Next Article in Journal
Genome Mining of Fungal Unique Trichodiene Synthase-like Sesquiterpene Synthases
Previous Article in Journal
Four New Species and a New Combination of Boletaceae (Boletales) from Subtropical and Tropical China
Previous Article in Special Issue
Transcriptomic and Proteomic Insights into the Effect of Sterigmatocystin on Aspergillus flavus
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
JoF
Volume 10
Issue 5
10.3390/jof10050349
jof-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

The Autophagy-Related Protein ATG8 Orchestrates Asexual Development and AFB1 Biosynthesis in Aspergillus flavus

by
Qingru Geng
†,
Jixiang Hu
†,
Pingzhi Xu
,
Tongzheng Sun
,
Han Qiu
,
Shan Wang
,
Fengqin Song
,
Ling Shen
,
Yongxin Li
,
Man Liu
,
Xue Peng
*,
Jun Tian
* and
Kunlong Yang
*
JSNU-UWEC Joint Laboratory of Jiangsu Province Colleges and Universities, School of Life Science, Jiangsu Normal University, Xuzhou 221116, China
*
Authors to whom correspondence should be addressed.
†
These authors contributed equally to this work.
J. Fungi 2024, 10(5), 349; https://doi.org/10.3390/jof10050349
Submission received: 31 March 2024 / Revised: 8 May 2024 / Accepted: 11 May 2024 / Published: 13 May 2024
(This article belongs to the Special Issue Epigenetic and Post-translational Modifications in Regulation of Development and Mycotoxins in Aspergillus)
Browse Figures
Versions Notes

Abstract

:
Autophagy, a conserved cellular recycling process, plays a crucial role in maintaining homeostasis under stress conditions. It also regulates the development and virulence of numerous filamentous fungi. In this study, we investigated the specific function of ATG8, a reliable autophagic marker, in the opportunistic pathogen Aspergillus flavus. To investigate the role of atg8 in A. flavus, the deletion and complemented mutants of atg8 were generated according to the homologous recombination principle. Deletion of atg8 showed a significant decrease in conidiation, spore germination, and sclerotia formation compared to the WT and atg8C strains. Additionally, aflatoxin production was found severely impaired in the ∆atg8 mutant. The stress assays demonstrated that ATG8 was important for A. flavus response to oxidative stress. The fluorescence microscopy showed increased levels of reactive oxygen species in the ∆atg8 mutant cells, and the transcriptional result also indicated that genes related to the antioxidant system were significantly reduced in the ∆atg8 mutant. We further found that ATG8 participated in regulating the pathogenicity of A. flavus on crop seeds. These results revealed the biological role of ATG8 in A. flavus, which might provide a potential target for the control of A. flavus and AFB1 biosynthesis.

1. Introduction

Aspergillus flavus, a saprophytic soil fungus, infects insects and contaminates both preharvest and postharvest seed crops such as maize and peanuts, while also producing potent aflatoxins (AFs) [1,2]. Among the AFs, aflatoxins B1, B2, G1, and G2 are the major four and aflatoxin B1 (AFB1), the most toxic and potent hepatocarcinogenic compound among them, primarily targets the liver [3,4]. Chronic low-level exposure to AFB1 can lead to immunosuppression and hepatocellular carcinoma, while a single acute exposure could be fatal [5,6]. Additionally, A. flavus, the second most common cause of aspergillosis after Aspergillus fumigatus, poses a significant threat to immunocompromised individuals [7,8,9]. Sino-orbital, cerebral, and ophthalmic infections due to A. flavus are the major clinical types in aspergillosis, after pulmonary aspergillosis [10]. It has emerged as a predominant pathogen in fungal sinusitis and keratitis globally [11]. Aflatoxins and Aspergillus not only devalue contaminated crops and cause significant agricultural economic losses but also pose a substantial threat to human health [12,13]. Therefore, tackling the problem of A. flavus and aflatoxin contamination is a pressing and crucial endeavor.
Numerous management strategies have been developed to address A. flavus contamination. One commonly employed approach is improving storage conditions [14]. Moreover, the use of anti-mildew agents is crucial for preventing fungal contamination. For instance, quercetin has been found to effectively inhibit the proliferation of A. flavus in a dose-dependent manner [15]. Research has shown that the growth of A. flavus hyphae and the germination of its spores can be suppressed in the presence of α-Fe2O3 nanorods under sunlight irradiation [16]. Furthermore, p-anisaldehyde (AS) has been recognized as a natural antifungal agent against A. flavus, with a demonstrated ability to modulate AFB1 biosynthesis [17]. In addition, biological control methods, including the use of Trichoderma strains, offer the potential for reducing A. flavus and its toxin levels through enzymatic degradation or complexation [18]. Despite substantial efforts, A. flavus and AF prevention and control remain significant global challenges. Hence, investigating the growth and development processes of A. flavus in its host, along with the regulatory mechanisms of aflatoxin synthesis, will offer critical insights and a theoretical framework for effectively managing A. flavus contamination.
Autophagy is a cellular degradation process in which cytosolic components and organelles are enclosed within double-membrane vesicles known as autophagosomes. These autophagosomes subsequently merge with degradative organelles, such as the vacuole/lysosome, where the enclosed contents are broken down and the resulting macromolecules are recycled [19,20]. ATG8, a ubiquitin-like protein, binds with the lipid phosphatidylethanolamine (PE) to form Atg8-PE, a crucial component for the formation of double-membrane autophagosomes [21]. Consequently, ATG8 is considered a reliable autophagic marker for monitoring autophagy progression in cells at both microscopic and molecular levels [22]. The molecular mechanisms of autophagy have been extensively investigated in yeast, where autophagy initiation, cargo recognition, cargo engulfment, and vesicle closure depend on ATG8 [23]. Furthermore, autophagy plays crucial roles in various aspects of filamentous fungi biology, including asexual and sexual development, nutrient deprivation responses, cellular stress responses, and pathogenicity. In Magnaporthe oryzae, mutant strains with impaired autophagy exhibit severely reduced or completely lost pathogenicity [24,25], along with decreased production of asexual spores [26]. Autophagy also plays a critical role in the growth, development, and pathogenicity of Fusarium graminearum [27] and Fusarium oxysporum [28]. Significantly, its potential role in mycotoxin biosynthesis has been reported in F. graminearum [29,30].
While the function of ATG8 has been reported in other fungi, its specific role in A. flavus remains uncharacterized. In this study, we identified ATG8 in A. flavus and examined its involvement in hyphal growth, sporulation, sclerotia development, stress tolerance, aflatoxin production, and pathogenicity. These findings will provide valuable insights for the development of potential novel control strategies.

2. Materials and Methods

2.1. Strains and Culture Conditions

The A. flavus strains utilized in this research are described in Table 1. All strains were inoculated onto potato dextrose agar (PDA) medium and incubated at 37 °C for 5 days. Spores were gathered employing a 0.001% Tween-20 solution, quantified with a hemocytometer, and the spore concentration was adjusted to 106 spores/mL for subsequent analysis.

2.2. Bioinformatic Identification and Analysis of ATG8

ATG8 sequences from various species were obtained by querying the GenBank reference proteins database (https://www.ncbi.nlm.nih.gov/, accessed on 25 December 2021), which included organisms such as A. flavus, Ceratocystis fimbriata, Saccharomyces cerevisiae, A. oryzae, Homo sapiens, Mus musculus, A. fumigatus, Pyricularia oryzae, A. alternata, F. graminearum, Neurospora crassa, and Drosophila melanogaster. A phylogenetic tree was constructed for these proteins using MEGA 7.0. The domains in ATG8 were visualized using DOG 2.0. Furthermore, the three-dimensional structure of the ATG8 protein was modeled utilizing the SWISS-MODEL homology modeling server (https://swissmodel.expasy.org/, accessed on 6 March 2022).

2.3. Strain Construction

The deleted and complemented mutants of atg8 were constructed according to the homologous recombination principle. To generate the atg8 deleted strain (Δatg8), flanking regions (5′ and 3′) of the atg8 gene, along with argB sequences, were amplified from wild-type genomic DNA using the primers detailed in Table 2. Subsequently, these three fragments were fused by PCR, and the resulting PCR products were then introduced into the protoplasts of the parental strains TJES20.1 and TXZ21.3 following the previously described approach [32]. The upstream homologous arm fragment (AP), downstream homologous arm fragment (BP), and open reading frame (ORF) were amplified from the genomic DNA of selected transformants using three primer pairs (atg8/p1 and argB/170R, argB/1205F and atg8/p6, atg8-orf/F and atg8-orf/R), respectively. This procedure yielded Δatg8 and Δatg8ΔpyrG mutants.
To generate the atg8 complemented strain (atg8C), the upstream region (comprising 5′ flanking regions and the coding sequence of agt8) and the downstream region (containing argB sequences) were amplified from wild-type genomic DNA. Subsequently, the purified PCR products were fused with the A. fumigatus pyrG gene. The resulting fused fragment was then introduced into protoplasts of the Δatg8ΔpyrG mutant to generate the atg8 complemented strain. Confirmation of all transformants was performed via PCR. The transformants were tested by amplifying AP, BP, and ORF fragments with three pairs of primers (c-atg8/p1 and pyrG/801R, pyrG/351F and c-atg8/p6, atg8-orf/F and atg8-orf/R), respectively. Those atg8C transformants containing the AP, BP, and ORF fragments were successfully generated.

2.4. Phenotype Analysis

To analyze the growth phenotypes of mutant strains on various media, the WT, Δatg8, and atg8C strains were incubated in the dark at 37 °C on potato dextrose agar (PDA, HuanKai Microbial, Guangzhou, China), glucose minimal media (GMM, 10 g/L glucose, 6 g/L NaNO3, 1.52 g/L KH2PO4, 0.52 g/L MgSO4·7H2O, 0.52 g/L KCl, and 1 mL/L trace elements), yeast extract glucose tryptone agar (YGT, 5 g/L yeast extract, 20 g/L glucose, and 1 mL/L trace elements), and yeast extract sucrose agar (YES, 20 g/L yeast extract, 150 g/L sucrose, and 1 g/L MgSO4·7H2O) solid culture media for 5 days. Following incubation, colony diameters were measured. Spores were collected using 0.001% Tween 20 and counted by a hemocytometer. To evaluate conidial germination rates, 1 μL of spore solution (106 spores/mL) was spot inoculated onto 1% agar medium and incubated at 37 °C for 3, 6, 9, and 12 h. Spore germination was then observed using an inverted optical microscope. For sclerotium analysis, the spore suspension was inoculated onto glucose minimal sorbitol media (GMMS, 10 g/L glucose, 6 g/L NaNO3, 1.52 g/L KH2PO4, 0.52 g/L MgSO4·7H2O, 0.52 g/L KCl, 1 mL/L trace elements, and 20 g/L sorbitol) solid medium, cultivated at 37 °C for 5 days, and the sclerotia were subsequently counted.

2.5. Aflatoxin B1 Extraction and Determination

For aflatoxin detection, 106 spores were inoculated into 8 mL of the YES liquid culture medium. After 5 days of incubation at 29 °C, 800 μL of the culture was mixed with an equal volume of dichloromethane, followed by centrifugation. Then, 700 μL of the lower liquid phase was collected and air-dried. Following drying, the tube walls were rinsed with 20 μL of dichloromethane, and the remaining 10 μL of the sample was analyzed using thin-layer chromatography (TLC) on a silica gel plate. AFB1 standard solution (Shanghai yuanye Bio-Technology Co., Ltd., Shanghai, China) was used as the control. The TLC results were recorded using a UV gel imaging system (BIO RAD ChemiDoc XRS, Hercules, CA, USA). Finally, Image J 1.8.0 was utilized to quantify the spots.

2.6. Stress Analysis

To investigate the role of ATG8 in A. flavus response to environmental stress, 2 μL of spore suspension was inoculated onto GMM solid medium supplemented with various stress-inducing agents: oxidative stress agents (6 mM and 8 mM H2O2), cell membrane stress agents (0.005% and 0.01% Sodium dodecyl sulfate, SDS), cell wall stress agents (200 μg/mL and 300 μg/mL Calcofluor white (CFW); 200 μg/mL and 300 μg/mL Congo red, CR), and high osmotic stress media (1 M and 2 M KCl, 1 M and 2 M NaCl). The cultures were then incubated at 37 °C in darkness for 5 days. Afterward, colony diameters were measured, and inhibition rates were calculated.

2.7. ROS Measurement

To elucidate the impact of ATG8 on the levels of reactive oxygen species in A. flavus, 100 μL spore suspension (106 spores/mL) was inoculated into 900 μL of PDB medium and incubated at 37 °C for 12 h. Following this, A. flavus mycelia were harvested by centrifugation and washed 2–3 times with PBS. The mycelia were then treated with 10 μM 2′-7′-dichlorofluorescein diacetate (DCFH-DA) at 37 °C for 30 min in darkness and washed with PBS. Subsequently, fluorescence microscopy (Leica, Cellvizio system DualBand, Heidelberg, Germany) was employed to analyze the samples (Excitation = 488 nm; emission = 525 nm).

2.8. Seed Infections

In order to investigate the impact of ATG8 on the pathogenicity of A. flavus, peanut, and maize kernels were utilized in infection experiments. The peanut and maize kernels were first sterilized using 1% sodium hypochlorite and then rinsed three times with sterile water. Subsequently, they were sterilized with 75% ethanol and rinsed again three times with sterile water. Following this, five seeds were placed in a sterile culture dish, and each seed was inoculated with 10 μL of spore suspension (106 spores/mL). After a 5-day incubation period, infected seeds were assessed for conidia and aflatoxin production.

2.9. Real-Time Quantitative Reverse Transcription PCR

To evaluate the gene expression of the brlA pathway, A. flavus strains were grown in PDB at 37 °C under static liquid conditions for 48 h. To assess gene expression associated with aflatoxin production, strains were cultured in YES medium at 29 °C with shaking at 200 rpm for 48 h. For other RT-qPCR analyses, strains were cultured in PDB at 37 °C with shaking at 200 rpm for 48 h. The mycelium was collected and ground with liquid nitrogen. Subsequently, TRIzol (Invitrogen, Carlsbad, CA, USA) was employed to extract total RNA following the manufacturer’s instructions. After RNA isolation, nanophotometer UV/Vis spectrophotometer (Implen, NanoPhotometer® N50, Stuttgart, Germany) was employed to check the quality and quantity of RNA. cDNA was synthesized using a RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific, Waltham, MA, USA). The TransStart Top Green qPCR SuperMix (TransGen Biotech, Beijing, China) was used in the Real-time PCR System (Thermo Fisher Scientific, Waltham, MA, USA). Primers for gene expression detection are listed in Table 3, with the actin gene used as a reference in this experiment.

2.10. Statistical Analysis

In this study, all experiments were conducted independently at least three times. Error bars represent standard deviation. Statistical analyses employed two-tailed unpaired Student’s t-test, two-way analysis of variance, followed by a multiple comparison test with Geisser–Greenhouse correction in GraphPad Prism 9, unless otherwise specified. Statistical significance was indicated by asterisks: * p < 0.05, ** p < 0.01, *** p < 0.001.

3. Results

3.1. Identification of ATG8 Protein in A. flavus and Prediction of the Tertiary Structure of ATG8 Protein

To elucidate the biofunction of ATG8 in A. flavus, we acquired the amino acid sequence of XP_002376260.1 from NCBI (http://www.ncbi.nlm.nih.gov/, accessed on 25 December 2021). Additionally, the amino acid sequences of ATG8 from various species (C. fimbriata, S. cerevisiae, A. oryzae, Homo sapiens, Mus musculus, A. fumigatus, P. oryzae, A. alternata, F. graminearum, N. crassa, Drosophila melanogaster) were retrieved through BLAST. Subsequently, a phylogenetic analysis of ATG8 proteins was conducted using MEGA 7.0. The analysis revealed that A. flavus ATG8 exhibited significant similarity to orthologs of A. fumigatus Af293, A. oryzae RIB40, and F. graminearum PH-1. Domain analysis revealed that the XP_002376260.1 protein contains the conserved domain Ubl_ATG8, showing structural similarity to known and validated ATG8 proteins (Figure 1A). Therefore, we named the XP_002376260.1 protein ATG8. Furthermore, the predicted tertiary structure of A. flavus ATG8 was successfully generated using SWISSMODEL (https://swissmodel.expasy.org/, accessed on 6 March 2022) (Figure 1B).

3.2. Deletion and Complementation of atg8 in A. flavus

The atg8 deletion and complementation mutants were created through homologous recombination (Figure 1C,E). The diagnostic PCR and RT-qPCR analysis were employed to confirm the successful construction of mutant strains. As illustrated in Figure 1D, AP and BP were obtained from the genomic DNA of the Δatg8 strain, while the ORF could not be amplified. Conversely, AP, BP, and ORF fragments were successfully amplified from the genome of the atg8C strain (Figure 1F). Subsequent RT-qPCR analysis further validated the deletion of the atg8 gene in Δatg8 and its restored expression level in atg8C (Figure 1G). These findings indicate the successful construction of the Δatg8 and atg8C strains.

3.3. ATG8 Is Crucial for Hyphal Growth and Conidiation in A. flavus

To investigate the impact of ATG8 on hyphal growth and conidiation in A. flavus, wild-type (WT) and mutant strains were cultured on various media (PDA, GMM, YES, and YGT) at 37 °C for 4 days. While colony growth of Δatg8 was notably slower on GMM compared to WT and atg8C, colony diameter remained unchanged for Δatg8 mutants when cultured on PDA, YES, and YGT (Figure 2A,B). Additionally, Figure 2C illustrated a significant decrease in spore production in the Δatg8 strain compared to WT and atg8C across the four different culture media mentioned above. Microscopic examination revealed sparser conidiophores and smaller conidium heads in Δatg8 compared to WT, with conidiophore morphology of atg8C resembling that of WT (Figure 2D). Further assessment of conidia germination rates demonstrated significantly lower rates for Δatg8 compared to WT and atg8C at the 6th, 9th, and 12th hours (Figure 2F,G), indicating inhibition of spore germination due to atg8 deletion in A. flavus. Additionally, the measurement of expression levels of conidium-related genes (brlA, abaA and wetA) showed a sharp decrease in Δatg8 mutants compared to WT and atg8C (Figure 2E). Collectively, these findings confirm the significance of ATG8 in A. flavus development and sporulation formation.

3.4. ATG8 Contributes to Sclerotia Formation

A. flavus relies on the production of sclerotia to survive adverse environmental conditions [33]. To investigate the importance of ATG8 in the sclerotium formation, WT and mutant strains were inoculated on GMMS media at 37 °C for 5 days. Figure 3A,B revealed a significant reduction in the number of sclerotia in Δatg8 compared to WT and atg8C strains. Further RT-qPCR demonstrated that the expression of sclerotium-related genes (sclR and nsdD) in the Δatg8 mutants significantly decreased in comparison with those in WT and atg8C (Figure 3C). These findings suggest that ATG8 is indispensable for sclerotium development in A. flavus.

3.5. ATG8 Regulates Aflatoxin Biosynthesis in A. flavus

Aflatoxin B1 (AFB1), a notorious mycotoxin produced by A. flavus, contaminates different crops such as cotton and maize, and causes immense effects on the health of humans and animals [34,35]. In order to reveal the effect of ATG8 on the AFB1 biosynthesis, we measured AFB1 production in WT, Δatg8, and atg8C strains. TLC assays revealed that the Δatg8 mutant accumulated less AFB1 than the WT and atg8C strains when cultured in YES media (Figure 4A,B). There are 29 genes associated with AF biosynthesis, stages: early, middle, and late stages (Figure 4C). Moreover, we evaluated the expression levels of AF-related genes, which were significantly downregulated as depicted in Figure 4D. The results demonstrated that Δatg8 mutant strain disrupted the ability of A. flavus to produce AFB1.

3.6. Response of ATG8 to Multiple Stresses in A. flavus

To characterize the role of ATG8 in fungal susceptibility to environmental stresses, we treated the Δatg8 with various inhibitors. Figure 5A,B show that the Δatg8 mutant exhibited heightened sensitivity to 200 μg/mL CFW, a cell wall stress agent. Furthermore, compared to the WT and atg8C strains, the sensitivity of Δatg8 mutant to 300 μg/mL CFW, 200 and 300 μg/mL CR, also known as a cell wall stress agent, increased. Then, we determined the sensitivity of Δatg8 mutant to a cell membrane stress agent. Adding SDS to PDA media revealed a downregulation in sensitivity to 0.005% SDS for the Δatg8 mutant. In contrast, the Δatg8 mutant exhibited heightened sensitivity to 0.01% SDS compared to the WT and atg8C strains (Figure 5C,D). Furthermore, we examined the response of A. flavus to hyperosmotic stress following ATG8 deletion by supplementing PDA media with KCl or NaCl. As shown in Figure 5E,F, the sensitivity of the Δatg8 mutant decreased at all tested concentrations of KCl or NaCl. The abovementioned data indicate the involvement of ATG8 in responding to these stress stimuli in A. flavus.
In fungi, autophagy has been recognized as essential for oxidative stress resistance [36]. Therefore, the resistance ability of Δatg8 mutant against oxidative stress was measured. Sensitivity assays on PDA revealed that Δatg8 was very sensitive to the oxidative agent H2O2 (Figure 6A,B). To further confirm that autophagy is involved in resistance to reactive oxygen species (ROS) in A. flavus, we cultured the strains in PDB at 37 °C for 12 h and observed them under fluorescence microscopy. The Δatg8 hyphae, stained with DCFH-DA, emitted significantly brighter green fluorescence compared to WT and atg8C strains, indicating a higher accumulation of ROS in the Δatg8 strain (Figure 6C). RT-qPCR analyses also revealed significantly decreased expression levels of sod1 and yap1 in Δatg8 (Figure 6D). These data indicate the involvement of autophagy in antioxidant stress systems.

3.7. Effect of ATG8 Mutants on Pathogenicity to Crop Seeds

A. flavus is known to produce aflatoxins on various crops, including corn, peanuts, cottonseed, and nuts, resulting in significant agricultural economic losses and posing health risks [37,38]. The pathogenicity of ATG8 on crop seeds was detected. The result indicated that the Δatg8 mutant exhibited reduced mycelia vigor compared to the WT and atg8C strains (Figure 7A). We further detected that in the conidia production from the infected crop seed, as shown in Figure 7B, compared to the WT and atg8C strain, the conidia production of Δatg8 mutant is significantly reduced. All the above results suggested that the Δatg8 mutant is impaired in both infection and sporulation on crop seeds. Additionally, AFB1 production in infected crop seeds was quantified using TLC, and the results showed that the Δatg8 mutant produced little detectable AFB1 in the maize kernels and peanut seed compared to the WT and atg8C strains (Figure 7C,D). These results underscore the crucial role of ATG8 in crop infection by A. flavus.

4. Discussion

Autophagy is a highly conserved evolutionary process where proteins, membranes, and organelles are broken down and repurposed to sustain energy balance within eukaryotic cells [39,40]. In this study, the ATG8, a marker to monitor autophagosome formation [36], was characterized in A. flavus. We identified the atg8 gene and found that the ATG8 protein plays a crucial role in various aspects of A. flavus biology, including vegetative growth, conidial development, pathogenicity, resistance to ROS, and AFB1 biosynthesis.
Autophagy is crucial for fungi, influencing their growth, morphology, and development. Studies in various fungi, such as S. cerevisiae [41], F. verticillioides [42], and A. alternata [36], have shown that mutations or deletions in the ATG8 gene lead to developmental defects or reduced vegetative growth. Our studies were consistent with recent research on ATG8 functions in fungi. Specifically, our study reveals that Δatg8 mutants exhibit similar defects, with the deletion of atg8 resulting in reduced vegetative growth and developmental abnormalities in conidia. These findings collectively support the idea of the conserved roles of ATG8 in regulating cellular differentiation in both yeast and filamentous fungi.
Previous research has highlighted the crucial involvement of autophagy in pathogenicity [43,44]. Histone acetyltransferase acetylates autophagy-related proteins, regulating both appressorium formation and pathogenicity in M. oryzae [39]. Furthermore, inhibiting autophagy may decrease the pathogenicity of F. graminearum [30,45]. In Colletotrichum fructicola, deletion of the cfatg8 and cfatg9 genes impaired appressorium function and caused defects in pathogenicity [46]. Our study further demonstrates that Δatg8 mutants in A. flavus exhibit pathogenicity defects. The reduced pathogenicity of Δatg8 on maize kernels and peanut seeds may arise from various phenotypic abnormalities, including reduced hyphal growth and developmental defects of conidia. These findings highlight the significance of autophagy in pathogenicity.
The ability of fungi to infect hosts is closely linked to their capacity to withstand diverse environmental stresses. To investigate the involvement of ATG8 in A. flavus response to various environmental stresses, inhibitors such as KCl, NaCl, SDS, CFW, and CR were tested. The results indicate that ATG8 plays a significant role in A. flavus response to environmental stresses, including osmotic stress, cell membrane stress, and cell wall stress (Figure 5). The fluorescence microscopy showed that deletion of atg8 leads to the accumulation of high ROS levels. Furthermore, we observed downregulation of genes involved in ROS detoxification in the Δatg8 mutant (Figure 6). Consistent with our results, in A. alternata, the ΔAaAtg8 failed to detoxify ROS effectively, resulting in ROS accumulation [25]. Overall, our findings suggest that autophagy-mediated ROS detoxification plays a critical role in the oxidative stress response.
Aflatoxins have acutely toxic, immunosuppressive, carcinogenic, and teratogenic effects [47,48,49]; therefore, the prevention and control of aflatoxin are crucial. Our study revealed a striking decrease in AFB1 production in the Δatg8 mutant compared to the WT and atg8C strains, indicating that autophagy is necessary for AFB1 biosynthesis in A. flavus. Furthermore, RT-qPCR analysis revealed a downregulation of aflatoxin biosynthesis gene expression in the Δatg8 mutant. It is speculated that ATG8 regulates AFB1 biosynthesis by controlling the gene cluster responsible for aflatoxin biosynthesis in A. flavus.
In summary, we identified the ATG8 protein and constructed atg8 deletion and complementation mutants using a homologous recombination strategy. We proposed that ATG8 is vital for the growth, conidial development, stress resistance, AFB1 biosynthesis, and pathogenicity of A. flavus. Given the crucial role of ATG8 in maintaining autophagy and pathogenicity, future investigations will explore ATG8-interacting proteins to enhance our comprehension of the autophagy regulatory network in A. flavus.

Author Contributions

Conceptualization, K.Y. and F.S.; methodology, K.Y. and J.T.; software, T.S.; validation, H.Q., J.H. and P.X.; formal analysis, Q.G.; investigation, S.W.; resources, K.Y.; data curation, K.Y.; writing—original draft preparation, Q.G.; writing—review and editing, M.L.; visualization, X.P.; supervision, L.S.; project administration, Y.L.; funding acquisition, K.Y. ang J.T. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the National Natural Science Foundation of China (31900036, 31972171, 32322067), the Natural Science Foundation of Jiangsu Province (BK20190994), the Program of Natural Science Foundation of the Jiangsu Higher Education Institutions of China (19KJB180016, 23KJB550004), and the Priority Academic Program Development of Jiangsu Higher Education Institutions (PAPD), Postgraduate Research & Practice Innovation Program of Jiangsu Province (KYCX22_2813, KYCX22_2798, KYCX22_2820), Natural Science Foundation by Xuzhou City (KC21295, KC21160), the Program of Natural Science Foundation of Jiangsu Normal University (18XLRX029).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Data are contained within the article.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Amaike, S.; Keller, N.P.  Aspergillus flavus. Annu. Rev. Phytopathol. 2011, 49, 107–133. [Google Scholar] [CrossRef] [PubMed]
  2. Yang, K.; Tian, J.; Keller, N.P. Post-translational modifications drive secondary metabolite biosynthesis in Aspergillus: A review. Environ. Microbiol. 2022, 24, 2857–2881. [Google Scholar] [CrossRef]
  3. Hedayati, M.T.; Pasqualotto, A.C.; Warn, P.A.; Bowyer, P.; Denning, D.W. Aspergillus flavus: Human pathogen, allergen and mycotoxin producer. Microbiology 2007, 153, 1677–1692. [Google Scholar] [CrossRef]
  4. Ding, C.; Tian, T.; Liu, Q.; Zhao, S.; Tao, T.; Wu, H.; Guo, L. Transcriptomics and metabolomic profiling identify molecular mechanism for Aspergillus flavus infection in grain. Food Front. 2023, 4, 1845–1858. [Google Scholar] [CrossRef]
  5. Lohmar, J.M.; Puel, O.; Cary, J.W.; Calvo, A.M. The Aspergillus flavus rtfA gene regulates plant and animal pathogenesis and secondary metabolism. Appl. Environ. Microbiol. 2019, 85, e02446-18. [Google Scholar] [CrossRef] [PubMed]
  6. Fu, J.; Gu, M.; Yan, H.; Zhang, M.; Xie, H.; Yue, X.; Zhang, Q.; Li, P. Protein biomarker for early diagnosis of microbial toxin contamination: Using Aspergillus flavus as an example. Food Front. 2023, 4, 2013–2023. [Google Scholar] [CrossRef]
  7. Yang, K.; Geng, Q.; Luo, Y.; Xie, R.; Sun, T.; Wang, Z.; Qin, L.; Zhao, W.; Liu, M.; Li, Y.; et al. Dysfunction of FadA-cAMP signalling decreases Aspergillus flavus resistance to antimicrobial natural preservative Perillaldehyde and AFB1 biosynthesis. Environ. Microbiol. 2022, 24, 1590–1607. [Google Scholar] [CrossRef] [PubMed]
  8. Song, Z.; Zhang, Y.; Ti, Y.; Qiao, H.; Niu, C.; Ban, Y.; Wang, X.; Hou, Y.; Lu, R.; Song, Z. A magnetic nanocomposite combined with cinnamic acid for capture–inhibition–separation of Aspergillus fumigatus. Food Front. 2023, 4, 867–882. [Google Scholar] [CrossRef]
  9. Shankar, J.; Thakur, R.; Clemons, K.V.; Stevens, D.A. Interplay of cytokines and chemokines in aspergillosis. J. Fungi 2024, 10, 251. [Google Scholar] [CrossRef]
  10. Chakrabarti, A.; Singh, R. The emerging epidemiology of mould infections in developing countries. Curr. Opin. Infect. Dis. 2011, 24, 521–526. [Google Scholar] [CrossRef]
  11. Krishnan, S.; Manavathu, E.K.; Chandrasekar, P.H. Aspergillus flavus: An emerging non-fumigatus Aspergillus species of significance. Mycoses 2009, 52, 206–222. [Google Scholar] [CrossRef] [PubMed]
  12. Mellon, J.E.; Cotty, P.J.; Dowd, M.K. Aspergillus flavus hydrolases: Their roles in pathogenesis and substrate utilization. Appl. Microbiol. Biotechnol. 2007, 77, 497–504. [Google Scholar] [CrossRef] [PubMed]
  13. Yang, K.; Luo, Y.; Sun, T.; Qiu, H.; Geng, Q.; Li, Y.; Liu, M.; Keller, N.P.; Song, F.; Tian, J. Nitric oxide-mediated regulation of Aspergillus flavus asexual development by targeting TCA cycle and mitochondrial function. J. Hazard. Mater. 2024, 471, 134385. [Google Scholar] [CrossRef] [PubMed]
  14. Pietsch, C.; Müller, G.; Mourabit, S.; Carnal, S.; Bandara, K. Occurrence of fungi and fungal toxins in fish feed during storage. Toxins 2020, 12, 171. [Google Scholar] [CrossRef] [PubMed]
  15. Li, X.M.; Li, Z.Y.; Wang, Y.D.; Wang, J.Q.; Yang, P.L. Quercetin inhibits the proliferation and aflatoxins biosynthesis of Aspergillus flavus. Toxins 2019, 11, 154. [Google Scholar] [CrossRef]
  16. Sun, D.; Mao, J.; Wang, Z.; Li, H.; Zhang, L.; Zhang, W.; Zhang, Q.; Li, P. Inhibition of Aspergillus flavus growth and aflatoxins production on peanuts over α-Fe2O3 nanorods under sunlight irradiation. Int. J. Food Microbiol. 2021, 353, 109296. [Google Scholar] [CrossRef] [PubMed]
  17. Sun, T.; Zhang, N.; Luo, Y.; Qiu, H.; Geng, Q.; Li, Y.; Peng, X.; Song, F.; Tian, J.; Yang, K. p-Anisaldehyde suppresses Aspergillus flavus infection and aflatoxin biosynthesis via targeting cell structure and Ap1-regulatory antioxidant system. Food Front. 2024, 5, 1302–1319. [Google Scholar] [CrossRef]
  18. Ren, X.; Branà, M.T.; Haidukowski, M.; Gallo, A.; Zhang, Q.; Logrieco, A.F.; Li, P.; Zhao, S.; Altomare, C. Potential of Trichoderma spp. for biocontrol of aflatoxin-producing Aspergillus flavus. Toxins 2022, 14, 86. [Google Scholar] [CrossRef] [PubMed]
  19. Yang, Z.; Klionsky, D.J. An overview of the molecular mechanism of autophagy. Curr. Top. Microbiol. Immunol. 2009, 335, 1–32. [Google Scholar]
  20. Xu, D.D.; Du, L.L. Fission yeast autophagy machinery. Cells 2022, 11, 1086. [Google Scholar] [CrossRef]
  21. Wang, J.; Xu, C.; Sun, Q.; Xu, J.; Chai, Y.; Berg, G.; Cernava, T.; Ma, Z.; Chen, Y. Post-translational regulation of autophagy is involved in intra-microbiome suppression of fungal pathogens. Microbiome 2021, 9, 131. [Google Scholar] [CrossRef]
  22. Ivory, B.J.; Smith, H.M.; Cabrera, E.; Robinson, M.R.; Sparks, J.T.; Solem, A.; Ishihara, J.I.; Takahashi, H.; Tsuji, M.; Segarra, V.A. ATG8 is conserved between Saccharomyces cerevisiae and psychrophilic, polar-collected fungi. MicroPubl Biol. 2021, 2021. [Google Scholar] [CrossRef]
  23. Schaaf, M.B.; Keulers, T.G.; Vooijs, M.A.; Rouschop, K.M. LC3/GABARAP family proteins: Autophagy-(un)related functions. FASEB J. 2016, 30, 3961–3978. [Google Scholar] [CrossRef] [PubMed]
  24. Guo, P.; Wang, Y.; Xu, J.; Yang, Z.; Zhang, Z.; Qian, J.; Hu, J.; Yin, Z.; Yang, L.; Liu, M.; et al. Autophagy and cell wall integrity pathways coordinately regulate the development and pathogenicity through MoAtg4 phosphorylation in Magnaporthe oryzae. PLoS Pathog. 2024, 20, e1011988. [Google Scholar] [CrossRef]
  25. Xu, F.; Liu, X.H.; Zhuang, F.L.; Zhu, J.; Lin, F.C. Analyzing autophagy in Magnaporthe oryzae. Autophagy 2011, 7, 525–530. [Google Scholar] [CrossRef]
  26. Deng, Y.Z.; Ramos-Pamplona, M.; Naqvi, N.I. Autophagy-assisted glycogen catabolism regulates asexual differentiation in Magnaporthe oryzae. Autophagy 2009, 5, 33–43. [Google Scholar] [CrossRef]
  27. Josefsen, L.; Droce, A.; Sondergaard, T.E.; Sørensen, J.L.; Bormann, J.; Schäfer, W.; Giese, H.; Olsson, S. Autophagy provides nutrients for nonassimilating fungal structures and is necessary for plant colonization but not for infection in the necrotrophic plant pathogen Fusarium graminearum. Autophagy 2012, 8, 326–337. [Google Scholar] [CrossRef]
  28. Khalid, A.R.; Lv, X.; Naeem, M.; Mehmood, K.; Shaheen, H.; Dong, P.; Qiu, D.; Ren, M. Autophagy related gene (ATG3) is a key regulator for cell growth, development, and virulence of Fusarium oxysporum. Genes 2019, 10, 658. [Google Scholar] [CrossRef]
  29. Chen, Y.; Zheng, S.; Ju, Z.; Zhang, C.; Tang, G.; Wang, J.; Wen, Z.; Chen, W.; Ma, Z. Contribution of peroxisomal docking machinery to mycotoxin biosynthesis, pathogenicity and pexophagy in the plant pathogenic fungus Fusarium graminearum. Environ. Microbiol. 2018, 20, 3224–3245. [Google Scholar] [CrossRef] [PubMed]
  30. Lv, W.; Wang, C.; Yang, N.; Que, Y.; Talbot, N.J.; Wang, Z. Genome-wide functional analysis reveals that autophagy is necessary for growth, sporulation, deoxynivalenol production and virulence in Fusarium graminearum. Sci. Rep. 2017, 7, 11062. [Google Scholar] [CrossRef] [PubMed]
  31. Yang, K.; Shadkchan, Y.; Tannous, J.; Landero Figueroa, J.A.; Wiemann, P.; Osherov, N.; Wang, S.; Keller, N.P. Contribution of ATPase copper transporters in animal but not plant virulence of the crossover pathogen Aspergillus flavus. Virulence 2018, 9, 1273–1286. [Google Scholar] [CrossRef]
  32. Yang, K.; Liang, L.; Ran, F.; Liu, Y.; Li, Z.; Lan, H.; Gao, P.; Zhuang, Z.; Zhang, F.; Nie, X.; et al. The DmtA methyltransferase contributes to Aspergillus flavus conidiation, sclerotial production, aflatoxin biosynthesis and virulence. Sci. Rep. 2016, 6, 23259. [Google Scholar] [CrossRef]
  33. Luis, J.M.; Carbone, I.; Payne, G.A.; Bhatnagar, D.; Cary, J.W.; Moore, G.G.; Lebar, M.D.; Wei, Q.; Mack, B.; Ojiambo, P.S. Characterization of morphological changes within stromata during sexual reproduction in Aspergillus flavus. Mycologia 2020, 112, 908–920. [Google Scholar] [CrossRef]
  34. Shabeer, S.; Asad, S.; Jamal, A.; Ali, A. Aflatoxin contamination, its impact and management strategies: An updated review. Toxins 2022, 14, 307. [Google Scholar] [CrossRef]
  35. Fasoyin, O.E.; Yang, K.; Qiu, M.; Wang, B.; Wang, S.; Wang, S. Regulation of morphology, aflatoxin production, and virulence of Aspergillus flavus by the major nitrogen regulatory gene areA. Toxins 2019, 11, 718. [Google Scholar] [CrossRef]
  36. Wu, P.C.; Choo, C.Y.L.; Lu, H.Y.; Wei, X.Y.; Chen, Y.K.; Yago, J.I.; Chung, K.R. Pexophagy is critical for fungal development, stress response, and virulence in Alternaria alternata. Mol. Plant Pathol. 2022, 23, 1538–1554. [Google Scholar] [CrossRef]
  37. Bhatnagar, D.; Cary, J.W.; Ehrlich, K.; Yu, J.; Cleveland, T.E. Understanding the genetics of regulation of aflatoxin production and Aspergillus flavus development. Mycopathologia 2006, 162, 155–166. [Google Scholar] [CrossRef]
  38. Jayaprakash, A.; Roy, A.; Thanmalagan, R.R.; Arunachalam, A.; Ptv, L. Immune response gene coexpression network analysis of Arachis hypogaea infected with Aspergillus flavus. Genomics 2021, 113, 2977–2988. [Google Scholar] [CrossRef]
  39. Yin, Z.; Chen, C.; Yang, J.; Feng, W.; Liu, X.; Zuo, R.; Wang, J.; Yang, L.; Zhong, K.; Gao, C.; et al. Histone acetyltransferase MoHat1 acetylates autophagy-related proteins MoAtg3 and MoAtg9 to orchestrate functional appressorium formation and pathogenicity in Magnaporthe oryzae. Autophagy 2019, 15, 1234–1257. [Google Scholar] [CrossRef]
  40. Zhu, X.M.; Li, L.; Wu, M.; Liang, S.; Shi, H.B.; Liu, X.H.; Lin, F.C. Current opinions on autophagy in pathogenicity of fungi. Virulence 2019, 10, 481–489. [Google Scholar] [CrossRef]
  41. Pollack, J.K.; Harris, S.D.; Marten, M.R. Autophagy in filamentous fungi. Fungal Genet. Biol. 2009, 46, 1–8. [Google Scholar] [CrossRef]
  42. Wang, Y.; Liu, X.; Xu, Y.; Gu, Y.; Zhang, X.; Zhang, M.; Wen, W.; Lee, Y.W.; Shi, J.; Mohamed, S.R.; et al. The autophagy-related proteins FvAtg4 and FvAtg8 are involved in virulence and fumonisin biosynthesis in Fusarium verticillioides. Virulence 2022, 13, 764–780. [Google Scholar] [CrossRef]
  43. Asif, N.; Lin, F.; Li, L.; Zhu, X.; Nawaz, S. Regulation of autophagy machinery in Magnaporthe oryzae. Int. J. Mol. Sci. 2022, 23, 8366. [Google Scholar] [CrossRef]
  44. Liu, X.H.; Gao, H.M.; Xu, F.; Lu, J.P.; Devenish, R.J.; Lin, F.C. Autophagy vitalizes the pathogenicity of pathogenic fungi. Autophagy 2012, 8, 1415–1425. [Google Scholar] [CrossRef]
  45. Chai, X.; Liu, Y.; Ma, H.; Wang, S.; Niyitanga, E.; He, C. Effects of macroautophagy and mitophagy on the pathogenicity of Fusarium graminearum. Phytopathology 2022, 112, 1928–1935. [Google Scholar] [CrossRef]
  46. Zhang, S.; Guo, Y.; Li, S.; Li, H. Histone acetyltransferase CfGcn5-mediated autophagy governs the pathogenicity of Colletotrichum fructicola. mBio 2022, 13, e0195622. [Google Scholar] [CrossRef]
  47. Pickova, D.; Ostry, V.; Toman, J.; Malir, F. Aflatoxins: History, significant milestones, recent data on their toxicity and ways to mitigation. Toxins 2021, 13, 399. [Google Scholar] [CrossRef]
  48. Liang, L.; Liu, Y.; Yang, K.; Lin, G.; Xu, Z.; Lan, H.; Wang, X.; Wang, S. The putative histone methyltransferase DOT1 regulates aflatoxin and pathogenicity attributes in Aspergillus flavus. Toxins 2017, 9, 232. [Google Scholar] [CrossRef]
  49. Huang, Z.; Wu, D.; Yang, S.; Fu, W.; Ma, D.; Yao, Y.; Lin, H.; Yuan, J.; Yang, Y.; Zhuang, Z. Regulation of fungal morphogenesis and pathogenicity of Aspergillus flavus by hexokinase AfHxk1 through its domain hexokinase_2. J. Fungi 2023, 9, 1077. [Google Scholar] [CrossRef]
Jof 10 00349 g001
Figure 1. The bioinformatics analysis of ATG8 protein and the construction of A. flavus mutants. (A) Phylogenetic tree analysis of ATG8 orthologs from twelve species (A. flavus NRRL3357, A. fumigatus Af293, A. oryzae RIB40, F. graminearum PH-1, A. alternata, P. oryzae, C. fimbriata CBS 114723, N. crassa OR74A, S. cerevisiae S288C, Drosophila melanogaster, Homo sapiens, Mus musculus) and domain identification of ATG8 visualized by DOG 2.0; (B) Prediction of the tertiary structure of A. flavus ATG8 using SWISS-MODEL (https://swissmodel.expasy.org/, accessed on 6 March 2022); (C) Construction diagram of the Δatg8; (D) PCR verification using genomic DNA from WT and Δatg8 strains, ORF: open reading frame of the atg8 gene, AP: upstream homologous arm fragment, and BP: downstream homologous arm fragment; (E) Construction diagram of the atg8C; (F) PCR verification using genomic DNA from WT and atg8C strains; (G) Relative expression levels of atg8 in WT, Δatg8, and atg8C strains. *** indicates p < 0.001.
Figure 1. The bioinformatics analysis of ATG8 protein and the construction of A. flavus mutants. (A) Phylogenetic tree analysis of ATG8 orthologs from twelve species (A. flavus NRRL3357, A. fumigatus Af293, A. oryzae RIB40, F. graminearum PH-1, A. alternata, P. oryzae, C. fimbriata CBS 114723, N. crassa OR74A, S. cerevisiae S288C, Drosophila melanogaster, Homo sapiens, Mus musculus) and domain identification of ATG8 visualized by DOG 2.0; (B) Prediction of the tertiary structure of A. flavus ATG8 using SWISS-MODEL (https://swissmodel.expasy.org/, accessed on 6 March 2022); (C) Construction diagram of the Δatg8; (D) PCR verification using genomic DNA from WT and Δatg8 strains, ORF: open reading frame of the atg8 gene, AP: upstream homologous arm fragment, and BP: downstream homologous arm fragment; (E) Construction diagram of the atg8C; (F) PCR verification using genomic DNA from WT and atg8C strains; (G) Relative expression levels of atg8 in WT, Δatg8, and atg8C strains. *** indicates p < 0.001.
Jof 10 00349 g001
Jof 10 00349 g002
Figure 2. Effect of ATG8 on growth and conidia of A. flavus. (A) The growth of WT, Δatg8, and atg8C strains on PDA, GMM, YES and YGT at 37 °C for 4 days in the dark; (B) Colonial diameter of WT, Δatg8, and atg8C strains on the mentioned media; (C) Conidia count of WT, Δatg8, and atg8C strains on the mentioned media; (D) Conidiophore morphology of WT, Δatg8, and atg8C strains following 12 h of cultivation in darkness at 37 °C; (E) Relative expression levels of the conidium-related genes brlA, abaA, and wetA in WT, Δatg8, and atg8C strains; (F) Conidium germination of WT, Δatg8, and atg8C strains under dark conditions at 37 ◦C for 3, 6, 9, and 12 h; (G) Conidium germination rate of WT, Δatg8, and atg8C strains at 3, 6, 9, and 12 h. **, *** and ns indicate p < 0.01, p < 0.001 and not significant, respectively.
Figure 2. Effect of ATG8 on growth and conidia of A. flavus. (A) The growth of WT, Δatg8, and atg8C strains on PDA, GMM, YES and YGT at 37 °C for 4 days in the dark; (B) Colonial diameter of WT, Δatg8, and atg8C strains on the mentioned media; (C) Conidia count of WT, Δatg8, and atg8C strains on the mentioned media; (D) Conidiophore morphology of WT, Δatg8, and atg8C strains following 12 h of cultivation in darkness at 37 °C; (E) Relative expression levels of the conidium-related genes brlA, abaA, and wetA in WT, Δatg8, and atg8C strains; (F) Conidium germination of WT, Δatg8, and atg8C strains under dark conditions at 37 ◦C for 3, 6, 9, and 12 h; (G) Conidium germination rate of WT, Δatg8, and atg8C strains at 3, 6, 9, and 12 h. **, *** and ns indicate p < 0.01, p < 0.001 and not significant, respectively.
Jof 10 00349 g002
Jof 10 00349 g003
Figure 3. Sclerotium production of WT, Δatg8, and atg8C strains. (A) Sclerotium development of WT, Δatg8, and atg8C strains observed in GMMS medium at 37 °C for 5 days; (B) Quantification of sclerotia formation in WT, Δatg8, and atg8C strains cultured on GMMS medium; (C) Comparison of relative expression levels of sclerotium-related genes (sclR and nsdD) among WT, Δatg8, and atg8C strains. *** indicates p < 0.001.
Figure 3. Sclerotium production of WT, Δatg8, and atg8C strains. (A) Sclerotium development of WT, Δatg8, and atg8C strains observed in GMMS medium at 37 °C for 5 days; (B) Quantification of sclerotia formation in WT, Δatg8, and atg8C strains cultured on GMMS medium; (C) Comparison of relative expression levels of sclerotium-related genes (sclR and nsdD) among WT, Δatg8, and atg8C strains. *** indicates p < 0.001.
Jof 10 00349 g003
Jof 10 00349 g004
Figure 4. ATG8 contributes to aflatoxin biosynthesis. (A) Thin-layer chromatography analysis of AFB1 production by WT, Δatg8, and atg8C strains in YES liquid media after 5 days of culture at 29 °C; (B) Quantification analysis of AFB1 production in panel A; (C) AF gene cluster in A. flavus categorized into three stages; (D) Relative expression levels of genes related to AF biosynthesis. ** and *** indicate p < 0.01 and p < 0.001, respectively.
Figure 4. ATG8 contributes to aflatoxin biosynthesis. (A) Thin-layer chromatography analysis of AFB1 production by WT, Δatg8, and atg8C strains in YES liquid media after 5 days of culture at 29 °C; (B) Quantification analysis of AFB1 production in panel A; (C) AF gene cluster in A. flavus categorized into three stages; (D) Relative expression levels of genes related to AF biosynthesis. ** and *** indicate p < 0.01 and p < 0.001, respectively.
Jof 10 00349 g004
Jof 10 00349 g005
Figure 5. ATG8 involvement in A. flavus response to environmental stresses. (A) Fungal strains exposed to cell wall stress induced by CFW and CR on PDA for 4 days; (B) Growth inhibition rates under cell wall stress caused by CFW and CR; (C) Fungal strains under cell membrane stress induced by SDS on PDA for 4 days; (D) Growth inhibition rates under cell membrane stress caused by SDS; (E) Fungal strains under osmotic stress induced by KCl and NaCl on PDA for 4 days; (F) Growth inhibition rates under osmotic stress caused by KCl and NaCl. *, *** and ns indicate p < 0.05, p < 0.001 and not significant, respectively.
Figure 5. ATG8 involvement in A. flavus response to environmental stresses. (A) Fungal strains exposed to cell wall stress induced by CFW and CR on PDA for 4 days; (B) Growth inhibition rates under cell wall stress caused by CFW and CR; (C) Fungal strains under cell membrane stress induced by SDS on PDA for 4 days; (D) Growth inhibition rates under cell membrane stress caused by SDS; (E) Fungal strains under osmotic stress induced by KCl and NaCl on PDA for 4 days; (F) Growth inhibition rates under osmotic stress caused by KCl and NaCl. *, *** and ns indicate p < 0.05, p < 0.001 and not significant, respectively.
Jof 10 00349 g005
Jof 10 00349 g006
Figure 6. ATG8’s role in resistance to reactive oxygen species. (A) atg8 deletion increases sensitivity to hydrogen peroxide (H2O2); (B) Growth inhibition rates under H2O2; (C) Fluorescence microscopy analysis of intracellular ROS in the mycelia of atg8 mutants. Intracellular ROS was visualized by DCFH-DA; (D) Relative expression levels of sod1 and yap1 in WT, Δatg8, and atg8C strains. ** and *** indicate p < 0.01 and p < 0.001, respectively.
Figure 6. ATG8’s role in resistance to reactive oxygen species. (A) atg8 deletion increases sensitivity to hydrogen peroxide (H2O2); (B) Growth inhibition rates under H2O2; (C) Fluorescence microscopy analysis of intracellular ROS in the mycelia of atg8 mutants. Intracellular ROS was visualized by DCFH-DA; (D) Relative expression levels of sod1 and yap1 in WT, Δatg8, and atg8C strains. ** and *** indicate p < 0.01 and p < 0.001, respectively.
Jof 10 00349 g006
Jof 10 00349 g007
Figure 7. ATG8’s role in A. flavus colonization on crops. (A) Colonization of peanut seeds and maize kernels by WT, Δatg8, and atg8C strains at 29 °C in darkness for 5 days; (B) Conidia count statistics of the fungal strains on peanut seeds and maize kernels; (C) TLC analysis of AFB1 yield by the fungal strains on the kernels; (D) Quantification analysis of AFB1 production in panel C. ** and *** indicate p < 0.01 and p < 0.001, respectively.
Figure 7. ATG8’s role in A. flavus colonization on crops. (A) Colonization of peanut seeds and maize kernels by WT, Δatg8, and atg8C strains at 29 °C in darkness for 5 days; (B) Conidia count statistics of the fungal strains on peanut seeds and maize kernels; (C) TLC analysis of AFB1 yield by the fungal strains on the kernels; (D) Quantification analysis of AFB1 production in panel C. ** and *** indicate p < 0.01 and p < 0.001, respectively.
Jof 10 00349 g007
Table 1. Aspergillus strains used in this study.
Table 1. Aspergillus strains used in this study.
Name of StrainGenotypeBackgroundSource
NRRL 3357A. flavus Wild-typeNRRL 3357[31]
TJES20.1pyrG1, Δku70, ΔargB::AfpyrGNRRL 3357[31]
TXZ 21.3pyrG1, Δku70, ΔargBNRRL 3357[31]
Δatg8pyrG1, Δku70, ΔargB::AfpyrG, Δatg8::argBNRRL 3357This study
Δatg8ΔpyrGpyrG1, Δku70, Δatg8::argBNRRL 3357This study
atg8CpyrG1, Δku70, Δatg8::argB, atg8::AfpyrGNRRL 3357This study
Table 2. Gene-specific primers used for deleted and complemented mutants.
Table 2. Gene-specific primers used for deleted and complemented mutants.
PrimersSequence (5′-3′)Application
atg8/P1TGAGAAGTGGCAGAGTGACatg8 deletion
atg8/P2TGTCCCAGTTCCTGCTTAGT
atg8/P3TTCTACCGAACTCATCACCACCGGGAAACAGTAGGAAGAAGGTGGAT
atg8/P4TGGTGCCCGCATTCACATGTCACGGGCTTCGCCGTCAGTATGTGTT
atg8/P5AGTCAGTCATCGCCTGTTTT
atg8/P6GCGGTTCCTGGTGGGTTAT
argB/FTCCCGGTGGTGATGAGTTCA. flavus argB
argB/RCCCGTGACATGTGAATGCG
pyrG/FGCCTCAAACAATGCTCTTCACCCA. fumigatus pyrG
pyrG/RGTCTGAGAGGAGGCACTGATGC
atg8-orf/FCAACTCTATCTGATCCGTACatg8 mutant screen
atg8-orf/RGAGACTATGTCAATATGTGCC
argB-170/RTGTCCAGTTCGGGTTAGCG
argB-1205/FACGGTGTCTCAAAGCCAGG
pyrG-801/RCAGGAGTTCTCGGGTTGTCG
pyrG-351/FCAGAGTATGCGGCAAGTCA
c-atg8/p1GTCTGCGCTGAGAAGTGGatg8 complementation
c-atg8/P2GAAATAGAGGTAGCCTAATCG
c-atg8/P3GGGTGAAGAGCATTGTTTGAGGCTTAAAGATCGCCGAAGGTG
c-atg8/P4GCATCATGCCTCCTCTCAGACTCCCGGTGGTGATGAGTTC
c-atg8/P5GACCCAAACTGTCAGAGC
c-atg8/P6ACCCAGGCAATCTTGAGGC
Table 3. Gene-specific primers used for RT-qPCR.
Table 3. Gene-specific primers used for RT-qPCR.
PrimersSequence (5′-3′)Application
atg8/QFGACATCGCCACTATTGATAAGatg8 RT-qPCR
atg8/QRGTTCTTCGTAGATGCTGCTC
abaA/QFACGGAAATCGCCAAAGACAabaA RT-qPCR
abaA/QRCCGGAATTGCCAAAGTAGG
brlA/QFCTCCAGCGTCAACCTTCAbrlA RT-qPCR
brlA/QRTCAAATGCTCTTGCCTCTTA
wetA/QFGGCGTCTAGTTGTCAGGAGwetA RT-qPCR
wetA/QRACATTCATTGAGTTGGAGGA
sclR/QFCAATGAGCCTATGGGAGTGGsclR RT-qPCR
sclR/QRATCTTCGCCCGAGTGGTT
nsdD/QFGGACTTGCGGGTCGTGCTAnsdD RT-qPCR
nsdD/QRAGAACGCTGGGTCTGGTGC
aflD/QFGCTCCCGTCCTACTGTTTCaflD RT-qPCR
aflD/QRCATGTTGGTGATGGTGCTG
aflR/QFAAAGCACCCTGTCTTCCCTAACaflR RT-qPCR
aflR/QRGAAGAGGTGGGTCAGTGTTTGTAG
aflS/QFCGAGTCGCTCAGGCGCTCAAaflS RT-qPCR
aflS/QRGCTCAGACTGACCGCCGCTC
aflM/QFCCCCAGAAGAATTTGACCGaflM RT-qPCR
aflM/QRACGCAAGCAGTGTTAGAGC
aflO/QFGATTGGGATGTGGTCATGCGATTaflO RT-qPCR
aflO/QRGCCTGGGTCCGAAGAATGC
aflP/QFACGAAGCCACTGGTAGAGGAGATGaflP RT-qPCR
aflP/QRGTGAATGACGGCAGGCAGGT
sod1/QFATGGTCAAGGCTGGTAGGsod1 RT-qPCR
sod1/QRCAGTGATAGGCTGGGAGG
yap1/QFCTTCTTCTTGCCGCTCTTyap1 RT-qPCR
yap1/QRTCCGTAACCCAATCCACC
actin/QFACGGTGTCGTCACAAACTGGactin RT-qPCR
actin/QRCGGTTGGACTTAGGGTTGATAG
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Geng, Q.; Hu, J.; Xu, P.; Sun, T.; Qiu, H.; Wang, S.; Song, F.; Shen, L.; Li, Y.; Liu, M.; et al. The Autophagy-Related Protein ATG8 Orchestrates Asexual Development and AFB1 Biosynthesis in Aspergillus flavus. J. Fungi 2024, 10, 349. https://doi.org/10.3390/jof10050349

AMA Style

Geng Q, Hu J, Xu P, Sun T, Qiu H, Wang S, Song F, Shen L, Li Y, Liu M, et al. The Autophagy-Related Protein ATG8 Orchestrates Asexual Development and AFB1 Biosynthesis in Aspergillus flavus. Journal of Fungi. 2024; 10(5):349. https://doi.org/10.3390/jof10050349

Chicago/Turabian Style

Geng, Qingru, Jixiang Hu, Pingzhi Xu, Tongzheng Sun, Han Qiu, Shan Wang, Fengqin Song, Ling Shen, Yongxin Li, Man Liu, and et al. 2024. "The Autophagy-Related Protein ATG8 Orchestrates Asexual Development and AFB1 Biosynthesis in Aspergillus flavus" Journal of Fungi 10, no. 5: 349. https://doi.org/10.3390/jof10050349

APA Style

Geng, Q., Hu, J., Xu, P., Sun, T., Qiu, H., Wang, S., Song, F., Shen, L., Li, Y., Liu, M., Peng, X., Tian, J., & Yang, K. (2024). The Autophagy-Related Protein ATG8 Orchestrates Asexual Development and AFB1 Biosynthesis in Aspergillus flavus. Journal of Fungi, 10(5), 349. https://doi.org/10.3390/jof10050349

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop