Next Article in Journal
Comparative Mitogenomics Provides Valuable Insights for the Phylogeny and New DNA Barcodes of Ganoderma
Previous Article in Journal
High-Yield-Related Genes Participate in Mushroom Production
Previous Article in Special Issue
Trichophyton indotineae Erg1Ala448Thr Strain Expressed Constitutively High Levels of Sterol 14-α Demethylase Erg11B mRNA, While Transporter MDR3 and Erg11A mRNA Expression Was Induced After Addition of Short Chain Azoles
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
JoF
Volume 10
Issue 11
10.3390/jof10110768
jof-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Trichophyton mentagrophytes ITS Genotype VIII/Trichophyton indotineae Infection and Antifungal Resistance in Bangladesh

by
Mohammed Saiful Islam Bhuiyan
1,
Shyam B. Verma
2,
Gina-Marie Illigner
3,
Silke Uhrlaß
3,
Esther Klonowski
3,
Anke Burmester
4,
Towhida Noor
5 and
Pietro Nenoff
3,*
1
Department of Dermatology and Venerology, Bangabandhu Sheikh Mujib Medical University (BSMMU), Dhaka 1000, Bangladesh
2
Nirvan & ‘In Skin Clinics’, Vadodara 390020, India
3
Labopart-Medizinische Laboratorien, D-04571 Rötha OT Mölbis, Germany
4
Department of Dermatology, Jena University Hospital, Friedrich Schiller University, D-07747 Jena, Germany
5
Matador Skin Center, Dhaka 1000, Bangladesh
*
Author to whom correspondence should be addressed.
J. Fungi 2024, 10(11), 768; https://doi.org/10.3390/jof10110768
Submission received: 8 August 2024 / Revised: 30 October 2024 / Accepted: 31 October 2024 / Published: 5 November 2024
(This article belongs to the Special Issue Advances in Human and Zoonotic Dermatophytoses)
Browse Figures
Versions Notes

Abstract

:
Trichophyton (T.) mentagrophytes ITS genotype VIII, also known as Trichophyton indotineae, is a new species of the T. mentagrophytes/T. interdigitale complex and its first records, albeit under a different species name, are from the Indian subcontinent, Middle Eastern Asia, and West Asia. T. mentagrophytes genotype VIII (T. indotineae) has spread globally and has now been documented in over 30 countries. The aim of this study was to investigate the occurrence and proportion of terbinafine- and itraconazole-resistant isolates of T. mentagrophytes ITS genotype VIII (T. indotineae) in Bangladesh. This was part of an official collaborative project between IADVL (Indian Association of Dermatologists, Venereologists, and Leprologists) and Bangabandhu Sheikh Mujib Medical University (BSMMU), Bangladesh. Over a period of 6 months, ninety-nine patients of chronic recalcitrant tinea corporis were recruited from BSMMU hospital. Species identification was performed by fungal culture and morphological observation of the upper and lower surfaces of fungal colonies, as well as by using fluorescent microscopy. In addition, a PCR (polymerase chain reaction)-ELISA was performed to group the patients into those with the T. mentagrophytes/T. interdigitale complex. The internal transcribed spacer (ITS) gene was sequenced. Samples were tested for resistance to terbinafine and itraconazole by mutational analyses of the squalene epoxidase (SQLE) and the ergosterol 11B (ERG11B) genes. A total of 79/99 samples showed a positive culture. In 76 of these isolates, T. mentagrophytes ITS genotype VIII (T. indotineae) could be reliably identified both by culture and molecular testing. Resistance testing revealed terbinafine resistance in 49 and itraconazole resistance in 21 patients. Among these, 11 patients were resistant to both the antifungal agents. Mutations L393S, L393F, F397L, and F397I of the SQLE gene were associated with terbinafine resistance. Resistance to itraconazole could not be explained by mutations in the ERG11B gene. Infections with T. mentagrophytes ITS genotype VIII (T. indotineae) have become a public health issue with potentially global ramifications. About 62% of samples from Bangladesh showed resistance to terbinafine, making oral itraconazole the most effective drug currently available, although resistance to itraconazole and both terbinafine and itraconazole also exists.

1. Introduction

In recent years, dermatology outpatient departments (OPDs) in many parts of the world, especially in the Indian subcontinent, have been faced with a huge number of patients seeking recovery from dermatophytosis [1]. At the same time, treatment of dermatophytosis with the recommended dosing duration of conventional antifungal drugs has proven difficult due to chronic, persistent, and many novel clinical manifestations. Though the precise cause of this situation is not clear, host immunity, drugs, ecosystem (global warming), geographical region, cultural habits, and the pleomorphic character of the causative fungus have been considered as potential factors [2]. Among the seven genera of dermatophytes—Arthroderma, Epidermophyton, Lophophyton, Microsporum, Nannizzia, Paraphyton, and Trichophyton-Trichophyton (T.), Microsporum, Epidermophyton, and Nannizzia are the primary pathogens for humans [2]. When considering the history of epidemiological patterns of dermatophyte infection, it is striking that the spectrum of dermatophyte species has changed over time due to human migration and socioeconomic changes. From 1930 to 1950, T. mentagrophytes (today the T. mentagrophytes/T. interdigitale complex) was the main causative agent of tinea pedis and tinea corporis, while T. rubrum was very rare in Europe before the 1940s [3]. From 1950 onwards, T. rubrum spread over the next 30 years and remained the predominant species, followed by T. mentagrophytes as the causative agent for superficial fungal diseases worldwide, except scalp infections [4]. Some studies showed that T. rubrum was responsible for about 90% of cases of chronic dermatophytosis [5]. In 2008, T. rubrum was the leading causative dermatophyte species, accounting for 80% of cases [6]. However, in 2011, Sahai et al. in India reported a dramatic epidemiological shift of the dominant dermatophyte from T. rubrum to T. mentagrophytes [7]. Other Indian studies also described the predominant role of T. mentagrophytes [8,9].
T. mentagrophytes, the most polymorphic group among dermatophytes, is considered zoophilic and is responsible for highly inflammatory dermatophytosis when infecting human hosts. It is present worldwide and has spread independently of race and geography [4]. T. interdigitale was identified by sequencing of the internal transcribed spacer (ITS) region as a clonal anthropophilic derivative of T. mentagrophytes that causes non-inflammatory lesions. Recently, T. mentagrophytes was reported as the most common dermatophyte species in India and Iran [10,11,12]. These two sibling species represent a wide number of genotypes of the ITS region, but differentiation of these two species is difficult in practice and has been summarized into a T. mentagrophytes/T. interdigitale species group (TMTISG) with a high terbinafine resistance rate [13,14]. More than 10 ITS genotypes (TMTISG) have been identified with different geographical distribution and clinical pictures [14]. Among these, ITS genotype VIII was identified as a separate species causing chronic recalcitrant dermatophytosis in India [15,16]. This terbinafine and itraconazole resistance can be detected molecularly by sequencing the squalene epoxidase and the Erg11 gene of the r-DNA [17,18]. In 2020, this terbinafine-resistant ITS genotype VIII was named as Trichophyton (T.) indotineae by Kano et al., as it was identified in one Indian and one Nepalese patient [19]. A previous case with the corresponding sequence was identified and reported from Australia in 2007 [20]. A sequence similar to that of T. mentagrophytes ITS genotype VIII (T. indotineae) was identified in a GenBank skin sample isolated from an Indian in 2004 (AB430471.1) [21]. The pathogen has spread to many countries of the Middle East, Europe, and North America. Although Bangladesh is a neighboring country of India with close foreign relations and its citizens travel irregularly between the two countries, no work on T. mentagrophytes ITS genotype VIII (T. indotineae) has been published from the country to date. Between 2008 to 2022, in fifteen published papers from different countries (none from Bangladesh), out of 100 reported cases of infection with T. mentagrophytes ITS genotype VIII (T. indotineae), 35% originated from India and 11% from Bangladesh [22,23,24,25,26,27]. The present study investigates the true extent of this new dermatophyte and its antifungal resistance pattern in Bangladesh.

2. Patients and Methods

Skin scraping samples were collected and investigated over a period of 6 months from ninety-nine patients with chronic recalcitrant tinea corporis from Bangladesh. These were patients with suspected dermatophytosis and with pronounced and highly inflammatory dermatophytia, which are characteristic of infections with T. mentagrophytes ITS genotype VIII (T. indotineae). No preliminary mycological diagnosis was performed prior to this study. Age, gender, and occupation of these patients were recorded. Duration and location of the dermatomycosis, as well as whether there was a relapse or recurrence of the symptoms, were also noted. Whether and which fixed-dose combination cream (FDC) was used and whether oral treatment with terbinafine, fluconazole, voriconazole, and itraconazole was used was also recorded. A table with the detailed data can be found in the Supplementary Materials.
Species identification was performed by fungal culture and by morphological examination of the top and bottom surfaces of the fungal colonies, as well as by fluorescent microscopy (Figure 1). The Uniplex PCR-ELISA test was used to group the patients into those with the T. mentagrophytes/T. interdigitale complex [28]. Sequencing of the ITS gene was performed. Samples were tested for resistance to terbinafine and itraconazole by mutation analysis of the squalene epoxidase (SQLE) and ERG11B genes.

2.1. PCR for Determination of the Species from Skin Scraping Samples

DNA from the skin scrapings was extracted according to the manufacturer’s protocol using the QIAamp® DNA Mini Kit (Qiagen, Hilden, Germany).
For species identification, PCR (polymerase chain reaction) was performed in which the dermatophyte DNA was amplified in the master cycler with specific primers. One primer of the primer pair was labeled with digoxigenin at the 5′ end to label the resulting PCR product with digoxigenin. The topoisomerase II gene was used for identification using the primer sequences described by Hsu et al. [29]. The master mix contained 2.5 mM MgCl2, 5* buffer with 400 mM Tris-HCl, 100 mM (NH4)2SO4, and 0.1% Tween-20 as well as 200 µM of each dNTP and the TaqDNA polymerase (Bio-Budget Technologies GmbH, Krefeld, Germany). The PCR mixture was prepared with a final volume of 30 µL. This is 6 µL master mix, 16.5 µL H2O, 0.75 µL Primer-U (20 µM primer unlabeled from biomers.net, Ulm, Germany), 0.75 µL Primer-D-Dig (primer labeled with digoxigenin, TIB Molbiol Syntheselabor GmbH, Berlin, Germany), and 6 µL DNA as template. An amount of 6 µL of water was used as a negative control and 6 µL of positive DNA as a positive control. The tubes were covered with mineral oil to prevent evaporation and contamination. The PCR program used included an initial denaturation at 95 °C for 5 min and 30 s, followed by 42 cycles: denaturation at 95 °C for 15 s, annealing at 63 °C for 20 s, extension at 72 °C for 90 s, and final extension at 72 °C for 7.7 min [30].

2.2. Visualization by PCR-ELISA for Direct Identification of Dermatophytes from Skin Scrapings

The samples were analyzed for dermatophyte DNA using a validated and standardized, in-house-developed enzyme-linked immunoassay (PCR-ELISA) [30]. Specific probes were used detecting the following relevant dermatophytes: T. rubrum, T. violaceum, T. interdigitale/T. mentagrophytes, Microsporum (M.) canis, M. audouinii, T. benhamiae (formerly referred to as T. anamorph of Arthroderma benhamiae), and Epidermophyton floccosum.
For the PCR-ELISA, the chemically denatured PCR product is hybridized after amplification with a biotinylated probe (also a sequence from the topoisomerase II gene) and bound to a streptavidin-coated solid phase. Unbound, nonspecific amplification products and DNA are removed by washing the microtiter plate. The positive reaction is indicated by color development after the addition of a peroxidase-conjugated anti-digoxigenin antibody and substrate (ABTS tablets, Roche Diagnostics Germany, Mannheim, Germany). The optical density (OD) is measured at a wavelength of 405 nm (TECAN Sunrise Photometer, Crailsheim, Germany) [28,30]. The PCR-ELISA is a culture-independent method that can be performed on all skin samples.

2.3. Identification of Dermatophyte Species by Sequencing of the Fungal DNA from Culture

ITS sequencing is used for species identification and is only performed on cultures after DNA isolation by the QIAamp® DNA Mini Kit (Qiagen, Hilden, Germany). Sequencing was performed in all samples of fungal culture material. The identification of all isolated dermatophytes was confirmed by sequencing the ITS region of the ribosomal DNA (rDNA), mainly the regions ITS 1, 5.8S rRNA, and ITS 2 [31,32,33].
The required PCR amplification of a ~900 bp DNA fragment was performed using universal primers that bind to flanking panfungal sequence regions. The following gene sequences were used as probes for sequencing of the ITS region of the rDNA: V9G 5′-TTACGTCCCTGCCCTTTGTA-3′ and LSU266 5′-GCATTCCCAAACAACTCGACTC-3′ [34]. The PCR program used included an initial denaturation at 94 °C for 5 min, followed by 42 cycles: denaturation at 94 °C for 60 s, annealing at 63 °C for 60 s, extension at 72 °C for 60 s, and final extension at 72 °C for 10 min. Red HS Master Mix (Biozym Scientific GmbH, Hessisch Oldendorf, Germany) was used for the PCR. The DNA fragment was sequenced at the Microsynth Seqlab GmbH, Göttingen, Germany.
The sequence of each strain was compared with sequences of type strains from the databases. Based on the principle of similarity search (BLASTn search), individual strains were identified down to the species level using the validated Online Dermatophyte Database of the Westerdijk Fungal Biodiversity Institute (formerly Centraalbureau voor Schimmelcultures CBS), Utrecht, The Netherlands (https://wi.knaw.nl/ (accessed on 7 August 2024)). In addition, we compared sequences of our samples with those in the comprehensive database of the National Center for Biotechnology Information (NCBI) in Bethesda, MD, USA.

2.4. In Vitro Antifungal Susceptibility Testing of Trichophyton mentagrophytes Genotype VIII (Trichophyton indotineae) and Trichophyton rubrum

The antifungal susceptibility method used is an in vitro test of T. mentagrophytes and T. rubrum based on the work of Dr. Michel Monod, Lausanne, Switzerland [35]. For this purpose, an in-house test was developed. A 4-well culture plate from SPL Life Sciences Co. (Pocheon-si., Republic of Korea) is used, filled with Sabouraud’s dextrose agar (Sifin diagnostics GmbH, Berlin, Germany) with increasing terbinafine concentrations (0 µg/mL, 0.1 µg/mL, 0.2 µg/mL, 0.5 µg/mL in individual cases up to 16 µg/mL). One cm2 of culture surface is pre-textured in 1 mL of sterile water. For inoculation, 50 µL of the suspension is added to each well. Incubation is then carried out at 28° as previously described [25,36]. Fungal growth was examined after three to four days, and any growth was recorded as resistant. In vitro susceptibility to itraconazole was tested using the same breakpoint test with itraconazole concentrations of 0.125, 0.25, and 0.5 µg/mL. Sabouraud’s dextrose agar without antifungal agents was taken as the control. Based on epidemiological cut-off values (ECOFFs) from previous research, strains were classified as resistant or sensitive to terbinafine (epidemiological cut-off value or ECOFF of 0.125 µg/mL) and to itraconazole (ECOFF 0.25 µg/mL) [36,37]. Terbinafine and itraconazole were acquired from Sigma-Aldrich®, Merck KGaA, Darmstadt, Germany.

2.5. Squalene epoxidase Gene Analysis for Terbinafine Resistance Testing of Trichophyton mentagrophytes Genotype VIII (Trichophyton indotineae)

Fungal DNA was extracted from a fresh fungal culture of T. mentagrophytes ITS genotype VIII (T. indotineae) on Sabouraud’s dextrose agar (using a QIAamp® DNA Mini Kit (Qiagen, Hilden, Germany). A square area of approximately 1.0 mm2 of the growing culture was used. The squalene epoxidase (SQLE) gene of the terbinafine-resistant clinical isolates was amplified by PCR with Red HS Master Mix (Biozym Scientific GmbH, Hessisch Oldendorf, Germany). The primer pair TrSQLE-F1 (5′ ATGGTTGTAGAGGCTCCTCCC 3′) and TrSQLE-R1 (5′ CTAGCTTTGAAGTTCGGCAAA 3′) was used, and chromosomal DNA served as the template [34] (initial denaturation: 5 min 95 °C/40 cycles/30 s 95 °C/30 s 60 °C/60 s 72 °C/final elongation 5 min 72 °C). The resulting PCR product with a length of approximately 1300 bp was sequenced at the Microsynth Seqlab GmbH, Göttingen, Germany. The sequences were aligned and screened for missense mutations using MEGA version 10.0.5 [38,39].

2.6. Mutation Analysis by PCR Using the DermaGenius® Resistance Multiplex RT-PCR

The DermaGenius® Resistance multiplex RT-PCR (PathoNostics, Maastricht, The Netherlands) is a terbinafine resistance test directly from the native sample. The test detects mutations in the squalene epoxidase gene as well as relevant Trichophyton strains [40,41,42,43]. The PCR kit used consists of ready-to-use, optimized mixtures of target-specific primers and probes for the detection and identification of the most common and clinically relevant dermatophyte species. It is based on real-time PCR technology, enabled by fluorescent probes present in the mixtures. Detection is enabled during amplification and melting curve analysis on a real-time PCR instrument that can detect fluorescence in green, yellow, orange, and red detection channels. If the melting temperature is below 64 °C, the sample has a mutation at 393 or 397 and terbinafine resistance is present. If the melting temperature is above 65 °C, the isolate does not have a mutation at 393 or 397 and there is no terbinafine resistance. DNA extracts from nail, hair, and skin material served as input material [44]. All 99 samples were tested, and the following mutations in the squalene epoxidase gene were detected: Leu393Phe, Phe397Leu, Leu393Ser, Phe397Ile, and Phe397Val.

2.7. Sequencing of the Erg11B Gene

First, the primers from the publication by Burmester et al. [18] were tested to investigate whether they could be used to sequence the suspected region of mutations that could be associated with azole resistance. The reverse primer was recalculated for a product length of 550 bp. This resulted in, among other things, the self-named primer Erg11BR1.
Primer Erg11BR1 (rev): 5′ AATAGTCAGTTGGCGGCACA 3′.
Primer TmErg11BF3 (fwd): 5′ GCCCACATGATGATTGCTCTTC 3′ [18].
The method used itself proved to be successful at a DNA concentration of up to 20 ng/µL. The self-created primers and PCR program delivered the expected sequences. The PCR program used included an initial denaturation at 95 °C for 5 min, followed by 35 cycles: denaturation at 95 °C for 60 s, annealing at 60 °C for 60 s, extension at 72 °C for 60 s, and final extension at 72 °C for 10 min. Red HS Master Mix (Biozym Scientific GmbH, Hessisch Oldendorf, Germany) was used for the PCR. DNA fragments were sequenced at the Microsynth Seqlab GmbH, Göttingen, Germany.

2.8. Phylogenetic Tree According to ITS-rDNA and tef1-α

The phylogenetic tree according to ITS-rDNA and tef1-α was constructed using the maximum likelihood method and the bootstrap method, rooted by T. quinckeanum. Evolutionary analyses were performed in MEGA X (version 10.1.6) [39,45]. Table 1 lists the genotypes and strains used for the dendrogram creation with the respective NCBI accession numbers.

2.9. Deposition of the Sequences in Gene Databases

The ITS gene sequences of a selection of five of the 79 strains/isolates of T. mentagrophytes ITS genotype VIII (T. indotineae) and one T. rubrum strain are deposited at the database of the National Center for Biotechnology Information (NCBI) in Bethesda, MD, USA (Table 2). In addition, the sequences of the selected strains were also deposited for translation elongations factor 1-α (tef1-α). The primers EF-DermF 5′ CACATTAACTTGGTCGTTATCG 3′ and EF-DermR 5′ CATCCTTGGAGATACCAGC 3′ were used with the PCR program (initial denaturation at 95 °C for 5 min, followed by 35 cycles: denaturation at 95 °C for 30 s, annealing at 58 °C for 30 s, extension at 72 °C for 60 s, and final extension at 72 °C for 5 min) [31].

2.10. Ethics Statement and Patient Informed Consent

The authors confirm that the ethical policies of the journal have been adhered to. No ethical approval was required as the research in this article was related to micro-organisms. All persons gave their informed consent prior to their inclusion in the study.

3. Results

3.1. Patients Data

Of the 99 samples, 95 strains of the T. mentagrophytes/T. interdigitale complex and 4 T. rubrum were identified by PCR and/or cultivation. To consider the clinical data, we focused on the evaluation of the 95 patients with the T. mentagrophytes/T. interdigitale complex. Of these patients, 54 were under 30 years of age and 41 were over 30. The affected individuals were 36 women, 57 men, and in two cases the gender was not specified (Figure 2a,b).
Of these 95 patients, 33 worked as housewives, 25 were students, 19 were in services, five worked as businessmen, three as peasants, two as industry workers, two as teachers, and one each as a retired person, unemployed person, shopkeeper, tailor, laborer, and in government service (Table 3).
Before these patients took part in the study, they had suffered from skin diseases in 65 cases for 6–12 months, in 24 cases for 1–3 years, and in six cases for over 3 years. In one case, the affected person was not sure (Figure 3a). The location of the tinea can be divided into tinea corporis (includes trunk, buttocks, legs, arms), tinea cruris, tinea genitalis, and tinea faciei. A total of 93 patients reported tinea corporis, 83 tinea cruris, 15 tinea genitalis, and 36 tinea faciei. Multiple answers were possible (Figure 3b).
Previous treatment with fixed-dose combination creams (FDCs) containing clobetasol propionate or other corticosteroids with antifungal and antibacterial agents was noted and broken down. Approximately 33 patients used clobetasol + ofloxacin + ornidazole + terbinafine, 20 econazole + triamcinolone, 14 miconazole + hydrocortisone, six injections with triamcinolone, six clobetasol, two betamethasone, one mometasone, and one triamcinolone. In nine cases it was not clear whether treatment with FDC creams had taken place, in six cases “no” was stated, and in one case “yes”. Multiple preparations could be stated (Table 4).
Prior oral treatment with terbinafine, fluconazole, voriconazole, and itraconazole was noted, and it was possible that more than one antifungal agent was administered. Approximately 58 patients were treated with terbinafine and 12 were unsure if they had received this medication. Twenty-six patients were treated with fluconazole and 13 were unsure if they had received it. Eighteen patients were treated with voriconazole and 13 patients were unsure if they had received this medication. Nineteen patients were treated with itraconazole and 11 patients were unsure if they had received it (Figure 4).

3.2. Dermatophyte Detection by Culture and/or PCR

Dermatophytes were detected in 79 (78%) of 99 samples by both culture and PCR. The following dermatophytes were found: T. mentagrophytes/T. interdigitale (TM/Tinter), 76/79 (96.2%), and T. rubrum, 3/79 strains (3.8%).

3.3. Identification of Fungal Species and Genotypes by Sequencing of the ITS and the tef1-α Region of the rDNA

Since it was not possible to distinguish between T. interdigitale and the T. mentagrophytes complex using PCR-ELISA, the ITS region of the rDNA gene was sequenced. The sequencing focused exclusively on the cultural growth of the fungal isolates. Based on this sequencing, we were able to show that all T. mentagrophytes strains found belong to the T. mentagrophytes ITS genotype VIII (T. indotineae) [46].
Phylogenetic trees of the T. mentagrophyte ITS genotype VIII (T. indotineae) strains from Bangladesh were constructed. For comparison, the most important genotypes of the T. mentagrophytes/T. interdigitale complex were included (Figure 5a,b).
A clear differentiation of T. mentagrophytes ITS genotype VIII (T. indotineae) from the other genotypes is possible both with regard to the ITS regions of the rDNA and the tef1-α gene.

3.4. Antifungal Resistance Testing and Point Mutation Analysis of Trichophyton mentagrophytes ITS Genotype VIII (Trichophyton indotineae)

3.4.1. Antifungal Resistance Testing

Resistance testing of the 76 strains of T. mentagrophytes ITS genotype VIII (T. indotineae) using the breakpoint agar dilution method on Sabouraud’s dextrose agar containing terbinafine or itraconazole at different concentrations revealed terbinafine resistance in 49 and itraconazole resistance in 21 samples. Of these, 11 of 76 samples were resistant to both antifungal agents (Figure 6, Table 5).

3.4.2. Mutation Analysis of Squalene Epoxidase

The sequences were evaluated using multiple sequence alignment. This reveals the point mutations that led to various protein replacements at positions 393, 397, 429, 436, and 448.
Sequencing of the SQLE gene showed various point mutations. The mutation Phe397Leu (F397L) is the most common with 20 strains (26%). There are three different point mutations that cause this amino acid exchange. There was a base exchange from TTC to TTA in four samples, an exchange from TTC to CTC in 14 samples, and one exchange from TTC to TTG. This is followed by Leu393Ser (L393S) from TTA to TCA with 20 strains (26%) and Ala448Thr (A448T) from GCT to ACT with 17 (22%). Ser436Ala (S436A) from TCC to GCC was found in five cases (7%) and Phe397Ile (F397I) from TTC to ATC, Leu393Phe (L393F) from TTA to TTC, and Asn429Asp (N429D) from AAC to GAC with 1.4% each. Double mutations in F397L (TTC to TTA) and A448T (GCT to ACT) occurred in four cases.
To illustrate the connections between mutations and resistance, these results were compared (Table 6).
Based on these results, 11 strains with mutations resistant to both terbinafine and itraconazole were detected among the samples. Two isolates had the mutation L393S, three isolates had F397L, two more isolates had the mutation S436A, and one isolate had the mutation A448T. Three isolates with the double mutation F397L and A448T were resistant to both terbinafine and itraconazole. About 38 strains with mutations were resistant to terbinafine and sensitive to itraconazole. Seventeen had the mutation L393S, 17 had the mutation L393S, and one each had the mutations S436A, F397I, and L393F. One isolate with the double mutation F397L and A448T was resistant to terbinafine and sensitive to itraconazole. Ten isolates with the A448T mutation were the only ones that were sensitive to terbinafine and resistant to itraconazole. Six isolates with the A448T mutation were sensitive to terbinafine and sensitive to itraconazole. In total, 10 strains with mutations were sensitive to terbinafine and sensitive to itraconazole. This includes eight A448T mutations, one L393S, two S436A, and one N429D. The remaining seven samples had no mutations (wild strains).

3.4.3. Mutation Analysis by RT-PCR

Ninty-nine samples were examined using the DermaGenius® Resistance multiplex RT-PCR. A total of 61 mutations were found, all of which can be assigned to the T. interdigitale/T. mentagrophytes complex. No mutations were found in the remaining 38 samples. Of these, 34 pathogens could be assigned to the T. interdigitale/T. mentagrophytes complex, and the remaining four pathogens to T. rubrum (Table 7).
Fourteen additional samples were identified using PCR that could not be sequenced previously. However, the DermaGenius® PCR Resistance Kit detects fewer mutations than the mutation analysis of squalene epoxidase and therefore does not find the mutations Ser436Ala, Ala448Thr, and Asn429Asp. These are therefore always identified as sensitive.

3.4.4. Sequencing of the Erg11B Gene

The mutations in the Erg11B gene were also analyzed by sequencing using multiple sequence alignment. Point mutations were identified which led to different protein exchanges at positions 441, 443, 444, and 445.
There were two different exchanges at position 441. In four samples the substitution Asp441Tyr (D441Y) was detected and in one sample the substitution Asp441Gly (D441G). The mutation Gly443Glu (G443E) was detected at position 443 in two isolates and the mutation Gly443Arg (G443R) in another. The largest number of mutations was found at position 444. Most of the mutations—in 30 samples—were identified as Tyr444His (Y444H). Furthermore, the base exchange Tyr444Cys (Y444C) was detected in five samples and Tyr444Ser (Y444S) in four samples. This position has the largest proportion of mutations examined at around 76%. Two-point mutations were found at position 445. Three isolates had the mutation Gly445Ser (G445S), and one isolate had the substitution Gly445Asp (G445D). A total of 51 point mutations were identified, corresponding to 65% of all samples.
The associations between mutations in the Erg11B gene and resistance to itraconazole are summarized in Table 8.
One isolate that was resistant to itraconazole in the breakpoint test had the Gly443Glu mutation. Two itraconazole-resistant samples had the Tyr444His mutation, and another two samples had the Tyr444Cys base change. The remaining itraconazole-resistant samples had the Gly445Ser mutation. Overall, 14% of samples with a mutation were resistant to itraconazole. However, fifteen samples without mutations in the Erg11B gene were also resistant to itraconazole in vitro. Thirteen isolates without the Erg11B gene mutation were not resistant to itraconazole. Seven isolates showed both itraconazole resistance and a mutation. Thirteen samples had neither itraconazole resistance nor a mutation. Fifteen samples showed resistance to itraconazole but no mutations. This meant that 51 samples could be classified as mutants, 28 samples as non-mutants, 22 samples as resistant, and 57 samples as sensitive (Table 9).
The Ala448Thr mutation in the SQLE gene is also associated with itraconazole resistance. A comparison between mutations in the Erg11B gene and Ala448Thr mutation in the SQLE gene is shown in Table 10.
Of 51 isolates with a mutation in the Erg11B gene, only one also had the Ala448Thr mutation in the SQLE gene. Of the 19 isolates with this mutation, 18 samples did not have a mutation in the Erg11B gene. However, of the isolates without a mutation in the Erg11B gene, 18 had the Ala448Thr mutation in the SQLE gene. The remaining ten isolates had neither a mutation in the Erg11B gene nor the Ala448Thr mutation in the SQLE gene.

4. Discussion

4.1. Fungal Infections in Bangladesh

There are few studies and case reports on invasive and superficial fungal infections in Bangladesh. Superficial mycoses are very common, with T. rubrum being the predominant etiological agent (80.6%). To date, no epidemiological studies on the occurrence of dermatophyte infections have been conducted in Bangladesh. Until a few years ago, T. rubrum was the main pathogen of superficial fungal infections in Bangladesh, but also in India and the world [47]. In India, there are now various epidemiological studies showing a change in the main pathogens of dermatophytoses from T. rubrum to the T. mentagrophytes/T. interdigitale complex [48,49]. The patients in this study were selected based on their clinical picture. That is, patients with pronounced dermatomycoses on the trunk, groin, and face were selected and included in the mycological examination.

4.2. Clinical and Anamnestic Patient Data

More than half of the patients with superficial fungal infections caused by T. mentagrophytes ITS genotype VIII were men. Most patients were young, between 10 and 40 years old. There were also older patients. The medical history did not provide any significant evidence of a connection with occupational activity. A high proportion of patients work in the home. In the majority of patients, tinea had been present for more than 6 months. The most common manifestation of mycosis caused by T. mentagrophytes ITS genotype VIII was tinea corporis, followed by tinea cruris and tinea genitalis. The frequent occurrence of tinea faciei was also typical. It is not surprising that tinea corporis accounts for the largest proportion, as this mycosis involves the torso, buttocks, legs, and arms. Tinea cruris is the typical site of infection in T. mentagrophytes ITS genotype VIII (T. indotineae) and, although it only affects the groin area, it has been described in 83 of 99 cases. The suspected connection between the occurrence of therapy-refractory tinea caused by T. mentagrophytes ITS genotype VIII and the misuse of strong topical corticosteroids in so-called combination or cocktail creams (FDCs) is supported by the history of the preparations used so far. A large proportion of patients used clobetasol in combination with antibiotics and antimycotics, but various other steroid creams were also used as an alternative. More than half of the patients had previously received oral antimycotic therapy with terbinafine. In addition, fluconazole, voriconazole, and itraconazole were used.
Ten terbinafine-sensitive cases (patient nos. 13, 28, 30, 36–38, 73, 77, 78, 93, 97) had a history of taking oral terbinafine without itraconazole or voriconazole and experienced relapse. It is not absolutely necessary that patients who have previously received terbinafine/itraconazole therapy also develop terbinafine resistance in vitro. This is especially true since T. mentagrophytes ITS genotype VIII (T. indotineae) strains can be acquired with or without terbinafine resistance through transmission from other people. Repeated relapses and treatment failure with oral antimycotics are typical for T. indotineae infections. These repeated relapses are certainly not only due to antimycotic resistance but are also due to the virulence and altered biological behavior of this new dermatophyte species.

4.3. Pathogen Identification

The pathogen identification or genotyping was based on the sequencing of the ITS region of the dermatophyte DNA. The sequences were identified via the NCBI BLAST. All 76 samples identified as T. mentagrophytes could be clearly assigned to genotype VIII. Since only two different Trichophyton species were found in the present study, the morphological evaluation was unproblematic. Despite morphological differences within a species, all fungal strains could be correctly identified by culture. Three of 79 isolates had the reddish-brown back of the dermatophyte colony, which enabled identification as T. rubrum and was confirmed by sequencing.
Using PCR-ELISA, all 99 skin scraping samples were reactive to a dermatophyte. The T. mentagrophytes/T. interdigitale complex was found in 95 of 99 samples (95.96%) using PCR-ELISA. DNA from T. rubrum was found in four samples (4.04%). However, the sequencing was not carried out from the fungal DNA extracted directly from skin scrapings, but rather, as shown above, from fungal culture material of the 76 cultured strains of the T. mentagrophytes/T. interdigitale complex, all of which were confirmed as T. mentagrophytes ITS genotype VIII (T. indotineae). Ultimately, it must be assumed that all samples that are positive for T. mentagrophytes/T. interdigitale by PCR-ELISA must be counted as belonging to the new species T. indotineae.
The mycological diagnosis of dermatophyte infection in the study was based on the routine procedure for dermatophyte detection in the Moelbis laboratory. A step-by-step diagnosis is carried out, starting with fluorescence microscopic preparation and cultural fungal detection. The diagnosis is supplemented by the simple PCR-ELISA for orienting molecular dermatophyte detection. Fine diagnostics for precise pathogen identification is based on the sequencing of the ITS region of the rDNA. The DermaGenius® Resistance multiplex RT-PCR was also used as part of a method comparison.
T. mentagrophytes ITS genotype VIII (T. indotineae) cannot be clearly sequenced using conventional mycological techniques. ITS sequencing is necessary in all cases. Unfortunately, it must be noted that there is currently no local capacity for this diagnosis in Bangladesh.

4.4. Resistance Testing

In vitro susceptibility testing using the breakpoint agar dilution method revealed that 62% of T. mentagrophytes ITS genotype VIII (T. indotineae) strains were terbinafine-resistant. The percentage is also consistent with the terbinafine resistance of isolates of T. mentagrophytes ITS genotype VIII isolated in Germany [25,46]. In the large study on terbinafine resistance of T. mentagrophytes ITS genotype VIII in India in 2017/19, an even higher percentage of terbinafine-resistant isolates of 66.7% to 76% was found. In addition, 27.3% to 57.1% of Indian T. rubrum strains were also terbinafine-resistant [36]. In cases of recurrent dermatophytosis, terbinafine is used repeatedly, which can lead to resistance of the dermatophytes if used uncontrolled over a long period of time [50]. In the Asian region, topical combination preparations are also often used that contain a potent topical glucocorticoid and several antimicrobial agents [46]. These so-called combo creams or cocktail creams predominantly contain clobetasol propionate as a class IV topical glucocorticoid. One reason for the widespread and long-term use of combination preparations is the price, which is significantly lower than that of topical antifungal monopreparations [51]. Additionally, the combo creams are available without a doctor’s prescription and are recommended and sold in over-the-counter (OTC) pharmacies. Terbinafine has no effect on the most strains of T. mentagrophytes ITS genotype VIII (T. indotineae) in chronic, recurrent forms of tinea, either applied topically or taken orally. Approximately 60%, sometimes up to over 70%, of the isolates show resistance to terbinafine in vitro [36,46,52]. At least 38% of all T. mentagrophytes ITS genotype VIII (T. indotineae) strains tested were sensitive to terbinafine in vitro. In those patients with in vitro sensitive T. mentagrophytes ITS genotype VIII (T. indotineae) isolates, therapy with terbinafine may be attempted. However, an alternative treatment, usually itraconazole, should be considered.
In ten terbinafine-sensitive cases (patient nos. 13, 28, 30, 36–38, 73, 77, 78, 93, 97), oral terbinafine was taken in the past without itraconazole or voriconazole and a relapse occurred. It is not essential that patients who have previously received terbinafine/itraconazole therapy also develop terbinafine resistance in vitro. This is especially because the T. mentagrophytes ITS genotype VIII (T. indotineae) strains can also be acquired by transmission from other individuals, with or without terbinafine resistance. Repeated relapses and failure of treatment with oral antifungals are typical of T. mentagrophytes ITS genotype VIII (T. indotineae) infections. These repeated relapses are certainly not only due to antifungal resistance but also to the virulence and altered biological behavior of this new dermatophyte species.
Itraconazole from the azole group was tested as the second antimycotic. About 28% of all T. mentagrophytes ITS genotype VIII (T. indotineae) isolates were resistant to itraconazole in vitro. The ECOFF for itraconazole is 0.25 µg/mL [36,37]. In this practical scenario of clinical non-response to terbinafine, the unrestricted use of voriconazole for dermatophytosis is a new phenomenon in Bangladesh. In the series of chronic recalcitrant dermatophytosis, at least 50% of patients had taken terbinafine orally in the past, 19% had taken voriconazole, and 20% had taken itraconazole with or without prescription. This widespread use of voriconazole for superficial fungal infection may pose a threat of resistance in the future.
There is a good correlation between the result of the breakpoint test, the detection of in vitro terbinafine resistance, and the treatment failure of terbinafine in patients [53,54]. The results of the breakpoint test of T. mentagrophytes ITS genotype VIII (T. indotineae) correlated very well with treatment failure in tinea corporis caused by this pathogen, both with regard to oral therapy and topical application of terbinafine [53,54]. The breakpoint test has also proven to be plausible and clinically relevant in the resistance testing of T. rubrum. T. rubrum isolates resistant in the breakpoint test do not respond to terbinafine therapy in patients [55,56].

4.5. Terbinafine Resistance Due to Mutations in Squalene Epoxidase

According to Yamada et al. (2017) [35], there is a direct connection between mutations in the SQLE gene and resistance to terbinafine. A mutation analysis using sequencing demonstrated that 68 of a total of 79 isolates had mutations in this gene. However, only 49 isolates were also resistant to terbinafine. The mutation analysis was also carried out using the DermaGenuis® Resistance Kit. However, this test kit only detects the mutations at positions 393 and 397. These are the amino acid substitutions Leu393Ser, Leu393Phe, Phe397Leu, and Phe397Ile. A total of 46 of the terbinafine-resistant patients were diagnosed, using both multiplex real-time PCR and sequencing to detect point mutations at positions 393 and 397. The Ala448Thr mutation does not affect resistance to terbinafine. In contrast, there appears to be an association with itraconazole resistance [57]. The remaining four terbinafine-resistant isolates showed the mutations Ala448Thr and Ser436Ala. Only a single strain that was resistant to both terbinafine and itraconazole showed the Ala448Thr mutation. The remaining 16 isolates with this mutation showed itraconazole resistance in eight cases and a sensitive reaction to the antifungal in eight cases. These results support the statement that the mutation may cause an increased likelihood of itraconazole resistance, but this does not necessarily lead to resistance. The final mutation Asn429Asp is a mutation that is not responsible for resistance. No resistance was to be expected from the sequencing analysis of the isolates without mutations. This occurred in 91% of these samples. One sample nevertheless showed resistance to itraconazole. Since this is not caused by a mutation in squalene epoxidase, this result is also in line with expectations. For all other samples that could not be sequenced due to missing cultures, a comparison and evaluation of the results of the resistance kit with the specific point mutations was not possible.

4.6. Itraconazole Resistance Due to Mutations in the ERG11 Gene

The starting point for this analysis was the publication by Burmester et al. (2022) [41], which showed point mutations in the Erg11B gene in T. mentagrophytes ITS genotype VIII (T. indotineae) isolates obtained from patients at the Jena University Hospital. As in other fungi, the genome of T. mentagrophytes ITS genotype VIII (T. indotineae) encodes two putative copies of Erg11 that encode sterol 14-α demethylases, named A and B due to their similarity to homologous A and B copies of Aspergillus fumigatus [18]. Fungal Erg11 genes belong to the cytochrome P450 containing protein superfamily 51 and are therefore also synonymously referred to as Cyp51. The two Erg11 proteins of A. fumigatus differ in their substrate specificity and Erg11B (syn. Cyp51B) only converts eburicol and was unable to use lanosterol as substrate [58]. Eburicol is formed from lanosterol by the action of the C-24 methyltransferase encoded by Erg6 [59] and accumulation of eburicol has toxic effects in A. fumigatus [60]. In A. fumigatus, deletion mutants of one Erg11 gene copy have a viable phenotype, showing that each gene can replace the function of the second copy [61]. Erg11-related azole resistance depends on overexpression of Erg11 genes or point mutations leading to amino acid exchanges of Erg11 protein sequences [62]. Another Erg11-independent resistance mechanism in fungi is the efflux of azoles due to increased expression of multiple drug resistance (MDR) transporters or major facilitator superfamily (MFS) transporters [63]. The influence of the MDR3 transporter on the transport of voriconazole and itraconazole has been shown for T. rubrum [64]. Nevertheless, T. mentagrophytes ITS genotype VIII (T. indotineae) disrupting MDR3 and its parental strains overexpressing MDR3 show little difference in azole susceptibility [65]. Genome analysis of T. mentagrophytes ITS genotype VIII (T. indotineae) shows a correlation of multiple Erg11B copies as tandem repeats with overexpression of Erg11B [65]. Interestingly, two Erg11B-overexpressing mutant strains showing itraconazole resistance also contain the Ala448Thr mutation in the squalene epoxidase protein sequence. One of the itraconazole-resistant Ala448Thr mutant strains contains only one Erg11B copy in combination with Erg11B overexpression [65]. Therefore, the high number of Ala448Thr mutant strains showing itraconazole resistance in this study may also be the result of Erg11B overexpression due to several mechanisms. Interestingly, in a previous study, an Ala448Thr mutant strain showed multiple azole resistance in combination with Erg11B wild-type sequences [18], indicating a resistance mechanism independent of Erg11B point mutations.
Point mutations in Erg11 genes that result in amino acid exchanges mediate resistance to specific azoles due to their chemical nature [66]. For example, the Erg11A mutant Tyr121Phe from A. fumigatus shows resistance to voriconazole, which belongs to the short-chain azoles [66]. Erg11B point mutations in this study affected similar amino acid positions as in a previous study [18]. Erg11B mutations Asp441Gly, Gly443Glu, Tyr444Cys, and Tyr444His were found in both studies. However, several of these mutations do not show a clear phenotype against azoles used in medical therapy [18]. Only Erg11B Ala230Thr shows an association with resistance against sertaconazole nitrate [18]. Interestingly, plant pathogenic fungi show comparable mutations in Erg11 as found in Erg11B of T. mentagrophytes ITS genotype VIII (T. indotineae). The wheat pathogen Zymoseptoria (Z.) tritici (tel. Mycosphaerella graminicola) shows small deletions of delta Tyr459/Gly460 [67], which corresponds to Tyr442/Gly443 in the wild-type Erg11B sequences of T. mentagrophytes ITS genotype VIII (T. indotineae) presented here. In addition, the Z. tritici mutations Tyr461His and Tyr461Ser [67] correspond to the mutations Tyr444His and Tyr444Ser in T. mentagrophytes ITS genotype VIII (T. indotineae). Erg11 mutants in Z. tritici show increased resistance to azole used in agriculture as cyproconazole [67]. Other phytopathogenic fungi show similar mutations, for example, the banana pathogen Mycosphaerella fijiensis carries Erg11 mutations Tyr463His [68] that correspond to T. mentagrophytes ITS genotype VIII (T. indotineae) Erg11B Tyr444His. Other Mycosphaerella fijiensis mutations show several other tyrosine substitutes in Erg11 protein positions 461 and 463 [68]. The mutations correlate with loss of sensitivity to propiconazole [68].
The high frequency of Erg11B mutations in T. mentagrophytes ITS genotype VIII (T. indotineae) leading to amino acid exchanges shows that there is a high selection pressure for the evolution of Erg11B due to environmental changes. This also explains the increase in other resistance mechanisms such as overexpression of Erg11B [47]. The fact that no direct relation with medically used azoles was observed for several Erg11B mutants suggests that azoles widely used in agriculture might have an influence on the development of Erg11B in T. mentagrophytes ITS genotype VIII (T. indotineae). It is important to elucidate the role of these evolutionary tendencies to understand the fungal repertoire of resistance mechanisms in the future. The unique genotypes of each isolate suggest that the resistant strains evolved independently at different times. The challenge for future diagnostics is therefore not only to determine the species subtypes but also to analyze genes involved in the resistance mechanisms [18].
Resistance to itraconazole could not be explained by mutations found in the ERG11B gene.

5. Conclusions

In Bangladesh, infection with T. mentagrophytes ITS genotype VIII (T. indotineae) has become a public health issue with potentially global ramifications. Here, 62% of samples showed resistance to terbinafine, making oral itraconazole the most effective drug currently available. However, itraconazole resistance is also increasing. The scenario is identical in India and Bangladesh.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/jof10110768/s1, Table S1: Clinical data and resistances of patients from Bangladesh.

Author Contributions

Conceptualization, M.S.I.B., S.B.V., S.U., T.N. and P.N.; data curation, G.-M.I., S.U., E.K., A.B., T.N. and P.N.; formal analysis, G.-M.I., S.U., E.K. and A.B., funding acquisition, P.N.; investigation, M.S.I.B., G.-M.I., S.U. and P.N.; methodology, M.S.I.B., G.-M.I., S.U., A.B. and P.N.; project administration, M.S.I.B., S.B.V. and P.N.; resources, M.S.I.B., S.B.V. and P.N.; software, G.-M.I., S.U. and E.K.; supervision, M.S.I.B., S.B.V., A.B. and P.N.; validation, M.S.I.B., S.B.V., G.-M.I., S.U., E.K., A.B. and P.N.; visualization, S.U., E.K., A.B. and P.N.; writing—original draft, S.B.V., G.-M.I., E.K., A.B. and P.N.; writing—review and editing, M.S.I.B., S.B.V., S.U., E.K., A.B., T.N. and P.N. All authors have read and agreed to the published version of the manuscript.

Funding

This research received no external funding.

Institutional Review Board Statement

The study was conducted in accordance with the Declaration of Helsinki, and approved by the Institutional Review Board of the Bangabandhu Sheikh Mujib Medical University (No. BSMMU/2022/2775, Registration No: 661 and21.03.2022).

Informed Consent Statement

Informed consent was obtained from all subjects involved in the study.

Data Availability Statement

The raw data supporting the conclusions of this article will be made available by the authors on request.

Acknowledgments

We thank Rashmi Sarkar (Department of Dermatology, LHMC and associated KSCH and SSK Hospitals, New Delhi, India) for the idea and the impetus of the study under the umbrella of the IADVL (Indian Association of Dermatologists, Venereologists, and Leprologists).

Conflicts of Interest

Author Shyam B. Verma was employed by the Nirvan & ‘In Skin Clinics’. The remaining authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

References

  1. Verma, S.B.; Panda, S.; Nenoff, P.; Singal, A.; Rudramurthy, S.M.; Uhrlaß, S.; Das, A.; Bisherwal, K.; Shaw, D.; Vasani, R. The unprecedented epidemic-like scenario of dermatophytosis in India: I. Epidemiology, risk factors and clinical features. Indian J. Dermatol. Venereol. Leprol. 2021, 87, 154–175. [Google Scholar] [CrossRef] [PubMed]
  2. Chanyachailert, P.; Leeyaphan, C.; Bunyaratavej, S. Cutaneous fungal caused by dermatophytes and non-dermatophytes: An updated comprehensive review of epidemiology, clinical presentations, and diagnostic testing. J. Fungi 2023, 9, 669. [Google Scholar] [CrossRef] [PubMed]
  3. Philpot, C. The differentiation of Trichophyton mentagrophytes from T. rubrum by a simple urease test. Sabouraudia 1967, 5, 189–193. [Google Scholar] [CrossRef]
  4. Zhan, P.; Liu, W. The changing face of dermatophytic infections worldwide. Mycopathologia 2017, 182, 77–86. [Google Scholar] [CrossRef]
  5. Kaaman, T. The clinical significance of cutaneous reactions to trichophytin in dermatophytosis. Acta Derm. Venereol. 1978, 58, 139–143. [Google Scholar] [CrossRef]
  6. Havlickova, B.; Czaika, V.A.; Friedrich, M. Epidemiological trends in skin mycoses worldwide. Mycoses 2008, 51 (Suppl. S4), 2–15. [Google Scholar] [CrossRef]
  7. Sahai, S.; Mishra, D. Change in spectrum of dermatophytes isolated from superficial mycoses cases: First report from Central India. Indian J. Dermatol. Venereol. Leprol. 2011, 77, 335–336. [Google Scholar] [CrossRef]
  8. Bhatia, V.K.; Sharma, P.C. Epidemiological studies on dermatophytosis in human patients in Himachal Pradesh, India. Springerplus 2014, 3, 134. [Google Scholar] [CrossRef]
  9. Kalita, J.M.; Sharma, A.; Bhardwaj, A.; Nag, V.L. Dermatophytoses and spectrum of dermatophytes in patients attending a teaching hospital in Western Rajasthan, India. J. Fam. Med. Prim. Care 2019, 8, 1418–1421. [Google Scholar] [CrossRef]
  10. Rudramurthy, S.M.; Shankarnarayan, S.A.; Dogra, S.; Shaw, D.; Mushtaq, K.; Paul, R.A.; Narang, T.; Chakrabarti, A. Mutation in the squalene epoxidase gene of Trichophyton interdigitale and Trichophyton rubrum associated with allylamine resistance. Antimicrob. Agents Chemother. 2018, 62, e02522-17. [Google Scholar] [CrossRef] [PubMed]
  11. Singh, A.; Masih, A.; Khurana, A.; Singh, P.K.; Gupta, M.; Hagen, F.; Meis, J.F.; Chowdhary, A. High terbinafine resistance in Trichophyton interdigitale isolates in Delhi, India harbouring mutations in the Squalene epoxidase (SQLE) gene. Mycoses 2018, 61, 477–484. [Google Scholar] [CrossRef] [PubMed]
  12. Rezaei-Matehkolaei, A.; Rafiei, A.; Makimura, K.; Gräser, Y.; Gharghani, M.; Sadeghi-Nejad, B. Epidemiological aspects of dermatophytosis in Khuzestan, southwestern Iran, an Update. Mycopathologia 2016, 181, 547–553. [Google Scholar] [CrossRef] [PubMed]
  13. Symoens, F.; Jousson, O.; Planard, C.; Fratti, M.; Staib, P.; Mignon, B.; Monod, M. Molecular analysis and mating behaviour of the Trichophyton mentagrophytes species complex. Int. J. Med. Microbiol. 2011, 301, 260–266. [Google Scholar] [CrossRef] [PubMed]
  14. Taghipour, S.; Pchelin, I.M.; Zarei Mahmoudabadi, A.; Ansari, S.; Katiraee, F.; Rafiei, A.; Shokohi, T.; Abastabar, M.; Taraskina, A.E.; Kermani, F.; et al. Trichophyton mentagrophytes and T. interdigitale genotypes are associated with particular geographic areas and clinical manifestations. Mycoses 2019, 62, 1084–1091. [Google Scholar] [CrossRef] [PubMed]
  15. Verma, S.B.; Madhu, R. The great Indian epidemic of superficial dermatophytosis: An appraisal. Indian J. Dermatol. 2017, 62, 227–236. [Google Scholar] [CrossRef]
  16. Nenoff, P.; Verma, S.B.; Uhrlaß, S.; Burmester, A.; Gräser, Y. A clarion call for preventing taxonomical errors of dermatophytes using the example of the novel Trichophyton mentagrophytes genotype VIII uniformly isolated in the Indian epidemic of superficial dermatophytosis. Mycoses 2019, 62, 6–10. [Google Scholar] [CrossRef]
  17. Winter, P.; Burmester, A.; Tittelbach, J.; Wiegand, C. A new genotype of Trichophyton quinckeanum with point mutations in Erg11A encoding sterol 14-α demethylase exhibits increased itraconazole resistance. J. Fungi 2023, 9, 1006. [Google Scholar] [CrossRef]
  18. Burmester, A.; Hipler, U.-C.; Elsner, P.; Wiegand, C. Point mutations in the squalene epoxidase erg1 and sterol 14-α demethylase erg11 gene of T. indotineae isolates indicate that the resistant mutant strains evolved independently. Mycoses 2022, 65, 97–102. [Google Scholar] [CrossRef]
  19. Kano, R.; Kimura, U.; Kakurai, M.; Hiruma, J.; Kamata, H.; Suga, Y.; Harada, K. Trichophyton indotineae sp. nov.: A new highly terbinafine-resistant anthropophilic dermatophyte species. Mycopathologia 2020, 185, 947–958. [Google Scholar] [CrossRef]
  20. Kong, F.; Tong, Z.; Chen, X.; Sorrell, T.; Wang, B.; Wu, Q.; Ellis, D.; Chen, S. Rapid identification and differentiation of Trichophyton species, based on sequence polymorphisms of the ribosomal internal transcribed spacer regions, by rolling-circle amplification. J. Clin. Microbiol. 2008, 46, 1192–1199. [Google Scholar] [CrossRef]
  21. Kawasaki, M.; Anzawa, K.; Wakasa, A.; Takeda, K.; Tanabe, H.; Mochizuki, T.; Ishizaki, H.; Hemashettar, B.M. Different genes can result in different phylogenetic relationships in Trichophyton species. Nihon Ishinkin Gakkai Zasshi 2008, 49, 311–318. [Google Scholar] [CrossRef] [PubMed]
  22. Jabet, A.; Brun, S.; Normand, A.-C.; Imbert, S.; Akhoundi, M.; Dannaoui, E.; Audiffred, L.; Chasset, F.; Izri, A.; Laroche, L.; et al. Extensive dermatophytosis caused by Terbinafine-resistant Trichophyton indotineae, France. Emerg. Infect. Dis. 2022, 28, 229–233. [Google Scholar] [CrossRef] [PubMed]
  23. Dellière, S.; Joannard, B.; Benderdouche, M.; Mingui, A.; Gits-Muselli, M.; Hamane, S.; Alanio, A.; Petit, A.; Gabison, G.; Bagot, M.; et al. Emergence of difficult-to-treat tinea corporis caused by Trichophyton mentagrophytes complex isolates, Paris, France. Emerg. Infect. Dis. 2022, 28, 224–228. [Google Scholar] [CrossRef] [PubMed]
  24. Klinger, M.; Theiler, M.; Bosshard, P.P. Epidemiological and clinical aspects of Trichophyton mentagrophytes/Trichophyton interdigitale infections in the Zurich area: A retrospective study using genotyping. J. Eur. Acad. Dermatol. Venereol. 2021, 35, 1017–1025. [Google Scholar] [CrossRef] [PubMed]
  25. Nenoff, P.; Verma, S.B.; Ebert, A.; Süß, A.; Fischer, E.; Auerswald, E.; Dessoi, S.; Hofmann, W.; Schmidt, S.; Neubert, K.; et al. Spread of Terbinafine-Resistant Trichophyton mentagrophytes Type VIII (India) in Germany—”The Tip of the Iceberg?”. J. Fungi 2020, 6, 207. [Google Scholar] [CrossRef]
  26. Jia, S.; Long, X.; Hu, W.; Zhu, J.; Jiang, Y.; Ahmed, S.; Hoog, G.S.d.; Liu, W.; Jiang, Y. The epidemic of the multiresistant dermatophyte Trichophyton indotineae has reached China. Front. Immunol. 2022, 13, 1113065. [Google Scholar] [CrossRef]
  27. Durdu, M.; Kandemir, H.; Karakoyun, A.S.; Ilkit, M.; Tang, C.; de Hoog, S. First Terbinafine-Resistant Trichophyton indotineae Isolates with Phe397Leu and/or Thr414His Mutations in Turkey. Mycopathologia 2023, 188, 2. [Google Scholar] [CrossRef]
  28. Beifuss, B.; Bezold, G.; Gottlöber, P.; Borelli, C.; Wagener, J.; Schaller, M.; Korting, H.C. Direct detection of five common dermatophyte species in clinical samples using a rapid and sensitive 24-h PCR-ELISA technique open to protocol transfer. Mycoses 2011, 54, 137–145. [Google Scholar] [CrossRef]
  29. Hsu, M.-C.; Chen, K.-W.; Lo, H.-J.; Chen, Y.-C.; Liao, M.-H.; Lin, Y.-H.; Li, S.-Y. Species identification of medically important fungi by use of real-time LightCycler PCR. J. Med. Microbiol. 2003, 52, 1071–1076. [Google Scholar] [CrossRef]
  30. Winter, I.; Uhrlaß, S.; Krüger, C.; Herrmann, J.; Bezold, G.; Winter, A.; Barth, S.; Simon, J.C.; Gräser, Y.; Nenoff, P. Molecular biological detection of dermatophytes in clinical samples when onychomycosis or tinea pedis is suspected. A prospective study comparing conventional dermatomycological diagnostics and polymerase chain reaction. Dermatologie 2013, 64, 283–289. [Google Scholar] [CrossRef]
  31. Mirhendi, H.; Makimura, K.; de Hoog, G.S.; Rezaei-Matehkolaei, A.; Najafzadeh, M.J.; Umeda, Y.; Ahmadi, B. Translation elongation factor 1-α gene as a potential taxonomic and identification marker in dermatophytes. Med. Mycol. 2015, 53, 215–224. [Google Scholar] [CrossRef] [PubMed]
  32. Kargl, A.; Kosse, B.; Uhrlaß, S.; Koch, D.; Krüger, C.; Eckert, K.; Nenoff, P. Hedgehog fungi in a dermatological office in Munich: Case reports and review. Dermatologie 2018, 69, 576–585. [Google Scholar] [CrossRef]
  33. Uhrlaß, S.; Schroedl, W.; Mehlhorn, C.; Krüger, C.; Hubka, V.; Maier, T.; Gräser, Y.; Paasch, U.; Nenoff, P. Molecular epidemiology of Trichophyton quinckeanum—A zoophilic dermatophyte on the rise. J. Dtsch. Dermatol. Ges. 2018, 16, 21–32. [Google Scholar] [CrossRef]
  34. Paepe, R.d.; Normand, A.-C.; Uhrlaß, S.; Nenoff, P.; Piarroux, R.; Packeu, A. Resistance profile, terbinafine resistance screening and MALDI-TOF MS identification of the emerging pathogen Trichophyton indotineae. Mycopathologia 2024, 189, 29. [Google Scholar] [CrossRef]
  35. Yamada, T.; Maeda, M.; Alshahni, M.M.; Tanaka, R.; Yaguchi, T.; Bontems, O.; Salamin, K.; Fratti, M.; Monod, M. Terbinafine resistance of Trichophyton clinical isolates caused by specific point mutations in the squalene epoxidase gene. Antimicrob. Agents Chemother. 2017, 61, e00115-17. [Google Scholar] [CrossRef]
  36. Ebert, A.; Monod, M.; Salamin, K.; Burmester, A.; Uhrlaß, S.; Wiegand, C.; Hipler, U.-C.; Krüger, C.; Koch, D.; Wittig, F.; et al. Alarming India-wide phenomenon of antifungal resistance in dermatophytes: A multicentre study. Mycoses 2020, 63, 717–728. [Google Scholar] [CrossRef]
  37. The European Committee on Antimicrobial Susceptibility Testing. Overview of Anti-Fungal ECOFFs and Clinical Breakpoints for Yeasts, Moulds and Dermatophytes Using the EUCAST E.Def 7.4, E.Def 9.4 and E.Def 11.0 Procedures. Version 4.0. Available online: http://www.eucast.org (accessed on 7 July 2024).
  38. Tamura, K.; Nei, M. Estimation of the number of nucleotide substitutions in the control region of mitochondrial DNA in humans and chimpanzees. Mol. Biol. Evol. 1993, 10, 512–526. [Google Scholar] [CrossRef]
  39. Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular Evolutionary Genetics Analysis across Computing Platforms. Mol. Biol. Evol. 2018, 35, 1547–1549. [Google Scholar] [CrossRef]
  40. TECOmedical Group. Klinisch Orientierte Dermatophytendiagnostik DermaGenius® 3.0 Complete RT-PCR. 2022. Available online: https://www.tecomedical.com/de/Dermatophyten-/DermaGenius-30-multiplex-RT-PCR/ (accessed on 7 July 2024).
  41. Ndiaye, M.; Sacheli, R.; Diongue, K.; Adjetey, C.; Darfouf, R.; Seck, M.C.; Badiane, A.S.; Diallo, M.A.; Dieng, T.; Hayette, M.-P.; et al. Evaluation of the Multiplex Real-Time PCR DermaGenius® Assay for the Detection of Dermatophytes in Hair Samples from Senegal. J. Fungi 2021, 8, 11. [Google Scholar] [CrossRef]
  42. Singh, A.; Singh, P.; Dingemans, G.; Meis, J.F.; Chowdhary, A. Evaluation of DermaGenius® resistance real-time polymerase chain reaction for rapid detection of terbinafine-resistant Trichophyton species. Mycoses 2021, 64, 721–726. [Google Scholar] [CrossRef]
  43. Uhrlaß, S.; Nenoff, P. DermaGenius® 3.0 for mycological diagnostics in routine testing. Mycoses 2022, 65, 17–18. [Google Scholar]
  44. Clinically Oriented Dermatophyte Diagnostics. DermaGenius® 3.0 Complete RT-PCR. 2022. Available online: https://www.tecomedical.com/download-file?file_id=4715&file_code=59e2e16f62 (accessed on 8 July 2024).
  45. Tamura, K.; Stecher, G.; Peterson, D.; Filipski, A.; Kumar, S. MEGA6: Molecular Evolutionary Genetics Analysis version 6.0. Mol. Biol. Evol. 2013, 30, 2725–2729. [Google Scholar] [CrossRef] [PubMed]
  46. Uhrlaß, S.; Verma, S.B.; Gräser, Y.; Rezaei-Matehkolaei, A.; Hatami, M.; Schaller, M.; Nenoff, P. Trichophyton indotineae—An emerging pathogen causing recalcitrant dermatophytoses in India and worldwide—A multidimensional perspective. J. Fungi 2022, 8, 757. [Google Scholar] [CrossRef] [PubMed]
  47. Seebacher, C.; Bouchara, J.-P.; Mignon, B. Updates on the epidemiology of dermatophyte infections. Mycopathologia 2008, 166, 335–352. [Google Scholar] [CrossRef]
  48. Shah, S.R.; Vyas, H.R.; Shah, B.J.; Jangid, N.C.; Choudhary, A.; Gehlawat, T.; Mistry, D.; Joshi, R. A clinical-mycological study of dermatophytosis in Western India with focus on antifungal drug resistance as a factor in recalcitrance. Indian J. Dermatol. 2023, 68, 234. [Google Scholar] [CrossRef]
  49. Kumar, P.; Ramachandran, S.; Das, S.; Bhattacharya, S.N.; Taneja, B. Insights into changing dermatophyte spectrum in India through analysis of cumulative 161,245 cases between 1939 and 2021. Mycopathologia 2023, 188, 183–202. [Google Scholar] [CrossRef]
  50. Gupta, A.K.; Venkataraman, M.; Hall, D.C.; Cooper, E.A.; Summerbell, R.C. The emergence of Trichophyton indotineae: Implications for clinical practice. Int. J. Dermatol. 2023, 62, 857–861. [Google Scholar] [CrossRef]
  51. Verma, S.B.; Vasani, R. Male genital dermatophytosis—Clinical features and the effects of the misuse of topical steroids and steroid combinations—An alarming problem in India. Mycoses 2016, 59, 606–614. [Google Scholar] [CrossRef]
  52. Nenoff, P.; Uhrlaß, S.; Verma, S.B.; Panda, S. Trichophyton mentagrophytes ITS genotype VIII and Trichophyton indotineae: A terminological maze, or is it? Indian J. Dermatol. Venerol. Leprol. 2022, 88, 586–589. [Google Scholar] [CrossRef]
  53. Süß, A.; Uhrlaß, S.; Ludes, A.; Verma, S.B.; Monod, M.; Krüger, C.; Nenoff, P. Extensive tinea corporis due to a terbinafine-resistant Trichophyton mentagrophytes isolate of the Indian genotype in a young infant from Bahrain in Germany. Dermatologie 2019, 70, 888–896. [Google Scholar] [CrossRef]
  54. Gawaz, A.; Nenoff, P.; Uhrlaß, S.; Schaller, M. Therapie eines Terbinafin-resistenten Trichophyton mentagrophytes Typ VIII. Dermatologie 2021, 72, 900–904. [Google Scholar] [CrossRef] [PubMed]
  55. Eichhorn, K.; Uhrlaß, S.; Nenoff, P. Chronisch rezidivierende Tinea corporis durch ein Terbinafin-resistentes Isolat von Trichophyton rubrum—Erfolgreiche Therapie mit Itraconazol. J. Dtsch. Dermatol. Ges. 2021, 19 (Suppl. S1), 27–30. [Google Scholar] [CrossRef]
  56. Appelt, L.; Nenoff, P.; Uhrlaß, S.; Krüger, C.; Kühn, P.; Eichhorn, K.; Buder, S.; Beissert, S.; Abraham, S.; Aschoff, R.; et al. Terbinafin-resistente Dermatophytosen und Onychomykose durch Trichophyton rubrum. Hautarzt 2021, 72, 868–877. [Google Scholar] [CrossRef] [PubMed]
  57. Burmester, A.; Hipler, U.-C.; Uhrlaß, S.; Nenoff, P.; Singal, A.; Verma, S.B.; Elsner, P.; Wiegand, C. Indian T. mentagrophytes squalene epoxidase erg1 double mutants show high proportion of combined fluconazole and terbinafine resistance. Mycoses 2020, 63, 1175–1180. [Google Scholar] [CrossRef] [PubMed]
  58. Hargrove, T.Y.; Wawrzak, Z.; Lamb, D.C.; Guengerich, F.P.; Lepesheva, G.I. Structure-Functional Characterization of Cytochrome P450 Sterol 14α-Demethylase (CYP51B) from Aspergillus fumigatus and Molecular Basis for the Development of Antifungal Drugs. J. Biol. Chem. 2015, 290, 23916–23934. [Google Scholar] [CrossRef] [PubMed]
  59. Dhingra, S.; Cramer, R.A. Regulation of sterol biosynthesis in the human fungal pathogen Aspergillus fumigatus: Opportunities for therapeutic development. Front. Microbiol. 2017, 8, 92. [Google Scholar] [CrossRef]
  60. Elsaman, H.; Golubtsov, E.; Brazil, S.; Ng, N.; Klugherz, I.; Dichtl, K.; Müller, C.; Wagener, J. Toxic eburicol accumulation drives the antifungal activity of azoles against Aspergillus fumigatus. Nat. Commun. 2024, 15, 6312. [Google Scholar] [CrossRef]
  61. Alcazar-Fuoli, L.; Mellado, E. Ergosterol biosynthesis in Aspergillus fumigatus: Its relevance as an antifungal target and role in antifungal drug resistance. Front. Microbiol. 2012, 3, 439. [Google Scholar] [CrossRef]
  62. Zhang, J.; Li, L.; Lv, Q.; Yan, L.; Wang, Y.; Jiang, Y. The Fungal CYP51s: Their functions, structures, related drug resistance, and inhibitors. Front. Microbiol. 2019, 10, 691. [Google Scholar] [CrossRef]
  63. Banerjee, A.; Pata, J.; Sharma, S.; Monk, B.C.; Falson, P.; Prasad, R. Directed mutational strategies reveal drug binding and transport by the MDR transporters of Candida albicans. J. Fungi 2021, 7, 68. [Google Scholar] [CrossRef]
  64. Monod, M.; Feuermann, M.; Salamin, K.; Fratti, M.; Makino, M.; Alshahni, M.M.; Makimura, K.; Yamada, T. Trichophyton rubrum azole resistance mediated by a new ABC transporter, TruMDR3. Antimicrob. Agents Chemother. 2019, 63, e00863-19. [Google Scholar] [CrossRef]
  65. Yamada, T.; Yaguchi, T.; Maeda, M.; Alshahni, M.M.; Salamin, K.; Guenova, E.; Feuermann, M.; Monod, M. Gene Amplification of CYP51B: A New Mechanism of Resistance to Azole Compounds in Trichophyton indotineae. Antimicrob. Agents Chemother. 2022, 66, e0005922. [Google Scholar] [CrossRef] [PubMed]
  66. Rosam, K.; Monk, B.C.; Lackner, M. Sterol 14α-demethylase ligand-binding pocket-mediated acquired and intrinsic azole resistance fungel pathogens. J. Fungi 2020, 7, 1. [Google Scholar] [CrossRef]
  67. Brunner, P.C.; Stefanato, F.L.; McDonald, B.A. Evolution of the CYP51 gene in Mycosphaerella graminicola: Evidence for intragenic recombination and selective replacement. Mol. Plant Pathol. 2008, 9, 305–316. [Google Scholar] [CrossRef] [PubMed]
  68. Cañas-Gutiérrez, G.P.; Angarita-Velásquez, M.J.; Restrepo-Flórez, J.M.; Rodríguez, P.; Moreno, C.X.; Arango, R. Analysis of the CYP51 gene and encoded protein in propiconazole-resistant isolates of Mycosphaerella fijiensis. Pest Manag. Sci. 2009, 65, 892–899. [Google Scholar] [CrossRef] [PubMed]
Jof 10 00768 g001
Figure 1. T. mentagrophytes genotype VIII (T. indotineae) on Sabouraud’s dextrose agar: (a) without cycloheximide; (b) with cycloheximide. (c,d) Microscopic image with micro- and macroconidia.
Figure 1. T. mentagrophytes genotype VIII (T. indotineae) on Sabouraud’s dextrose agar: (a) without cycloheximide; (b) with cycloheximide. (c,d) Microscopic image with micro- and macroconidia.
Jof 10 00768 g001
Jof 10 00768 g002
Figure 2. (a) Age distribution of patients with T. mentagrophytes/T. interdigitale complex (n = 95); (b) gender distribution of patients with T. mentagrophytes/T. interdigitale complex (n = 95).
Figure 2. (a) Age distribution of patients with T. mentagrophytes/T. interdigitale complex (n = 95); (b) gender distribution of patients with T. mentagrophytes/T. interdigitale complex (n = 95).
Jof 10 00768 g002
Jof 10 00768 g003
Figure 3. (a) Duration of illness before participation in the study (n = 95); (b) localization of tinea (multiple answers possible).
Figure 3. (a) Duration of illness before participation in the study (n = 95); (b) localization of tinea (multiple answers possible).
Jof 10 00768 g003
Jof 10 00768 g004
Figure 4. History of previous oral treatment. Specifying multiple preparations was possible.
Figure 4. History of previous oral treatment. Specifying multiple preparations was possible.
Jof 10 00768 g004
Jof 10 00768 g005
Figure 5. (a) Phylogenetic tree according to ITS-rDNA. Statistical method: maximum likelihood; test of phylogeny: bootstrap method; no. of bootstrap replications: 1000; red square: sequences from the Bangladesh study, rooted by Trichophyton quinckeanum. Evolutionary analyses were conducted in MEGA X (Version 10.1.6). III* is a subgroup of genotype III. (b) Phylogenetic tree according to tef1-α. Statistical method: maximum likelihood; test of phylogeny: bootstrap method; no. of bootstrap replications: 1000; red square: sequences from the Bangladesh study, rooted by Trichophyton quinckeanum. Evolutionary analyses were conducted in MEGA X (Version 10.1.6). III* is a subgroup of genotype III.
Figure 5. (a) Phylogenetic tree according to ITS-rDNA. Statistical method: maximum likelihood; test of phylogeny: bootstrap method; no. of bootstrap replications: 1000; red square: sequences from the Bangladesh study, rooted by Trichophyton quinckeanum. Evolutionary analyses were conducted in MEGA X (Version 10.1.6). III* is a subgroup of genotype III. (b) Phylogenetic tree according to tef1-α. Statistical method: maximum likelihood; test of phylogeny: bootstrap method; no. of bootstrap replications: 1000; red square: sequences from the Bangladesh study, rooted by Trichophyton quinckeanum. Evolutionary analyses were conducted in MEGA X (Version 10.1.6). III* is a subgroup of genotype III.
Jof 10 00768 g005
Jof 10 00768 g006
Figure 6. In-house breakpoint resistance testing of T. mentagrophytes ITS genotype VIII (T. indotineae) against terbinafine (left) and itraconazole (right). No visible growth in the well corresponds to sensitivity. Visible growth in the well means resistance: (a) strain is resistant to both terbinafine (MIC > 0.5 µg/mL) and itraconazole (MIC > 0.25 µg/mL); (b) strain is resistant to terbinafine (MIC > 0.5 µg/mL) and sensitive to itraconazole (MIC < 0.1 µg/mL); (c) strain is sensitive to terbinafine (MIC < 0.1 µg/mL) and itraconazole (MIC < 0.1 µg/mL).
Figure 6. In-house breakpoint resistance testing of T. mentagrophytes ITS genotype VIII (T. indotineae) against terbinafine (left) and itraconazole (right). No visible growth in the well corresponds to sensitivity. Visible growth in the well means resistance: (a) strain is resistant to both terbinafine (MIC > 0.5 µg/mL) and itraconazole (MIC > 0.25 µg/mL); (b) strain is resistant to terbinafine (MIC > 0.5 µg/mL) and sensitive to itraconazole (MIC < 0.1 µg/mL); (c) strain is sensitive to terbinafine (MIC < 0.1 µg/mL) and itraconazole (MIC < 0.1 µg/mL).
Jof 10 00768 g006
Table 1. List of strains and genotypes used to construct the dendrogram, including the accession number of the National Center for Biotechnology Information (NCBI) in Bethesda, MD, USA. The sequences obtained in the present study are marked in bold. II* is a subgroup of genotype II. III* is a subgroup of genotype III.
Table 1. List of strains and genotypes used to construct the dendrogram, including the accession number of the National Center for Biotechnology Information (NCBI) in Bethesda, MD, USA. The sequences obtained in the present study are marked in bold. II* is a subgroup of genotype II. III* is a subgroup of genotype III.
Strain Number, Moelbis LabCollectionITSrDNA–Genebank NCBItef1-α–Genebank NCBISpecies
600270 19-OM951137Moelbis labT. interdigitale ITS genotype I
208223 17 DSM 108620MK447595MK460538T. interdigitale ITS genotype I
600086 21-OM951149Moelbis labT. interdigitale ITS genotype I
200070 17DSM 108,621 MK447596MK460539T. interdigitale ITS genotype II
600283 19 -OM951146600283 19T. interdigitale ITS genotype II
212583 21 -OM951143 Moelbis labT. interdigitale ITS genotype II
250016 18 -MN886818 MN886231T. mentagrophytes ITS genotype II*
212063 17 DSM 108905 MK630684 MK751367T. mentagrophytes ITS genotype II*
208787 21 -OM951152 Moelbis labT. mentagrophytes ITS genotype III
200002 16 DSM 103451 KX866689 MK460540 T. mentagrophytes ITS genotype III
217704 15 DSM 108630 MK450325 MK460541T. mentagrophytes ITS genotype III
217907 15 DSM 108628 MK447605MK460542T. mentagrophytes ITS genotype III*
218893 16 DSM 108629 MK447604MK460543T. mentagrophytes ITS genotype III*
900120 17 DSM 108632 MK447606MK460544 T. mentagrophytes ITS genotype III*
-UKJ 594/19 MN064822.1-T. mentagrophytes ITS genotype VIII T. indotineae
204532 20 -MT333242 MT340525T. mentagrophytes ITS genotype VIII T. indotineae
220575 19 -MT330287MT340521T. mentagrophytes ITS genotype VIII T. indotineae
214174 19DSM 110675 MT330289MT340511T. mentagrophytes ITS genotype VIII T. indotineae
218160 18DSM 108899MT330253MT340503 T. mentagrophytes ITS genotype VIII T. indotineae
216377 17 DSM 108902 MT330249MT340500 T. mentagrophytes ITS genotype VIII T. indotineae
214677 16DSM 108903 MT330252MT340499 T. mentagrophytes ITS genotype VIII T. indotineae
-CBS 130940-KM678173.1 T. mentagrophytes ITS genotype VIII T. indotineae
600158 22-PQ216375PQ232479T. mentagrophytesITS genotype VIII T. indotineae
600145 22-PQ216374PQ232478T. mentagrophytesITS genotype VIII T. indotineae
600121 22-PQ216373PQ232477T. mentagrophytesITS genotype VIII T. indotineae
600115 22-PQ216372PQ232476T. mentagrophytesITS genotype VIII T. indotineae
600103 22-PQ216371PQ232475T. mentagrophytesITS genotype VIII T. indotineae
215003 16DSM 108624 MK450324MK467449 T. mentagrophytes ITS genotype VII
210363 16DSM 108625 MK450323MK467450 T. mentagrophytes ITS genotype VII
218904 16DSM 108622 MK450322 MK467448T. mentagrophytes ITS genotype VII
204543 17DSM 108626 MK447609 MK467445T. mentagrophytes ITS genotype IV
200602 17DSM 108631 MK447607 MK467447T. mentagrophytes ITS genotype IV
200617 17DSM 108627 MK447608 MK467446T. mentagrophytes ITS genotype IV
112636 16-PQ248103Moelbis labT. quinckeanum
Table 2. List of the strains from Bangladesh deposited at the database of the National Center for Biotechnology Information (NCBI) in Bethesda, MD, USA.
Table 2. List of the strains from Bangladesh deposited at the database of the National Center for Biotechnology Information (NCBI) in Bethesda, MD, USA.
SpeciesCountryStrain Number, Moelbis LabYearGenebank NCBI
T. mentagrophytes ITS genotype VIII
T. indotineae		Bangladesh600103/222022PQ216371 (ITS)
PQ232475 (tef1-α)
T. mentagrophytes ITS genotype VIII
T. indotineae		Bangladesh600115/222022PQ216372 (ITS)
PQ232476 (tef1-α)
T. mentagrophytes ITS genotype VIII
T. indotineae		Bangladesh600121/222022PQ216373 (ITS)
PQ232477 (tef1-α)
T. mentagrophytes ITS genotype VIII
T. indotineae		Bangladesh600145/222022PQ216374 (ITS)
PQ232478 (tef1-α)
T. mentagrophytes ITS genotype VIII
T. indotineae		Bangladesh600158/222022PQ216375 (ITS)
PQ232479 (tef1-α)
Trichophyton rubrumBangladesh600173/222022PQ216376 (ITS)
PQ232480 (tef1-α)
Table 3. List of occupation (n = 95).
Table 3. List of occupation (n = 95).
OccupationNumber
Housewife33
Student25
Service19
Businessman5
Peasant3
Industry worker2
Teacher2
Laborer1
Govt. service1
Shopkeeper1
Tailor1
Retired1
No job1
Table 4. History of previous FDCs or intramuscular corticosteroid injection. Specifying multiple preparations was possible.
Table 4. History of previous FDCs or intramuscular corticosteroid injection. Specifying multiple preparations was possible.
History of Previous FDCs Number
Clobetasol + ofloxacin + ornidazole + terbinafine33
Econazole + triamcinolone20
Miconazole + hydrocortisone14
Triamcinolone injection6
Clobetasol6
Betamethasone2
Mometasone1
Triamcinolone1
Not sure9
No6
Yes1
Table 5. Number of dermatophytes found as well as terbinafine- and itraconazole-resistant and -sensitive strains (n = 76).
Table 5. Number of dermatophytes found as well as terbinafine- and itraconazole-resistant and -sensitive strains (n = 76).
Cultures GrownTerbinafine (%)Itraconazole (%)
-Resistant-Sensitive-Resistant-Sensitive
T. mentagrophytes/T. interdigitale7649 (64%)27 (36%)21 (28%)55 (72%)
Total7676 (100%)76 (100%)
Table 6. Association between terbinafine and itraconazole resistance and point mutations.
Table 6. Association between terbinafine and itraconazole resistance and point mutations.
Terbinafine-Resistant + Itraconazole-ResistantTerbinafine-Resistant + Itraconazole-SensitiveTerbinafine-Sensitive + Itraconazole-ResistantTerbinafine-Sensitive + Itraconazole-SensitiveTotal
F397L3170020
A448T1010617
L393S2170120
S436A21025
F397I01001
L393F01001
N429D00011
Double mutation F397L and A448T31004
Total mutations1138101069
No mutation (wild type)00077
Total1138101776
Table 7. Results of resistance testing using the DermaGenius® Resistance Kit.
Table 7. Results of resistance testing using the DermaGenius® Resistance Kit.
Mutation IdentificationPathogen Identification (%)
T. interdigitale/T. mentagrophytesT. rubrum
Wild type38 (38.4)34 (34.3)4 (4.1)
Mutant61 (61.6)61 (61.6)0 (0.0)
Total99 (100)95 (95.9)4 (4.1)
Table 8. Association between point mutations in the Erg11B gene and resistance to itraconazole based on all samples examined.
Table 8. Association between point mutations in the Erg11B gene and resistance to itraconazole based on all samples examined.
MutationBase Exchange in the Erg11 GeneItraconazole TestingNumberPercent (%)
D441YGAT → TATSensitive45.0
D441GGAT → GGTSensitive11.3
G443EGGA → GAAResistant11.3
Sensitive11.3
G443RGGA → AGASensitive11.3
Y444HTAC → CACResistant22.5
Sensitive2835.4
Y444CTAC → TGCResistant22.5
Sensitive33.8
Y444STAC → TCCSensitive45.1
G445SGGT → AGTResistant22.5
Sensitive11.3
G445DGGT → GAT 11.3
Total mutations 5164.6
No mutations Resistant1519.0
Sensitive1316.4
Total 79100
Table 9. Association between itraconazole resistance in vitro and mutations in the Erg11B gene in T. mentagrophytes ITS genotype VIII (T. indotineae) strains (n = 79).
Table 9. Association between itraconazole resistance in vitro and mutations in the Erg11B gene in T. mentagrophytes ITS genotype VIII (T. indotineae) strains (n = 79).
MutationMutation Present (%)Mutation Absent (%)Total (%)
Itraconazole-resistant7 (8.9)15 (19.0)22 (27.9)
Itraconazole-sensitive44 (55.7)13 (16.4)57 (72.1)
Total51 (64.6)28 (35.4)79 (100)
Table 10. Comparison of mutations in the Erg11B gene with the Ala448Thr mutation in the SQLE gene (n = 79).
Table 10. Comparison of mutations in the Erg11B gene with the Ala448Thr mutation in the SQLE gene (n = 79).
Mutation (Erg11B)Ala448Thr (SQLE)NumberPercent (%)
D441YAbsent45.1
D441GAbsent11.3
G443EAbsent22.5
G443RAbsent11.3
Y444HAbsent3037.8
Y444CAbsent56.3
Y444SAbsent45.1
G445SAbsent33.8
G445DPresent11.3
NonePresent1822.8
Absent1012.7
Total 79100
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Bhuiyan, M.S.I.; Verma, S.B.; Illigner, G.-M.; Uhrlaß, S.; Klonowski, E.; Burmester, A.; Noor, T.; Nenoff, P. Trichophyton mentagrophytes ITS Genotype VIII/Trichophyton indotineae Infection and Antifungal Resistance in Bangladesh. J. Fungi 2024, 10, 768. https://doi.org/10.3390/jof10110768

AMA Style

Bhuiyan MSI, Verma SB, Illigner G-M, Uhrlaß S, Klonowski E, Burmester A, Noor T, Nenoff P. Trichophyton mentagrophytes ITS Genotype VIII/Trichophyton indotineae Infection and Antifungal Resistance in Bangladesh. Journal of Fungi. 2024; 10(11):768. https://doi.org/10.3390/jof10110768

Chicago/Turabian Style

Bhuiyan, Mohammed Saiful Islam, Shyam B. Verma, Gina-Marie Illigner, Silke Uhrlaß, Esther Klonowski, Anke Burmester, Towhida Noor, and Pietro Nenoff. 2024. "Trichophyton mentagrophytes ITS Genotype VIII/Trichophyton indotineae Infection and Antifungal Resistance in Bangladesh" Journal of Fungi 10, no. 11: 768. https://doi.org/10.3390/jof10110768

APA Style

Bhuiyan, M. S. I., Verma, S. B., Illigner, G. -M., Uhrlaß, S., Klonowski, E., Burmester, A., Noor, T., & Nenoff, P. (2024). Trichophyton mentagrophytes ITS Genotype VIII/Trichophyton indotineae Infection and Antifungal Resistance in Bangladesh. Journal of Fungi, 10(11), 768. https://doi.org/10.3390/jof10110768

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop