Characterizing the Palm Pathogenic Thielaviopsis Species from Florida
Abstract
:1. Introduction
2. Materials and Methods
2.1. Fungal Isolates and Growth Conditions
2.2. DNA Extraction, PCR, and Sequencing
2.3. Phylogeny
2.4. Morphology, Growth, and Thermotolerance
2.5. Microscopy
2.6. Determination of Mating Type
2.7. Pathogenicity Tests
2.8. Fungicide Sensitivity
3. Results
3.1. Phylogenetic Relationships
3.2. Growth and Colony Morphology
3.3. Thermotolerance
3.4. Mating-Type Locus and Mating Assay
3.5. Pathogenicity Test
3.6. Fungicide Sensitivity
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Streets, R.B. Heart Rot of the Date Palm Caused by Thielaviopsis Paradoxa (DeSeynes) von Höhn; Technical Bulletin (University of Arizona, Agricultural Experiment Station) No. 48; College of Agriculture, University of Arizona: Tucson, AZ, USA, 1933; pp. 443–469. [Google Scholar]
- Elliott, M.L. Thielaviopsis Trunk Rot of Palm. UF/IFAS EDIS 2006, PP219; UF/IFAS Extension, University of Florida: Gainesville, FL, USA, 2019. [Google Scholar] [CrossRef]
- Simone, G.W. Thielaviopsis Diseases. In Compendium of Ornamental Palm Diseases and Disorders; Elliott, M.L., Broschat, T.K., Uchida, J.Y., Simone, G.W., Eds.; American Phytopathological Society: St. Paul, MN, USA, 2004; pp. 37–38. [Google Scholar]
- de Beer, Z.W.; Duong, T.A.; Barnes, I.; Wingfield, B.D.; Wingfield, M.J. Redefining Ceratocystis and Allied Genera. Stud. Mycol. 2014, 79, 187–219. [Google Scholar] [CrossRef] [PubMed]
- Mbenoun, M.; de Beer, Z.W.; Wingfield, M.J.; Wingfield, B.D.; Roux, J. Reconsidering Species Boundaries in the Ceratocystis paradoxa Complex, Including a New Species from Oil Palm and Cacao in Cameroon. Mycologia 2014, 106, 757–784. [Google Scholar] [CrossRef] [PubMed]
- Hunt, J. Taxonomy of the Genus Ceratocystis. Lloydia 1956, 19, 1–58. [Google Scholar]
- van Wyk, M.; Al Adawi, A.O.; Khan, I.A.; Deadman, M.L.; Al Jahwari, A.A.; Wingfield, B.D.; Ploetz, R.; Wingfield, M.J. Ceratocystis manginecans sp. nov., Causal Agent of a Destructive Mango Wilt Disease in Oman and Pakistan. Fungal Divers. 2007, 27, 213–230. [Google Scholar]
- Heath, R.N.; Wingfield, M.J.; Wingfield, B.D.; Meke, G.; Mbaga, A.; Roux, J. Ceratocystis Species on Acacia mearnsii and Eucalyptus Spp. in Eastern and Southern Africa Including Six New Species. Fungal Divers. 2009, 34, 41–68. [Google Scholar]
- Paulin-Mahady, A.E.; Harrington, T.C.; McNew, D. Phylogenetic and Taxonomic Evaluation of Chalara, Chalaropsis, and Thielaviopsis Anamorphs Associated with Ceratocystis. Mycologia 2002, 94, 62–72. [Google Scholar] [CrossRef] [PubMed]
- Harrington, T. The Genus Ceratocystis. Where Does the Oak Wilt Fungus Fit? In Proceedings of the 2nd National Oak Wilt Symposium, Austin, TX, USA, 4–7 June 2007; Appel, D.N., Billings, R.F., Eds.; USDA Forest Service, Forest Health Protection: Austin, TX, USA, 2009; pp. 27–42. [Google Scholar]
- Seifert, K.; Morgan-Jones, G.; Gams, W.; Kendrick, B. The Genera of Hyphomycetes; CBS-KNAW Fungal Biodiversity Centre: Utrecht, The Netherlands, 2011; Series 9; pp. 1–997. [Google Scholar]
- Baker, W.J.; Dransfield, J. Beyond Genera Palmarum: Progress and Prospects in Palm Systematics. Bot. J. Linn. Soc. 2016, 182, 207–233. [Google Scholar] [CrossRef]
- Khachatryan, H.; Hodges, A.W. Florida Nursery Crops and Landscaping Industry Economic Impacts, Situation, and Outlook. UF/IFAS EDIS, 2017, FE946; UF/IFAS Extension, University of Florida: Gainesville, FL, USA, 2014. [Google Scholar] [CrossRef]
- Fulton, H.R. Occurrence of Thielaviopsis paradoxa on the Cocoanut Palm in Florida. Phytopathology 1922, 12, 398–399. [Google Scholar]
- Cook, M.T. Thielaviopsis paradoxa; an Important Disease of Sugar Cane. J. Agric. Univ. Puerto Rico 1932, 16, 205–211. [Google Scholar] [CrossRef]
- Liu, D.; Coloe, S.; Baird, R.; Pederson, J. Rapid Mini-Preparation of Fungal DNA for PCR. J. Clin. Microbiol. 2000, 38, 471. [Google Scholar] [CrossRef]
- White, T.J.; Bruns, T.; Lee, S.; Taylor, J. Amplification and Direct Sequencing of Fungal Ribosomal RNA Genes for Phylogenetics. In PCR Protocols: A Guide to Methods and Applications; Innis, M.A., Gelfand, D.H., Sninsky, J.J., White, T.J., Eds.; Academic Press: New York, NY, USA, 1990; pp. 315–322. [Google Scholar]
- Glass, N.L.; Donaldson, G.C. Development of Primer Sets Designed for Use with the PCR to Amplify Conserved Genes from Filamentous Ascomycetes. Appl. Environ. Microbiol. 1995, 61, 1323–1330. [Google Scholar] [CrossRef] [PubMed]
- Jacobs, K.; Bergdahl, D.R.; Wingfield, M.J.; Halik, S.; Seifert, K.A.; Bright, D.E.; Wingfield, B.D. Leptographium wingfieldii Introduced into North America and Found Associated with Exotic Tomicus piniperda and Native Bark Beetles. Mycol. Res. 2004, 108, 411–418. [Google Scholar] [CrossRef] [PubMed]
- Rehner, S.A.; Buckley, E. A Beauveria Phylogeny Inferred from Nuclear ITS and EF1-α Sequences: Evidence for Cryptic Diversification and Links to Cordyceps Teleomorphs. Mycologia 2005, 97, 84–98. [Google Scholar] [CrossRef] [PubMed]
- Wilken, P.M.; Steenkamp, E.T.; van der Nest, M.A.; Wingfield, M.J.; de Beer, Z.W.; Wingfield, B.D. Unexpected Placement of the MAT1-1-2 Gene in the MAT1-2 Idiomorph of Thielaviopsis. Fungal Genet. Biol. 2018, 113, 32–41. [Google Scholar] [CrossRef] [PubMed]
- Katoh, K.; Toh, H. Parallelization of the MAFFT Multiple Sequence Alignment Program. Bioinformatics 2010, 26, 1899–1900. [Google Scholar] [CrossRef] [PubMed]
- Waterhouse, A.M.; Procter, J.B.; Martin, D.M.A.; Clamp, M.; Barton, G.J. Jalview Version 2-a Multiple Sequence Alignment Editor and Analysis Workbench. Bioinformatics 2009, 25, 1189–1191. [Google Scholar] [CrossRef] [PubMed]
- Kück, P.; Longo, G.C. FASconCAT-G: Extensive Functions for Multiple Sequence Alignment Preparations Concerning Phylogenetic Studies. Front. Zool. 2014, 11, 81. [Google Scholar] [CrossRef] [PubMed]
- Guindon, S.; Dufayard, J.F.; Lefort, V.; Anisimova, M.; Hordijk, W.; Gascuel, O. New Algorithms and Methods to Estimate Maximum-Likelihood Phylogenies: Assessing the Performance of PhyML 3.0. Syst. Biol. 2010, 59, 307–321. [Google Scholar] [CrossRef]
- Lefort, V.; Longueville, J.-E.; Gascuel, O. SMS: Smart Model Selection in PhyML. Mol. Biol. Evol. 2017, 34, 2422–2424. [Google Scholar] [CrossRef]
- Rambaut, A. Figtree V1.4.4. Available online: http://tree.bio.ed.ac.uk/software/figtree/ (accessed on 25 February 2024).
- Leslie, J.F.; Summerell, B.A. Media–Recipes and Preparation. In The Fusarium Laboratory Manual; Blackwell Publishing: Ames, IA, USA, 2006; pp. 3–14. [Google Scholar]
- Alves, K.S. Ec50estimator: An Automated Way to Estimate EC50 for Stratified Datasets Version 0.1.0. Available online: https://cran.r-project.org/package=ec50estimator (accessed on 25 February 2024).
- Álvarez, E.; Llano, G.A.; Loke, J.B.; Chacon, M.I. Characterization of Thielaviopsis paradoxa Isolates from Oil Palms in Colombia, Ecuador and Brazil. J. Phytopathol. 2012, 160, 690–700. [Google Scholar] [CrossRef]
- Tsui, C.K.-M.; DiGuistini, S.; Wang, Y.; Feau, N.; Dhillon, B.; Bohlmann, J.; Hamelin, R.C. Unequal Recombination and Evolution of the Mating-Type (MAT) Loci in the Pathogenic Fungus Grosmannia clavigera and Relatives. G3 Genes Genomes Genet. 2013, 3, 465–480. [Google Scholar] [CrossRef]
- Sandberg, T.E.; Salazar, M.J.; Weng, L.L.; Palsson, B.O.; Feist, A.M. The Emergence of Adaptive Laboratory Evolution as an Efficient Tool for Biological Discovery and Industrial Biotechnology. Metab. Eng. 2019, 56, 1–16. [Google Scholar] [CrossRef]
- Desaint, H.; Aoun, N.; Deslandes, L.; Vailleau, F.; Roux, F.; Berthomé, R. Fight Hard or Die Trying: When Plants Face Pathogens under Heat Stress. New Phytol. 2021, 229, 712–734. [Google Scholar] [CrossRef]
- Garcia-Solache, M.A.; Casadevall, A. Hypothesis: Global Warming Will Bring New Fungal Diseases for Mammals. MBio 2010, 1, e00061-10. [Google Scholar] [CrossRef] [PubMed]
- Milus, E.A.; Kristensen, K.; Hovmøller, M.S. Evidence for Increased Aggressiveness in a Recent Widespread Strain of Puccinia striiformis f. sp. tritici Causing Stripe Rust of Wheat. Phytopathology 2009, 99, 89–94. [Google Scholar] [CrossRef] [PubMed]
- de Vallavieille-Pope, C.; Bahri, B.; Leconte, M.; Zurfluh, O.; Belaid, Y.; Maghrebi, E.; Huard, F.; Huber, L.; Launay, M.; Bancal, M.O. Thermal Generalist Behaviour of Invasive Puccinia striiformis f. sp. tritici Strains under Current and Future Climate Conditions. Plant Pathol. 2018, 67, 1307–1320. [Google Scholar] [CrossRef]
- Garzón, C.D.; Molineros, J.E.; Yánez, J.M.; Flores, F.J.; Jiménez-Gasco, M.d.M.; Moorman, G.W. Sublethal Doses of Mefenoxam Enhance Pythium Damping-off of Geranium. Plant Dis. 2011, 95, 1233–1238. [Google Scholar] [CrossRef]
Isolate 1 | Species Name | Palm Host | Location (County) 2 | Year | ITS | β-Tubulin | TEF1-α |
---|---|---|---|---|---|---|---|
PLM40 | Thielaviopsis ethacetica | Cocos nucifera | West Palm Beach | 2005 | OR137915 | OR136943 | OR147317 |
PLM41 | T. ethacetica | C. nucifera | West Palm Beach | 2005 | OR137916 | OR136944 | OR147324 |
PLM42 | T. ethacetica | C. nucifera | West Palm Beach | 2005 | OR137917 | OR136945 | OR147320 |
PLM70 | T. ethacetica | Syagrus romanzoffiana | Orange | 2005 | OR137918 | OR136946 | OR147325 |
PLM300 | Thielaviopsis sp. | Phoenix dactylifera | West Palm Beach | 2007 | OR137919 | OR136947 | OR147331 |
PLM301 | Thielaviopsis sp. | P. dactylifera | West Palm Beach | 2007 | OR137920 | OR136948 | OR147332 |
PLM636 | T. ethacetica | Wodyetia bifurcata | Unknown, FL | 2012 | OR137921 | OR136949 | OR147321 |
PLM694 | T. ethacetica | P. dactylifera | Manatee | 2013 | OR137922 | OR136950 | OR147326 |
PLM695 | T. ethacetica | P. dactylifera | Manatee | 2013 | OR137923 | OR136951 | OR147318 |
PLM822 | T. ethacetica | P. dactylifera | Miami-Dade | 2015 | OR137924 | OR136952 | OR147327 |
PLM823 | T. ethacetica | P. dactylifera | Miami-Dade | 2015 | OR137925 | OR136953 | OR147328 |
PLM873 | T. ethacetica | C. nucifera | Martin | 2016 | OR137926 | OR136954 | - |
PLM874 | T. ethacetica | C. nucifera | Martin | 2016 | OR137927 | OR136955 | OR147322 |
TP5448 | T. ethacetica | C. nucifera | Lee | 2008 | OR137928 | OR136956 | OR147319 |
TPDP1 | T. ethacetica | P. dactylifera | Unknown, FL | 2022 | OR137929 | OR136957 | OR147323 |
TPDP2 | T. ethacetica | P. dactylifera | Unknown, FL | 2022 | OR137930 | OR136958 | OR147329 |
TPYS | T. ethacetica | P. dactylifera | Unknown, FL | 2022 | OR137931 | OR136959 | OR147330 |
Region | Primer | Sequence (5′—3′) | Reference | PCR Cycling Conditions 1 |
---|---|---|---|---|
ITS | ITS1 | TCCGTAGGTGAACCTGCGG | White et al., 1990 [17] | 95 °C 3 m; 39× [94 °C 30 s; 54 °C 30 s; 72 °C 60 s]; 72 °C 10 m |
ITS4 | TCCTCCGCTTATTGATATGC | |||
β-tubulin | bt1a | TTCCCCCGTCTCCACTTCTTCATG | Glass and Donaldson, 1995 [18] | 96 °C 2 m; 35× [94 °C 30 s; 54 °C 60 s; 72 °C 90 s]; 72 °C 10 m |
bt1b | GACGAGATCGTTCATGTTGAACTC | |||
TEF1-α | EF1-526F | GTCGTYGTYATYGGHCAYGT | Rehner and Buckley, 2005 [20] | 94 °C 4 m; 35× [94 °C 45 s; 61 °C 45 s; 72 °C 60 s]; 72 °C 5 m |
EF1-1567R | ACHGTRCCRATACCACCRATCTT | |||
EF1F | TGCGGTGGTATCGACAAGCGT | Jacobs et al., 2004 [19] | 94 °C 4 m; 35× [94 °C 45 s; 60 °C 45 s; 72 °C 60 s]; 72 °C 5 m | |
EF2R | AGCATGTTGTCGCCGTTGAAG | |||
MAT1-1 | ThPara_111_F | CCACATCAGCCATTTGATTC | Wilken et al., 2018 [21] | 95 °C 3 m; 35× [94 °C 30 s; 58 °C 30 s; 72 °C 60 s]; 72 °C 10 m |
ThPara_111_R | TCTCCCTGAAAAGGGTCCGT | |||
MAT1-2 | MAT121-1F | ATACSCCAGTTCTTGTTC | This study | 95 °C 3 m; 35× [94 °C 30 s; 58 °C 30 s; 72 °C 60 s]; 72 °C 10 m |
MAT121-1R | TGGGCGGTATTGATAATC |
Brand Name | Active Ingredients (Percent) | FRAC Groups | Class | Spectrum of Action |
---|---|---|---|---|
Heritage | Azoxystrobin (50) | 11 | Strobilurin | Broad spectrum, systemic |
Banner Maxx II | Propiconazole (14.3) | 3 | DMIs | Broad spectrum, systemic |
Concert II | Chlorothalonil (38.5); Propiconazole (2.9) | M5; 3 | Multi-site; DMIs | Contact, broad spectrum, systemic |
Headway G | Azoxystrobin (0.31); Propiconazole (0.75) | 11; 3 | Strobilurin; DMIs | Broad spectrum, systemic |
Medallion WDG | Fludioxonil (50) | 12 | Phenylpyrrole | Contact, non-systemic |
Mural | Azoxystrobin (30); Benzovindiflupyr (15) | 11; 7 | Strobilurin; Carboxamides | Broad spectrum, systemic |
Postiva | Difenoconazole (11.5); Pydiflumetofen (6.9) | 3; 7 | DMIs; Carboxamides | Broad spectrum, systemic |
RES505 | Confidential | NA | NA | NA |
AGphite | Mono- and di-potassium salts of phosphorous acid (56) | P07 | Phosphonates | Systemic |
Phospho-jet | Mono- and di-potassium salts of phosphorous acid (45.8) | P07 | Phosphonates | Systemic |
Fungicide | EC50 Estimate 1 | |
---|---|---|
PLM300 | TP5448 | |
Banner Maxx | <0.1 | <0.1 |
Headway | <0.1 | <0.1 |
Postiva | <0.1 | <0.1 |
Medallion | <0.1 | 0.106 |
Concert ll | 0.182 | 0.217 |
RES505 | 0.129 | 0.543 |
Mural | 0.266 | Not estimated |
Heritage | Not estimated | Not estimated |
PhosphoJet | Not estimated | Not estimated |
AGphite | Not estimated | Not estimated |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ayika, M.-G.; Rosano, A.; Valiente, J.; Chakrabarti, S.; Rollins, J.A.; Dhillon, B. Characterizing the Palm Pathogenic Thielaviopsis Species from Florida. J. Fungi 2024, 10, 247. https://doi.org/10.3390/jof10040247
Ayika M-G, Rosano A, Valiente J, Chakrabarti S, Rollins JA, Dhillon B. Characterizing the Palm Pathogenic Thielaviopsis Species from Florida. Journal of Fungi. 2024; 10(4):247. https://doi.org/10.3390/jof10040247
Chicago/Turabian StyleAyika, Marie-Gabrielle, Avril Rosano, Jacqueline Valiente, Seemanti Chakrabarti, Jeffrey A. Rollins, and Braham Dhillon. 2024. "Characterizing the Palm Pathogenic Thielaviopsis Species from Florida" Journal of Fungi 10, no. 4: 247. https://doi.org/10.3390/jof10040247
APA StyleAyika, M.-G., Rosano, A., Valiente, J., Chakrabarti, S., Rollins, J. A., & Dhillon, B. (2024). Characterizing the Palm Pathogenic Thielaviopsis Species from Florida. Journal of Fungi, 10(4), 247. https://doi.org/10.3390/jof10040247