |
RUB1 | A ubiquitin-like protein displaying a 53% amino acid identity to ubiquitin | the RUB1 conjugation pathway is functionally affiliated with the ubiquitin-proteasome system and may play a regulatory role | [28] |
UBA3 | E1 ubiquitin-activating enzyme | C-terminal domains of the E1 ubiquitin-activating enzyme | [29] |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Hu, N.; Xiao, X.; Yao, L.; Chen, X.; Li, X. The Protein Response of Salt-Tolerant Zygosaccharomyces rouxii to High-Temperature Stress during the Lag Phase. J. Fungi 2024, 10, 48. https://doi.org/10.3390/jof10010048
Hu N, Xiao X, Yao L, Chen X, Li X. The Protein Response of Salt-Tolerant Zygosaccharomyces rouxii to High-Temperature Stress during the Lag Phase. Journal of Fungi. 2024; 10(1):48. https://doi.org/10.3390/jof10010048
Chicago/Turabian StyleHu, Na, Xiong Xiao, Lan Yao, Xiong Chen, and Xin Li. 2024. "The Protein Response of Salt-Tolerant Zygosaccharomyces rouxii to High-Temperature Stress during the Lag Phase" Journal of Fungi 10, no. 1: 48. https://doi.org/10.3390/jof10010048