O-Mannosyltransferase CfPmt4 Regulates the Growth, Development and Pathogenicity of Colletotrichum fructicola
Abstract
1. Introduction
2. Materials and Methods
2.1. Strains and Culture Conditions
2.2. RNA-seq Sample Preparation and Data Analysis
2.3. Domain Architecture of CfPmt4 and Phylogenetic Tree
2.4. Gene Replacement and Complementation
2.5. Pathogenicity Assays
2.6. Growth, Conidiation, and Appressoria Formation Assays
2.7. Stress Response Assays
2.8. Glycogen Metabolism
2.9. Statistical Analysis
3. Results
3.1. GO Enrichment Analysis of Differentially Expressed Genes (DEGs)
3.2. Phylogenetic Analysis of CfPmt4 in C. fructicola
3.3. Targeted Deletion of the CfPMT4 Gene in C. fructicola
3.4. CfPmt4 Regulates Pathogenicity of C. fructicola
3.5. CfPmt4 Regulates Vegetative Growth
3.6. CfPmt4 Regulates Conidiation and Appressorium Formation
3.7. CfPmt4 Plays Crucial Roles in Cell Wall Integrity
3.8. CfPmt4 Participates in the Responses to Endoplasmic Reticulum Stress
3.9. CfPmt4 Is Essential for Glycogen Metabolism
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Li, H.; Zhou, G.Y.; Xu, J.P.; Zhu, D.X. Phylogenetic analysis and identification of a new anthracnose pathogen of Camellia oleifera. Plant Prot. 2014, 41, 602–607. [Google Scholar]
- Li, H.; Zhou, G.Y.; Liu, J.A.; Xu, J. Population genetic analyses of the fungal pathogen Colletotrichum fructicola on tea-oil trees in China. PLoS ONE 2016, 11, e0156841. [Google Scholar]
- Li, H.; Li, Y.; Jiang, S.Q.; Liu, J.A.; Zhou, G.Y. Identification of the pathogen of Camellia oleifera anthracnose in Hunan province. Sci. Silvae Sin. 2017, 53, 43–53. [Google Scholar]
- Li, H.; Li, S.Z.; Wang, Y.C.; Liu, J.A.; Xu, J.P.; Zhou, G.Y. Identification and resistance of the pathogen of anthracnose in oil tea nursery. Sci. Silvae Sin. 2019, 55, 85–94. [Google Scholar]
- Zhang, S.; Guo, Y.; Chen, S.; Li, H. The histone acetyltransferase CfGcn5 regulates growth, development, and pathogenicity in the anthracnose fungus Colletotrichum fructicola on the tea-oil tree. Front. Microbiol. 2021, 12, 680415. [Google Scholar]
- Zhang, S.; Guo, Y.; Li, S.; Li, H. Histone acetyltransferase CfGcn5-mediated autophagy governs the pathogenicity of Colletotrichum fructicola. mBio 2022, 13, e0195622. [Google Scholar] [CrossRef] [PubMed]
- Yao, Q.; Guo, Y.; Wei, F.Y.; Li, S.Z.; Zhang, S.P.; Li, H. A bZIP-type transcription factor CHac1 is involved in regulating development and pathogenesis in Colletotrichum fructicola. Mycosystema 2019, 38, 1643–1652. [Google Scholar]
- Li, S.Z.; Li, H. Genome-wide transcriptome analysis of Colletotrichum fructicola CfHAC1 regulation of the response to dithiothreitol stress. Mycosystema 2020, 39, 1886–1896. [Google Scholar]
- Li, S.; Zhang, S.; Li, B.; Li, H. The SNARE protein CfVam7 is required for growth, endoplasmic reticulum stress response, and patho genicity of Colletotrichum fructicola. Front. Microbiol. 2021, 12, 736066. [Google Scholar]
- Li, X.Y.; Zhang, S.P.; He, L. Retromer subunit, CfVps35 is required for growth development and pathogenicity of Colletotrichum fructicola. BMC Genom. Data 2022, 23, 68. [Google Scholar] [CrossRef]
- Tang, W.; Jiang, H.; Aron, O.; Wang, M.; Wang, X.; Chen, J.; Lin, B.; Chen, X.; Zheng, Q.; Gao, X.; et al. Endoplasmic reticulum-associated degradation mediated by MoHrd1 and MoDer1 is pivotal for appressorium development and pathogenicity of Magnaporthe oryzae. Environ. Microbiol. 2020, 22, 4953–4973. [Google Scholar] [PubMed]
- Li, S.; Zhang, J.; Li, M.; Li, E. Research progress of yeast O-mannose-transferase. Life Sci. 2019, 31, 18–26. [Google Scholar]
- Lommel, M.; Strahl, S. Protein O-mannosylation: Conserved from bacteria to humans. Glycobiology 2009, 19, 816–828. [Google Scholar] [CrossRef] [PubMed]
- Prill, S.K.H.; Klinkert, B.; Timpel, C.; Gale, C.A.; Schröppel, K.; Ernst, J.F. PMT family of Candida albicans: Five protein mannosyltransferase isoforms affect growth, morphogenesis and antifungal resistance. Mol. Microbiol. 2005, 55, 546–560. [Google Scholar] [CrossRef] [PubMed]
- Olson, G.M.; Fox, D.S.; Wang, P.; Alspaugh, J.A.; Buchanan, K.L. Role of protein O-Mannosyltransferase Pmt4 in the morphogenesis and virulence of Cryptococcus neoformans. Eukaryot. Cell 2007, 6, 222–234. [Google Scholar] [CrossRef] [PubMed]
- Jin, C. Protein Glycosylation in Aspergillus fumigatus is essential for cell wall synthesis and serves as a promising model of multicellular eukaryotic development. Int. J. Microbiol. 2011, 21, 654251. [Google Scholar]
- FernándezAlvarez, A.; ElíasVillalobos, A.; Ibeas, J.I. The O-mannosyltransferase PMT4 is essential for normal appressorium formation and penetration in Ustilago maydis. Plant Cell 2010, 21, 3397–3412. [Google Scholar] [CrossRef] [PubMed]
- Chen, A. Mechanism of Pmt Protein Family Genes in the Growth and Development of Magnaporthe oryzae. Master’s Thesis, Anhui Agricultural University, Hefei, China, 2015. [Google Scholar]
- González, M.; Brito, N.; Frías, M.; González, C. Botrytis cinerea protein O-Mannosyltransferases play critical roles in morphogenesis, growth, and virulence. PLoS ONE 2013, 8, e65924. [Google Scholar] [CrossRef]
- Xu, Y.; Zhou, H.; Zhao, G.; Yang, J.; Luo, Y.; Sun, S.; Wang, Z.; Li, S.; Jin, C. Genetical and O-glycoproteomic analyses reveal the roles of three protein O-mannosyltransferases in phytopathogen Fusarium oxysporum f.sp. cucumerinum. Fungal Genet. Biol. 2020, 134, 103285. [Google Scholar] [CrossRef]
- Wang, J.J.; Qiu, L.; Chu, Z.J.; Ying, S.H.; Feng, M.G. The connection of protein O-mannosyltransferase family to the biocontrol potential of Beauveria bassiana, a fungal entomopathogen. Glycobiology 2014, 24, 638–648. [Google Scholar] [CrossRef][Green Version]
- Pan, Y.; Pan, R.; Tan, L.; Zhang, Z.; Guo, M. Pleiotropic roles of O-mannosyltransferase Mopmt4 in development and pathogenicity of Magnaporthe oryzae. Curr. Genet. 2018, 65, 223–239. [Google Scholar] [CrossRef] [PubMed]
- Zheng, L.; Wu, X. Advances in research on the infection structure of plant pathogenic fungi. J. Nanjing For. Univ. 2007, 127, 90–94. [Google Scholar]
- Wang, H.; Lin, F.; Wang, Z. Mechanical penetration of plant pathogenic fungi appressorium. J. Microbiol. 2004, 23, 151–157. [Google Scholar]









| Primer | Sequence | Target Region |
|---|---|---|
| CfPMT4-1F | CCTTGTCTGAGGTTCGTCAA | amplify CfPMT4 5′ flank sequence |
| CfPMT4-2R | GTTGGGAATCGGAAATGGAC | amplify CfPMT4 5′ flank sequence |
| CfPMT4-3F | GCGCCGTGAGGTTGAAGTCA | amplify CfPMT4 3′ flank sequence |
| CfPMT4-4R | TTCCAGTGCTCCTTGATCAG | amplify CfPMT4 3′ flank sequence |
| CfPMT4-5F | CGACCGAGAGTTTACGTACA | validation of CfPMT4 gene deletion |
| H855R | GCTGATCTGACCAGTTGC | validation of CfPMT4 gene deletion |
| CfPMT4-7F | ACGACGGACACTTCCACTTC | amplify CfPMT4 gene sequence |
| CfPMT4-8R | GGCCAACATGACGTTATCGC | amplify CfPMT4 gene sequence |
| CfPMT4-9F | CGAGGGCATTCAGAAAAGAC | amplify complemented sequence |
| CfPMT4-10R | TTTGGCGAAGTGCAGGTCGT | amplify complemented sequence |
| Hyg-F | GGCTTGGCTCCAGCTAGTGGAGGT | amplify HPH sequence |
| Hyg-R | CTCTATTCCTTTGCCCTCG | amplify HPH sequence |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yang, D.; Luo, L.; Liu, Y.; Li, H. O-Mannosyltransferase CfPmt4 Regulates the Growth, Development and Pathogenicity of Colletotrichum fructicola. J. Fungi 2024, 10, 330. https://doi.org/10.3390/jof10050330
Yang D, Luo L, Liu Y, Li H. O-Mannosyltransferase CfPmt4 Regulates the Growth, Development and Pathogenicity of Colletotrichum fructicola. Journal of Fungi. 2024; 10(5):330. https://doi.org/10.3390/jof10050330
Chicago/Turabian StyleYang, Di, Lan Luo, Yadi Liu, and He Li. 2024. "O-Mannosyltransferase CfPmt4 Regulates the Growth, Development and Pathogenicity of Colletotrichum fructicola" Journal of Fungi 10, no. 5: 330. https://doi.org/10.3390/jof10050330
APA StyleYang, D., Luo, L., Liu, Y., & Li, H. (2024). O-Mannosyltransferase CfPmt4 Regulates the Growth, Development and Pathogenicity of Colletotrichum fructicola. Journal of Fungi, 10(5), 330. https://doi.org/10.3390/jof10050330

