Next Article in Journal
Effects of Light on the Fruiting Body Color and Differentially Expressed Genes in Flammulina velutipes
Previous Article in Journal
Effects of Orange Peel Extract on Laccase Activity and Gene Expression in Trametes versicolor
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
JoF
Volume 10
Issue 6
10.3390/jof10060371
jof-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Identification and Pathogenicity of Pestalotioid Species on Alpinia oxyphylla in Hainan Province, China

by
Xiufen Cui
1,2,
Zhigang Hao
1,2,
Menghuai Chen
1,2,
Shuang Song
1,2,
Jinan Zhang
1,2,
Yingbin Li
3,
Jianqiang Li
1,2,
Yixiang Liu
4,* and
Laixin Luo
1,2,*
1
Beijing Key Laboratory of Seed Disease Testing and Control, Department of Plant Pathology, College of Plant Protection, China Agricultural University, Beijing 100193, China
2
Key Laboratory of Surveillance and Management for Plant Quarantine Pests, Ministry of Agriculture and Rural Affairs, China Agricultural University, Beijing 100193, China
3
Department of Pesticide Science, College of Plant Protection, Yunnan Agricultural University, Kunming 650201, China
4
Department of Plant Pathology, College of Plant Protection, Yunnan Agricultural University, Kunming 650201, China
*
Authors to whom correspondence should be addressed.
J. Fungi 2024, 10(6), 371; https://doi.org/10.3390/jof10060371
Submission received: 19 April 2024 / Revised: 12 May 2024 / Accepted: 14 May 2024 / Published: 22 May 2024
(This article belongs to the Section Fungal Evolution, Biodiversity and Systematics)
Browse Figures
Versions Notes

Abstract

:
Alpinia oxyphylla is a traditional Chinese medicinal plant with a medicinal history of more than 1700 years. Ring leaf blight (RLB) disease, caused by pestalotioid species, is an important disease of A. oxyphylla, seriously affecting the yield and quality of its fruits. The causal agent of RLB disease has not been systematically identified or characterized yet. In this study, thirty-six pestalotioid strains were isolated from the leaves and stems of A. oxyphylla that was collected from six cities of Hainan province, China. Based on the multi-locus phylogeny (ITS, tef-1α and tub2) and morphological characteristic analyses, seventeen species belonging to three genera (Neopestalotiopsis, Pestalotiopsis and Pseudopestalotiopsis) were identified, and six new species (N. baotingensis, N. oblatespora, N. olivaceous, N. oxyphylla, N. wuzhishanensis and N. yongxunensis) were described. Pathogenicity tests revealed that strains of Neopestalotiopsis species caused more severe ring leaf blight on A. oxyphylla than strains of Pestalotiopsis and Pseudopestalotiopsis under wounded inoculation conditions.

1. Introduction

Alpinia oxyphylla belongs to the family Zingiberaceae and is an important Chinese herbal plant, with a medicinal history dating back 1700 years [1]. As an edible herb, the traditional medicinal effects of A. oxyphylla’s fruit mainly include warming the kidney, stopping spermatorrhea, arresting polyuria, warming the spleen as well as stopping diarrhea and excess saliva [2,3]. Moreover, the essential oil of A. oxyphylla has various effects including antibacterial, anticancer, antioxidant, vasodilation and improved immunity [4]. A. oxyphylla likes to grow in warm and humid environmental conditions and is commonly planted under rubber trees, areca trees and other economic forests as a semi-shade plant [5,6,7]. A. oxyphylla is mainly distributed in southern China, such as in Hainan, Guangdong and Guangxi provinces. Among them, Hainan, with abundant rainfall and high temperatures, is the most important planting area for A. oxyphylla, accounting for 90% of the total output in China [8,9,10].
The occurrence of diseases causes serious losses to the production and quality of A. oxyphylla. Ring leaf blight (RLB) is an important disease of A. oxyphylla that occurs from the seedling to the fruiting stage, mainly infecting old leaves. The disease often extends from the leaf edge or tip, forming irregular, reddish-brown spots with alternating dark and light brown wavy concentric rings and obvious yellow halos around the periphery of the disease spots, on which numerous small black conidiomata of the pathogen are scattered. The pathogen of this disease can be transmitted through wind and rain, mainly invading through wounds. The high temperature and rainy season contribute to the occurrence of RLB disease, and the high incidence of this disease is from August to September. Under suitable conditions, the proportion of diseased plants can reach more than 50%, and the area of the diseased spots can reach 1/3–1/2 of the leaf surface, even the entire leaf, which has an impressive impact on the growth of A. oxyphylla [11,12].
The pathogen of RLB disease was first reported as Pestalotia palmarum in 1986 [11]. Subsequently, the classification status of P. palmarum was adjusted to the genus Pestalotiopsis, while Pestalotia and Pestalotiopsis were used confusingly in descriptions of A. oxyphylla diseases [13]. The ring brown spot (RBS) disease of A. oxyphylla was caused by Pestalosphaeria alpinia, a sexual morph of pestalotioid fungi [14]. As asexual fungi, most pestalotioid species lack the sexual morphs Pestalosphaeria [15]. Most of pestalotioid species are important plant pathogens and are also commonly found as endophytes or saprophytes, being mainly distributed throughout tropical and temperate regions [16,17,18]. Pestalotioid species can infect the leaves, shoots, flowers, fruits or other parts of plants and cause a variety of diseases in multiple economic crops, including leaf spots, gray blight, shoot dieback, trunk diseases, dry flowers and fruit rot [17,19,20,21,22,23,24,25,26]. Hence, pestalotioid species causing disease in A. oxyphylla need to be reidentified and characterized based on their fungal diversity, molecular systematics and pathogenicity.
The development of a molecular phylogenetic analysis overcomes the limitation of overlapping conidial measurements in the traditional taxonomy of pestalotioid species [16,17,27,28]. In 2014, two novel genera, Neopestalotiopsis and Pseudopestalotiopsis, were segregated from Pestalotiopsis based on conidial characters and multi-locus phylogenetic analyses. The combined sequences of the ITS, tub2 and tef-1α genes were used to construct phylogenetic trees, which become an important basis for distinguishing different species within the genera Pestalotiopsis, Neopestalotiopsis and Pseudopestalotiopsis. Morphologically, Neopestalotiopsis can be easily differentiated from Pestalotiopsis and Pseudopestalotiopsis by the versicolorous median cells of the conidia, and Pseudopestalotiopsis is different from Pestalotiopsis with its three darker, concolorous median cells [17]. Through these methods, many novel pestalotioid species isolated from different plants have been introduced in recent years [19,22,29,30,31,32,33,34].
Therefore, the objective of this study is to clarify the types, characteristics and pathogenicities of pestalotioid species related to disease in A. oxyphylla of Hainan, China.

2. Materials and Methods

2.1. Sample Collection, Fungi Isolation and Morphological Examination

Fresh leaves of A. oxyphylla with typical ring spots and stems with irregular cloud-like spots were collected from the main planted areas at ten townships in six cities of Hainan province, including Baoting, Ledong, Qiongzhong, Sanya, Wanning and Wuzhishan in 2022. Small pieces (5 mm × 5 mm) of leaves or stems were cut from the junctions of diseased and healthy areas, disinfected with 3% sodium hypochlorite for 3 min, then 75% ethanol for 30 s and subsequently washed with sterilized water three times. The treated tissue pieces were dried on sterilized blotting paper and then placed on PDA plates (containing 100 μg/mL streptomycin, 50 μg/mL kanamycin and 100 μg/mL ampicillin). The plates were cultured at room temperature and examined daily for 7 days; then, the marginal mycelia with different morphologies on each plate were transferred to fresh PDA; subsequently, the pestalotioid strains were purified using single-spore culturing according to the results of the ITS sequence analysis.
The pestalotioid strains usually sporulated at room temperature on PDA after 10–20 days. The conidiomata were observed using a dissecting microscope (CNOPTEC, SZ680, Chongqing, China), and the characteristics of spores and conidiophores were observed using an optical microscope (CNOPTEC, DV320, Chongqing, China). All the morphological characteristics of the spores were photographed and measured for at least 30 individuals using OPTPro v.6.1.1.67. The images were processed using Adobe Photoshop CS6. The pure cultures of isolated fungal strains were stored in the seed health center of China Agricultural University.

2.2. DNA Extraction, Gene Sequencing and Phylogenetic Analyses

DNA was extracted from fresh fungal mycelia using the Biomed genomic DNA extraction kit (Biomed, Beijing, China). The partial sequences of three genes (ITS, tef-1α and tub2) were amplified. The PCR was performed according to Table 1, and the PCR products were purified and sequenced at Beijing Tsingke Biotech (Beijing, China).
The nucleotide sequences were checked using Chromas2.4.1 and then analyzed using the BLAST tool on the NCBI platform to assess the closest phylogenetic matches. All related sequences determined using BLAST or referenced previous studies were downloaded from GenBank (Table 2). MAFFT v.7 (https://mafft.cbrc.jp/alignment/software/, accessed on 15 October 2023) was used to align each locus sequence, and MEGA v.11 was used to manually improve the sequences. The three final aligned gene sequences were concatenated using SequenceMatrix (13 May 2024) [40].
The phylogenetic analyses of the combined sequences were carried out using maximum-likelihood (ML) and Bayesian inference (BI) methods. The ML analysis was performed on the CIPRES web portal (https://www.phylo.org, accessed on 31 October 2023) using RAxML-HPC BlackBox 8.2.10, with a GTRGAMMA substitution model and 1000 bootstrap replicates [91]. The BI analysis was implemented using MrBayes v.3.2.7 [92], and MrModeltest 2.2 [92] was used to seek the best-fit nucleotide substitution models for each gene. Two Markov chain Monte Carlo (MCMC) methods were run for 1,000,000 generations, and trees were sampled every 1000th generation. The first 25% of trees, standing for the burn-in phase of the analyses, were discarded, and the remaining trees were estimated to be the posterior probabilities. The ML tree and BI tree were viewed using Figtree v.1.4.4. and modified using WPS Office v.12.1.0.16729.
The new species can be further confirmed through PHI (Pairwise Homoplasy Index) analysis, which can also be used to analyze the species’ boundaries and related taxa [93]. The PHI test was completed using SplitsTree v.4 [94,95], and a value over 0.05 revealed no significant recombination in the dataset. The relationships among closely related species were shown using splits graphs through the LogDet transformation and split decomposition.

2.3. Pathogenicity Test

The pathogenicity of the fungi was tested using the wound inoculation method. Fresh and healthy leaves of A. oxyphylla measuring 30–40 cm long were collected from the field. The surface of the leaves was disinfected by spraying them with 75% ethanol and then washed three times with sterile water. Each fungal isolate was inoculated on 6 sites per leaf with 3 leaf replicates. A piece of mycelium (6 mm diameter), which was taken from the margin of a fresh colony cultured to 2/3 of the PDA plate’s diameter, was placed on the wound of injured leaf using a sterilized needle. A piece of PDA without mycelium was used as the control. The inoculated leaves were placed in a box and cultured in the incubator at 26 °C and 600 LUX, with a 16 h/8 h LED light/dark cycle. After 5 days, disease symptoms were recorded, the lesion area was measured using ImageJ v.1.53c and the data were analyzed using SPSS Statistics 24. The re-isolated fungi from the disease lesion were identified and tested using Koch’s postulates.

3. Results

3.1. Phylogenetic Analyses

A total of 36 pestalotioid isolates were obtained from the leaves (32 isolates) and stems (4 isolates) of A. oxyphylla from six cities in Hainan province. Based on the ITS sequence and color of the intermediate cells of the conidia, 36 strains were classified into three genera, of which 32 strains belong to Neopestalotiopsis, 2 strains belong to Pestalotiopsis and 2 strains belong to Pseudopestalotiopsis.
The phylogenetic tree of Neopestalotiopsis contained 145 taxa, with 2 outgroup taxa (Pestalotiopsis colombiensis and P. diversiseta). A total of 1404 characters, including gaps (503 for ITS, 469 for tef-1a and 432 for tub2), were included in the phylogenetic analysis. For the Bayesian inference, the HKY + G model with a gamma-distributed rate was selected for ITS, the HKY + G model with a gamma-distributed rate was selected for tef1-a and the HKY + I + G model with an invgamma-distributed rate was selected for tub2. Similar tree topologies were acquired using the ML and BI methods, and the best scoring ML tree is shown in Figure 1. The phylogenetic tree depicts 32 Neopestalotiopsis taxa isolated from A. oxyphylla, revealing 6 novel species.
The phylogenetic tree of Pestalotiopsis comprised 78 taxa, with the outgroup taxon N. cubana CBS 600.96. A total of 1457 characters, including gaps (505 for ITS, 495 for tef-1a and 457 for tub2), were included in the phylogenetic analysis. For the Bayesian inference, the GTR + I + G model with an invgamma-distributed rate was selected for ITS, the GTR + G model with a gamma-distributed rate was selected for tef1-a and the GTR + I + G model with an invgamma-distributed rate was selected for tub2. Similar tree topologies were obtained using the ML and BI methods, and the best scoring ML tree is shown in Figure 2. The phylogenetic tree depicts two Pestalotiopsis strains isolated from A. oxyphylla, clustered with the type species of P. hydei.
The alignment of Pseudopestalotiopsis contained 35 taxa, with P. trachicarpicola OP068 as the outgroup taxon. A total of 1392 characters, including gaps (521 for ITS, 442 for tef-1a and 429 for tub2), were included in the phylogenetic analysis. For the Bayesian inference, the HKY + G model with a gamma-distributed rate was selected for ITS, the HKY + G model with a gamma-distributed rate was selected for tef1-a and the HKY + I model with a propinv-distributed rate was selected for tub2. Similar tree topologies were obtained using the ML and BI methods, and the best scoring ML tree is shown in Figure 3. The phylogenetic tree depicts two Pseudopestalotiopsis taxa isolated from A. oxyphylla, clustered with the type species of Ps. avicenniae and Ps. myanmarina, respectively.

3.2. PHI Analyses

The results of the PHI test indicate no obvious recombination (Φw = 0.1064) among N. baotingensis SX41-0706, N. oblatespora YJ11-0708 and their closely related species N. saprophytica MFLUCC 12-0282, N. paeoniea CBS 318.74, N. hydeana MFLUCC 20-0132, N. egyptiaca CBS 140162, N. guajavicola FMBCC 11.4 and N. mesopotamica CBS 299.74 (Figure 4a). And there is no significant recombination (Φw = 0.0786) between N. olivaceous LF25-0709 and its closely related species N. amomi HKAS 124563, N. zingiberis GUCC 21001 and N. magna MFLUCC 12-0652 (Figure 4b). N. yongxunensis YX101-0708, N. wuzhishanensis YX116-0708 and their closely taxa have no significant recombination according to the PHI test results (Φw = 0.1103) (Figure 4c).

3.3. Taxonomy

Based on the multi-locus phylogeny (ITS, tef-1α and tub2) and morphological characteristic analyses, 17 species were identified. Three Neopestalotiopsis strains failed to acquire spores and were not identified as specific species. Six new species are described below. The conidial dimensions of the identified isolates in this study and their closely related strains are shown in Table 3.
Neopestalotiopsis baotingensis X.F. Cui and Z.G. Hao, sp. nov. (Figure 5).
MycoBank: MB854050.
Etymology: It is named in reference to the first collection city of Baoting in Hainan Province.
Holotype: SX41-0706.
Description:
The conidiomata on PDA are solitary or aggregated, globose and dark. The conidiophores often degenerated to conidiogenous cells. Conidiogenous cells are spherical and hyaline. The conidia are fusiform, straight to slightly curved, 18–26 × 5–7.2 μm ( x ¯ = 23.2 × 6.3 μm) and have four septa. The basal cell is conical to obtuse, hyaline, thin and smooth walled and is 3.2–6.2 μm long ( x ¯ = 4.5 μm). The three median cells are 12–17.3 μm ( x ¯ = 14.8 μm), verruculose, versicolored, pale brown to dark brown and the septa and periclinal walls are darker than the rest of the cell. The second cell from the base is pale brown to brown, is paler than the two other cells and is 3.2–5.5 μm long ( x ¯ = 4.4 μm). The third cell is brown to dark brown, darker than the two other cells and is 4–6 μm long ( x ¯ = 4.9 μm). The fourth cell is brown to dark brown and 4–6 μm long ( x ¯ = 5 μm). The apical cell is 2.5–5 μm long ( x ¯ = 3.8 μm) and cylindric to subcylindric, with 2–4 tubular appendages on it, often 2–3, arising from its apex, which are unbranched and 3–30.5 μm long ( x ¯ = 19.7 μm). The single basal appendage is unbranched, tubular, centric and 2.5–10 μm long ( x ¯ = 6.3 μm). A sexual morph was not observed.
Culture characteristics: The colony reached 70 mm in diameter on PDA after 4 days of growth at room temperature. The colony was off white, with dense aerial hyphae on the surface with crenate edges, and its reverse was lemon yellow.
Material examined: The sample originated in China, Hainan Province, Baoting city, Shiling Township, Shuixian village, from leaf spots of A. oxyphylla, which was collected on 6 July 2022 by X.F. Cui and Z.G. Hao (SX41-0706, holotype); the ex-type came from Hainan Province, Wuzhishan city, Shuiman Township, Yongxun village, from spots on the stem base of A. oxyphylla, which was collected on 8 July 2022 by X.F. Cui and Z.G. Hao (YJ34-0708);
Notes: Two strains of Neopestalotiopsis baotingensis were isolated from two cities in Hainan, SX41-0706 and YJ34-0708, with well-supported clusters (ML = 81%, BI = 1). N. baotingensis is closely related to N. saprophytica (MFLUCC 12-0282) in the phylogenetic analysis. The conidiophores of N. baotingensis often degenerated to conidiogenous cells, while those of N. saprophytica were unbranched or irregularly branched; N. baotingensis is shorter than N. saprophytica (N. baotingensis 18–26 μm, x ¯ = 23.2 μm vs. N. saprophytica 22–30 μm, x ¯ = 24.9 μm); N. baotingensis has shorter apical appendages (N. baotingensis 3–30.5 μm, x ¯ = 19.7 μm vs. N. saprophytica 23–35 μm, x ¯ = 27.3 μm). Additionally, there was an 21 bp difference for ITS~tef-1α~tub2 between N. baotingensis and N. saprophytica (4/452 in ITS; 16/746 in tef-1α and 1/415 in tub2). The PHI test for N. baotingensis revealed that there is no obvious recombination between N. baotingensis and its closely related taxa. Therefore, N. baotingensis is classified as a new species in this study.
Table 3. The conidial dimensions of pestalotioid species related to this study.
Table 3. The conidial dimensions of pestalotioid species related to this study.
SpeciesIsolate NumberConidial Size (μm)Apical Appendages (μm)Basal Appendages
NumberLength
N. baotingensisSX41-070618–26 × 5–7.22–43–30.52.5–10
N. saprophyticaMFLUCC 12-028222–30 × 5–62–423–354–7
N. brachiataSX31-070618.5–25.3 × 5.5–7.51–33.7–38.72.5–8
N. brachiataMFLUCC 17-155518.5–25 × 5.5–61–39.5–334–9
N. coffeae-arabicaeBL32-070819.2–25.3 × 5.3–72–410.9–22.61.4–5.4
N. coffeae-arabicaeLF51-070917.8–24.2 × 5–72–46.6–21.62.5–6.8
N. coffeae-arabicaeNM42-070617.5–23.8 × 5.8–7.82–412.7–312.7–9.2
N. coffeae-arabicaeHGUP401916–20 × 5–72–411–163–5
N. cubanaMH51-070819.7–30 × 5–6.82–415.5–32.24–7.5
N. cubanaYX112-070821–29 × 5.6–7.32–418.7–36.53.3–10.3
N. cubanaCBS 600.9620–25 × 8–9.52–421–274–7
N. oblatesporaYJ11-070818–23.2 × 5.5–6.72–410–26.52–9
N. guajavicolaFMBCC 11.423.3 × 6.52–321.84.4
N. olivaceousLF25-070921.5–33.8 × 5.5–7.72–59.5–22.5(0) 1.2–4.8
N. amomiHKAS 12456318–30 × 4–72–37–172–5
N. zingiberisGUCC 2100121–31 × 6–9.51–312–150–6
N. oxyphyllaLF55-070918.8–23.5 × 5.3–7.02–410–25.32.5–8
N. aotearoaCBS 367.5421–28 × 6.5–8.52–35–121.5–4
N. elaeidisMFLUCC 15-073510–20 × 3–72–310–20(0) 2–6
N. petilaMFLUCC 17-173821–26.5 × 6–72–322–293–8
N. piceanaCBS 394.4819.5–25 × 7.5–9321–316–23
N. samarangensisMFLUCC 12-023318–21 × 6.5–7.5312–183.5–5.2
N. rosicolaNM47-070616.9–24.6 × 5.5–7.22–410–251.7–7
N. rosicolaCFCC 5199220.2–25.5 × 5.5–82–417–22.82–9.5
N. vacciniiJR31-070914.5–20.6 × 5.5–7.42–310–22.51.3–5.1
N. vacciniiCAA105920.9 × 6.42–38.9–25.31.7–6.6
N. hispanicaCBS 14768624.4–25.3 × 7.2–7.83–419.5–22.65.1–15.5
N. wuzhishanensisYX116-070819.5–26.5 × 4.5–6.31–39–20.8(0) 0.8–3.8
N. mianyangensisUESTCC 22.000619–23 × 5.5–735.5–113–4
N. yongxunensisYX101-070818.2–25.5 × 5.8–7.52–410.5–24.71.7–7
N. dendrobiiMFLUCC 14-010620.5–23 × 6.5–7.52–35–6.5NA
N. paeonia-suffruticosaCGMCC3.2355420–23 × 9–113–422.5–343.5–7.5
P. hydeiBA11-070820.3–27.8 × 4.5–6.61–33.4–17.21–9.5
P. hydeiMFLUCC 20-013518–35 × 3–61–33–122–8
Ps. avicenniaeLF48-070920.8–30.7 × 5.8–7.91–317.2–33.32–7.8
Ps. avicenniaeMFLUCC 17-043422.5–26.5 × 5.5–61–315.5–28.53–4
Ps. myanmarinaJR34-070925.4–34.8 × 5.8–7.42–318.1–36.92.7–7
Ps. myanmarinaNBRC 1122631–38.5 × 6.5–92–322.5–38.5NA
The strains in this study are indicated in bold font. NA: not available.
Jof 10 00371 g005
Figure 5. Neopestalotiopsis baotingensis (SX41-0706, holotype). (a,b) Colony on PDA (above and reverse), (c,d) conidiomata on PDA, (e,f) conidiogenous cells and (g–l) conidia. Scale bars = 10 μm.
Figure 5. Neopestalotiopsis baotingensis (SX41-0706, holotype). (a,b) Colony on PDA (above and reverse), (c,d) conidiomata on PDA, (e,f) conidiogenous cells and (g–l) conidia. Scale bars = 10 μm.
Jof 10 00371 g005
Neopestalotiopsis oblatespora X.F. Cui and Z.G. Hao, sp. nov. (Figure 6).
MycoBank: MB854051.
Etymology: The name refers to the spore morphology.
Holotype: YJ11-0708.
Description:
Conidiomata were not observed on PDA. The conidiophores are often monopodial, branched and colorless. The conidia are oblate, straight, scarcely curved, 18–23.2 × 5.5–6.7 μm ( x ¯ = 20.2 × 6.2 μm) and have four septa. The basal cell is conical to subcylindrical, pale brown or hyaline, thin and smooth walled and is 2.5–4.5 μm long ( x ¯ = 3.2 μm). The three median cells are 12–15 μm ( x ¯ = 13.6 μm), nearly concolorous or versicolored and brown to dark brown, with the septa and periclinal walls darker than the rest of the cell. The second cell from the base is brown to dark brown and 3.7–6 μm long ( x ¯ = 4.7 μm). The third cell is dark brown and 3–5 μm long ( x ¯ = 4.2 μm). The fourth is dark brown and 3.5–5.3 μm long ( x ¯ = 4.4 μm). The apical cell is 2.5–4 μm long ( x ¯ = 3.2 μm), conical, hyaline, thin and smooth walled. There are 2–4 tubular appendages on the apical cell (often 3) arising from the apex of the apical cell, which are unbranched and 10–26.5 μm long ( x ¯ = 18 μm). The single basal appendage is unbranched, tubular, centric or lateral and 2–9 μm long ( x ¯ = 5.6 μm). A sexual morph was not observed.
Culture characteristics: The colonies reached 70 mm in diameter after 4 days on PDA at room temperature, and had serrated-edge, off-white, sparse aerial hyphae on the surface appearing to radiate, turning grey after sporulation.
Material examined: The sample originated in China, Hainan Province, Wuzhishan city, Shuiman Township, Yongxun village, from spots on the stem base of A. oxyphylla, which was collected on 8 July 2022 by X.F. Cui and Z.G. Hao (YJ11-0708);
Notes:
Based on multigene analyses, Neopestalotiopsis oblatespora is closely related to Neopestalotiopsis guajavicola (FMBCC 11.4), with only a 2 bp difference between them (1/476 in ITS; 1/378 in tef-1α). However, N. oblatespora is distinct from N. guajavicola, with a sporulation structure (branched conidiophores of N. oblatespora vs. conidiomata of N. guajavicola), smaller spores (N. oblatespora: 18–23.2 × 5.5–6.7 μm, x ¯ = 20.2 × 6.2 μm vs. N. guajavicola 21.7–24.9 × 6–7 μm, x ¯ = 23.3 × 6.5 μm) and shorter apical appendages (N. oblatespora: 10–26.5 μm, x ¯ = 18 μm vs. N. guajavicola: 19.1–24.5 μm, x ¯ = 21.8 μm); additionally, N. oblatespora has 2–4 apical appendages, while N. guajavicola has 2–3 appendages. Moreover, N. oblatespora has no significant recombination with its closely taxa according to the PHI test. Therefore, N. oblatespora is classified as a new species in the present study.
Jof 10 00371 g006
Figure 6. Neopestalotiopsis oblatespora (YJ11-0708, holotype). (a,b) Colony on PDA (above and reverse), (c) conidia pile on PDA, (d,e) conidiophores and (f–k) conidia. Scale bars = 10 μm.
Figure 6. Neopestalotiopsis oblatespora (YJ11-0708, holotype). (a,b) Colony on PDA (above and reverse), (c) conidia pile on PDA, (d,e) conidiophores and (f–k) conidia. Scale bars = 10 μm.
Jof 10 00371 g006
Neopestalotiopsis olivaceous X.F. Cui and Z.G. Hao, sp. nov. (Figure 7).
MycoBank: MB854052.
Etymology: The name refers to the color of the colony.
Holotype: LF25-0709.
Description:
Conidiomata were not observed on PDA. The conidia sometimes aggregate, becoming globose, dark green piles. The conidiophore are branched, with spore scars. The conidia are fusiform, straight to obviously irregularly curved, 21.5–33.8 × 5.5–7.7 μm ( x ¯ = 26.5 × 6.3 μm) and have four septa. The basal cell is conical, hyaline or pale olive, smooth, thin walled and 2.7–6.2 μm long ( x ¯ = 4.5 μm). The three median cells are 14 to 21.7 μm long ( x ¯ = 17 μm), pale olivaceous to olivaceous, concolorous and have a rugose wall, with septa darker than the rest of the cell. The second cell from the base is pale olivaceous to olivaceous and 3.3 to 8.5 μm long ( x ¯ = 5.9 μm). The third cell is pale olivaceous to olivaceous and 4 to 6.5 μm long ( x ¯ = 5.1 μm). The fourth cell is pale olivaceous to olivaceous and 4 to 6.5 μm long ( x ¯ = 5.4 μm). The apical cell is 3.5 to 5.5 μm long ( x ¯ = 4.5 μm), hyaline, and conic to acute, with 2 to 5 (often 3–4) tubular appendages on the apical cell, which are inserted at different loci in a crest at the apex of the apical cell, unbranched and 9.5 to 22.5 μm ( x ¯ = 14 μm) long. A single basal appendage, which is occasionally absent, is unbranched, tubular, centric or lateral and 1.2 to 4.8 μm ( x ¯ = 2.4 μm) long. A sexual morph was not observed.
Culture characteristics: The colonies reached 70 mm in diameter on PDA after 7 days of growth at room temperature. The colonies appeared circular, white above and medium dense, with aerial hyphae on the flat surface; its reverse was olivaceous, gradually deepening over time.
Material examined: The sample originated in China, Hainan Province, Qiongzhong city, Changzheng Township, Luofan village, from leaf spots of A. oxyphylla, which was collected on 9 July 2022 by X.F. Cui and Z.G. Hao (LF25-0709, holotype); the ex-type originated in Hainan Province, Baoting city, Shiling Township, Shuixian village, from leaf spots of A. oxyphylla, which was collected on 6 July 2022 by X.F. Cui and Z.G. Hao (SX33-0706); the sample originated in Hainan Province, Wuzhishan city, Shuiman Township, Yongxun village, from leaf spots of A. oxyphylla, which was collected on 8 July 2022 by X.F. Cui and Z.G. Hao (YX45-0708).
Notes: Three strains of Neopestalotiopsis olivaceous were isolated from three cities in Hainan, LF25-0709, SX33-0706 and YX45-0708, with well-supported clusters (ML = 99%, BI = 1). N. olivaceous clusters a sister group with N. amomi (HKAS 124563) and N. zingiberis (GUCC 21001). Molecularly, N. olivaceous can be differentiated from N. amomi (HKAS 124563) and N. zingiberis (GUCC 21001), according to ITS~tef-1α~tub2 (1/471 of ITS and 5/328 of TEF with N. amomi; 3/447 of ITS, 14/719 of TUB and 13/358 of TEF with N. zingiberis). Morphologically, N. olivaceous is distinguished with longer conidia (21.5–33.8 μm of N. olivaceous vs. 18–30 μm of N. amomi and 21–31 μm of N. zingiberis), different numbers of apical appendages (2–5 tubular appendages for N. olivaceous vs. 2–3 for N. amomi and 1–3 for N. zingiberis) and longer apical appendages (N. olivaceous with 9.5–22.5 μm vs. N. amomi with 7–17 μm and N. zingiberis with 12–15 μm). The results of the PHI test showed no significant recombination among N. olivaceous and its closely related taxa. Thus, N. olivaceous is classified as a new species in the present study.
Jof 10 00371 g007
Figure 7. Neopestalotiopsis olivaceous (LF25-0709, holotype). (a,b) Colony on PDA (above and reverse), (c) conidia pile on PDA, (d) conidiophores and (e–l) conidia. Scale bars = 10 μm.
Figure 7. Neopestalotiopsis olivaceous (LF25-0709, holotype). (a,b) Colony on PDA (above and reverse), (c) conidia pile on PDA, (d) conidiophores and (e–l) conidia. Scale bars = 10 μm.
Jof 10 00371 g007
Neopestalotiopsis oxyphylla X.F. Cui and Z.G. Hao, sp. nov. (Figure 8).
MycoBank: MB854053.
Etymology: It is named in reference to the host species, Alpinia oxyphylla.
Holotype: LF55-0709.
Description:
The conidiomata are solitary or aggregated, globose and dark, often immersed in PDA. The conidiophores are distinct, often degenerated to conidiogenous cells. Conidiogenous cells are spherical and hyaline. The conidia are fusiform, straight to slightly curved, 18.8–23.5 × 5.3–7.0 μm ( x ¯ = 21 × 6.2 μm) and have four septa. The basal cell is conical to subcylindrical, hyaline, thin and smooth walled and is 2.3–5 μm long ( x ¯ = 3.9 μm). The three median cells are 11.3–15 μm ( x ¯ = 13 μm), versicolored and brown to dark brown, with septa and periclinal walls that are darker than the rest of the cell and a wall with verrucae. The second cell from the base is pale brown, paler than the other two cells and 3.3–5.2 μm long ( x ¯ = 4.1 μm). The third cell is dark brown, darker than the other two and 3.5–5.0 μm long ( x ¯ = 4.1 μm); the fourth is pale brown to brown and 3.7–5.4 μm long ( x ¯ = 4.4 μm). The apical cell is 2.8–5 μm long ( x ¯ = 3.8 μm), conic to acute, hyaline, thin and smooth walled, with 2–4 tubular appendages on the apical cell (often 2–3) arising from the apex of the apical cell, which are occasionally branched, flexuous and 10–25.3 μm long ( x ¯ = 18.6 μm). The single basal appendage is unbranched, tubular, centric and 2.5–8 μm long ( x ¯ = 5 μm). A sexual morph was not observed.
Culture characteristics: The colonies reached 70 mm in diameter after 9 days on PDA at room temperature, with circular-edge, off-white, dense, central aerial hyphae on the raised surface, with a filiform margin, black fruiting bodies and a reverse similar in color.
Material examined: The sample originated in China, Hainan Province, Qiongzhong city, Changzheng Township, Luofan village, from leaf spots of A. oxyphylla, which was collected on 9 July 2022 by X.F. Cui and Z.G. Hao (LF55-0709, holotype); the ex-type was from Hainan Province, Wuzhishan city, Maoyang Township, Maohui village, from stem base spots of A. oxyphylla, which was collected on 8 July 2022 by X.F. Cui and Z.G. Hao (MJ31-0708); the ex-type originated in Hainan Province, Baoting city, Nanmao Shengli Farm, from leaf spots of A. oxyphylla, which was collected on 6 July 2022 by X.F. Cui and Z.G. Hao (NM44-0706).
Notes:
Based on multigene analyses, Neopestalotiopsis oxyphylla is closely related to N. brachiata (MFLUCC 17-1555), N. elaeidis (MFLUCC 15-0735), N. petila (MFLUCC 17-1738), N. aotearoa (CBS 367.54) and N. piceana (CBS 394.48), with only 0–2 bp difference among them. However, N. oxyphylla is distinct from N. elaeidis, with larger spores (N. oxyphylla: 18.8–23.5 × 5.3–7.0 μm, x ¯ = 21 × 6.2 μm vs. N. elaeidis 10–20 × 3–7 μm, x ¯ = 16 × 5.5 μm) and thinner spores (N. oxyphylla: 5.3–7.0 μm vs. N. aotearoa: 6.5–8.5 μm and N. piceana 7.5–9 μm); N. oxyphylla has different numbers of apical appendages (N. oxyphylla: 2–4; N. brachiata: 1–3; N. aotearoa, N. elaeidis and N. petila: 2–3; N. piceana: 3) and shorter apical appendages (N. oxyphylla: 10–25.3 μm vs. N. brachiata: 9.5–33; N. petila: 22–29 μm, N. piceana: 21–31 μm), but they are longer than those of N. aotearoa (5–12 μm). In addition, N. oxyphylla has shorter basal appendages (N. oxyphylla: 2.5–8 μm vs. N. piceana: 6–23 μm). Therefore, N. oxyphylla is classified as a new species in the present study.
Jof 10 00371 g008
Figure 8. Neopestalotiopsis oxyphylla (LF55-0709, holotype). (a,b) Colony on PDA (above and reverse), (c) conidiomata on PDA, (d,e) conidiogenous cells, and (f–k) conidia. Scale bars = 10 μm.
Figure 8. Neopestalotiopsis oxyphylla (LF55-0709, holotype). (a,b) Colony on PDA (above and reverse), (c) conidiomata on PDA, (d,e) conidiogenous cells, and (f–k) conidia. Scale bars = 10 μm.
Jof 10 00371 g008
Neopestalotiopsis wuzhishanensis X.F. Cui and Z.G. Hao, sp. nov. (Figure 9).
MycoBank: MB854054.
Etymology: It is named in reference to the first collection city of Wuzhishan in Hainan province.
Holotype: YX116-0708.
Description:
The conidiomata on the PDA are solitary, globose and dark. The conidiophores often degenerated to conidiogenous cells. Conidiogenous cells are unclear. The conidia arefusiform, straight, scarcely curved, 19.5–26.5 × 4.5–6.3 μm ( x ¯ = 22.4 × 5.2 μm) and have four septa. The basal cell is conical to subcylindrical, hyaline, thin and smooth walled and is 2.8–5.5 μm long ( x ¯ = 4.2 μm). The three median cells are 12.8–16 μm ( x ¯ = 14.4 μm), nearly concolorous, pale brown and hyaline, with septa and periclinal walls darker than the rest of the cell. The second cell from the base is pale brown and 4–6.2 μm long ( x ¯ = 5.1 μm). The third cell is pale brown and 3.5–5.2 μm long ( x ¯ = 4.4 μm); the fourth is pale brown and 3.8–6.3 μm long ( x ¯ = 4.7 μm). The apical cell is 2.7–5.5 μm long ( x ¯ = 3.6 μm), conic to acute, hyaline, thin and smooth-walled, with 1–3 tubular appendages on the apical cell (often 1–2) arising from the apex of the apical cell, which are unbranched, straight to flexuous and 9–20.8 μm long ( x ¯ = 15.4 μm). There is a single or no basal appendage, which is unbranched, tubular, centric and 0.8–3.8 μm long ( x ¯ = 1.9 μm). A sexual morph is not observed.
Culture characteristics: The colonies reached 70 mm in diameter after 12 days on PDA at room temperature, with circular-edge, white, medium-dense, aerial hyphae on the flat surface, with a filiform margin, black and fruiting bodies. And its reverse was lemon yellow.
Material examined: The sample originated in China, Hainan Province, Wuzhishan city, Shuiman Township, Yongxun village, from leaf spots of A. oxyphylla, which was collected on 8 July 2022 by X.F. Cui and Z.G. Hao (YX116-0708).
Notes:
Neopestalotiopsis wuzhishanensis clusters a sister group to Neopestalotiopsis cubana (CBS 600.96), while N. wuzhishanensis is different from N. cubana depending on ITS, tef-1α and tub2 sequences (3/481 in ITS, 2/434 in tef-1α and 3/715 in tub2). Additionally, there are remarkabe discrepancies in the morphological characteristics: N. wuzhishanensis is thinner (N. wuzhishanensis: 4.5–6.3 μm, x ¯ = 5.2 μm vs. N. cubana 8–9.5 μm, x ¯ = 8.8 μm) and shorter in its apical appendages (N. wuzhishanensis: 9–20.8 μm, x ¯ = 15.4 μm vs. N. cubana: 21–27 μm, x ¯ = 24 μm) and base appendage (N. wuzhishanensis: 0.8–3.8 μm, x ¯ = 1.9 μm vs. N. cubana: 4–7 μm); additionally, the three median cells of N. wuzhishanensis are paler than N. cubana; furthermore, N. cubana has 1–3 apical appendages, while N. cubana carries 2–4 appendages. The results of the PHI test showed that N. wuzhishanensis has no significant recombination with its closely related taxa. Therefore, N. wuzhishanensis is classified as a new species in the present study.
Jof 10 00371 g009
Figure 9. Neopestalotiopsis wuzhishanensis (YX116-0708, holotype). (a,b) Colony on PDA (above and reverse), (c) conidiomata on PDA, (d,e) conidiogenous cells and (f–k) conidia. Scale bars = 10 μm.
Figure 9. Neopestalotiopsis wuzhishanensis (YX116-0708, holotype). (a,b) Colony on PDA (above and reverse), (c) conidiomata on PDA, (d,e) conidiogenous cells and (f–k) conidia. Scale bars = 10 μm.
Jof 10 00371 g009
Neopestalotiopsis yongxunensis X.F. Cui and Z.G. Hao, sp. nov. (Figure 10).
MycoBank: MB854055.
Etymology: The name refers to the first collection village of Yongxun in Hainan Province.
Holotype: YX101-0708.
Description:
The conidiomata on the PDA are solitary or aggregated, globose, dark and embedded or semi-immersed. The conidiophores often degenerated to conidiogenous cells. Conidiogenous cells are unclear. The conidia are fusiform, straight to curved, 18.2–25.5 × 5.8–7.5 μm ( x ¯ = 21.6 × 6.6 μm) and have four septa. The basal cell is conical, hyaline, thin and smooth walled and is 3.0–5.2 μm long ( x ¯ = 4.1 μm). The three median cells are 12–15.2 μm ( x ¯ = 13.7 μm), versicolored, pale brown to brown and have septa and periclinal walls that are darker than the rest of the cell; the second cell from the base is pale brown, paler than the other two cells and is 3.5–5.3 μm long ( x ¯ = 4.3 μm). The third cell is brown, darker than the other two and is 3.8–5.3 μm long ( x ¯ = 4.6 μm). The fourth cell is brown and 4.0–5.2 μm long ( x ¯ = 4.6 μm). The apical cell is 2.5–5.0 μm long ( x ¯ = 3.7 μm), conic to subcylindrical, hyaline, thin and smooth walled, with 2–4 tubular appendages on the apical cell arising from the apex of the apical cell, which are filiform, unbranched, straight to flexuous and 10.5–24.7 μm long ( x ¯ = 18.2 μm). The single basal appendage is unbranched, tubular, centric and 1.7–7 μm long ( x ¯ = 4.2 μm). A sexual morph is not observed.
Culture characteristics: The colonies reached 70 mm in diameter after 4 days on PDA at room temperature, with a circular-edge, white, dense aerial mycelium on the surface; the reverse was similar in color. The fruiting bodies were black, mostly under the hyphae and were visible on the back.
Material examined: The sample originated in China, Hainan Province, Wuzhishan city, Shuiman Township, Yongxun village, from leaf spots of A. oxyphylla, which was collected on 8 July 2022 by X.F. Cui and Z.G. Hao (YX101-0708);
Notes:
Neopestalotiopsis yongxunensis is related to N. dendrobii (MFLUCC 14-0106) and N. paeonia-suffruticosa (HKAS 123212), as shown in the phylogenetic analysis, while N. yongxunensis can be differentiated from N. dendrobii and N. paeonia-suffruticosa depending on ITS, tef1-α and tub2 sequences, showing a 7 bp difference (2/284 in tef1-α and 5/416 in tub2) with N. dendrobii and 10 bp difference (9/440 in tef1-α and 1/715 in tub2) with N. paeonia-suffruticosa. In addition, there are remarkable discrepancies in the morphological characteristics: N. yongxunensis is thinner in its conidia (N. yongxunensis: 5.8–7.5 μm, x ¯ = 6.6 μm vs. N. paeonia-suffruticosa: 9–11 μm, x ¯ = 9.5 μm), has different numbers of apical appendages (N. yongxunensis 2–4 vs. N. paeonia-suffruticosa 3–4) and shorter apical appendages (N. yongxunensis: 10.5–24.7 μm vs. N. paeonia-suffruticosa 22.5–34 μm), while N. yongxunensis differs from N. dendrobii in having longer apical appendages (N. yongxunensis: 10.5–24.7 μm vs. N. dendrobii 5–6.5 μm) with different numbers (N. yongxunensis 2–4 vs. N. dendrobii 2–3). Furthermore, the PHI test indicated that there is no significant recombination between N. yongxunensis and its closely related species. Therefore, N. yongxunensis is classified as a new species in the present study.
Jof 10 00371 g010
Figure 10. Neopestalotiopsis yongxunensis (YX101-0708, holotype). (a,b) Colony on PDA (above and reverse), (c) conidiomata on PDA, (d,e) conidiogenous cells and (f–k) conidia. Scale bars = 10 μm.
Figure 10. Neopestalotiopsis yongxunensis (YX101-0708, holotype). (a,b) Colony on PDA (above and reverse), (c) conidiomata on PDA, (d,e) conidiogenous cells and (f–k) conidia. Scale bars = 10 μm.
Jof 10 00371 g010

3.4. Pathogenicity Assay

Sixteen of the twenty tested pestalotioid isolates were able to cause typical brown lesions after inoculation, while the other four isolates did not, including Neopestalotiopsis sp.4 MH133-0708, N. coffeae-arabicae NM42-0706, N. oblatespora YJ11-0708 and Neopestalotiopsis sp.3 SX11-0706. The lesion areas measured 5 days after inoculation were 54.02, 13.86, 15.57, 4.65, 11.08, 117.40, 100.63, 82.31, 8.55, 80.25, 32.03, 7.02, 104.86, 84.48, 102.04 and 16.17 mm2 for isolates of P. hydei BA11-0708, Ps. myanmarina JR34-0709, Ps. avicenniae LF48-0709, N. coffeae-arabicae BL32-0708, N. coffeae-arabicae LF51-0709, N. cubana MH51-0708, N. cubana YX112-0708, N. wuzhishanensis YX116-0708, N. yongxunensis YX101-0708, N. baotingensis SX41-0706, N. vaccinii JR31-0709, N. rosicola NM47-0706, N. oxyphylla LF55-0709, N. brachiata SX31-0706, Neopestalotiopsis sp.5 XC11-0709 and N. olivaceous LF25-0709, respectively (Figure 11). The morphology of the purified fungi re-isolated from the lesion after inoculation was identical with those of the isolates used for inoculation, which were also confirmed using PCR and gene sequences. The results of the pathogenicity and phylogenetic analysis showed that the strains close to N. cubana and N. brachiata had a stronger pathogenicity (Figure 1 and Figure 11B).

4. Discussion

In this study, 36 pestalotioid strains were isolated. According to the multi-locus phylogeny (ITS, tef-1α and tub2) and morphological characteristics analyses, one Pestalotiopsis sp, two Pseudopestalotiopsis spp., and fourteen Neopestalotiopsis spp. were identified. Six new species (N. baotingensis, N. oblatespora, N. olivaceous, N. oxyphylla, N. wuzhishanensis and N. yongxunensis) were described. Among the 36 strains, the isolation frequency of N. coffeae-arabicae and N. cubana was 16.67% for both, higher than the others; additionally, N. coffeae-arabicae, N. olivaceous and N. oxyphylla were isolated from five, three and three cities separately, with a wider distribution in Hainan than others. This is the first systematic report of Neopestalotiopsis, Pestalotiopsis and Pseudopestalotiopsis fungi relating to A. oxyphylla in its main planted area.
The development of molecular biology has greatly facilitated the identification of microorganisms, and the phylogeny analyses of combined ITS, tef-1α and tub2 can better distinguish Neopestalotiopsis, Pestalotiopsis and Pseudopestalotiopsis. For example, in this study, N. olivaceous and N. wuzhishanensis do not conform to the morphological characteristics of the versicolorous median cells depicted in Neopestalotiopsis. This phenomenon was also mentioned by Sun et al. [18], so the phylogeny analyses can overcome the discrimination of the three genera only by the intermediate cell color. While the three gene sequences of N. oxyphylla, N. aotearoa and N. brachiata are closely similar, only with 0–2 bp difference in the combined sequence, and between N. oblatespora and N. guajavicola, with 2 bp difference, they have obvious discrepancies in their morphological characteristics. A similar phenomenon was observed between N. alpapicalis MFLUCC 17-2544T and N. rhizophorae MFLUCC 17-1551T [41]. Therefore, more gene fragments need to be introduced in order to further differentiate closely related species of pestalotioid fungi.
RLB is an important disease in the cultivation process of A. oxyphylla, according to previous reports. Its pathogen was reported as Pestalotia palmarum in 1986 [11], now classified as Pestalotiopsis palmarum, while the RBS disease, with similar symptoms to RLB disease, was caused by Pestalosphaeria alpinia, the sexual morph of pestalotioid, as reported in 1994 [15]. Perhaps due to the differences in the classification method and limitations in the sample size, P. palmarum and P. alpinia were not isolated in this study, which explained the potential diversity of pestalotioid fungi in this host that need to be further explored. In addition, the symptoms of RLB and RBS disease are similar, with both caused by pestalotioid fungi with different morphs, so it is recommended to merge the two diseases into one for future research and disease management.
The pathogenicity tests of 20 pestalotioid strains showed that most species can cause obvious symptoms on the leaves, indicating the diversity of the pathogen of RLB disease, and the Neopestalotiopsis species (lesion area over 75 mm2 for 7 species) tended to infect A. oxyphylla and caused more serious disease than Pestalotiopsis (lesion area of about 50 mm2) and Pseudopestalotiopsis (less than 50 mm2 for both). The reports of the disease caused by Neopestalotiopsis fungi have been more frequent in recent years [18]. In addition, all pathogenicity tests were carried out with a single cultivar of A. oxyphylla and constant environmental conditions. As we all know, both differences in varieties and changes in the environmental conditions can affect the occurrence of diseases. Therefore, more studies need to be performed on different varieties under different environmental conditions.
What is worth noting is that most of the pestalotioid species have a broad range of hosts, and one species of pestalotioid fungi can infect several economic plants, while a plant can be harmed by several pestalotioid fungi. For example, N. cubana can infect rubber trees [96], Camellia oleifera [19] and Ixora chinensis [97], and a new leaf fall disease of rubber trees was caused by N. aotearoa, N. cubana and N. formicarum [96]. A. oxyphylla is a semi-shade plant mainly planted in rubber tree forests. In this study, six strains of N. cubana, one strain of Neopestalotiopsis sp.3 SX11-0706 clustered with N. formicarum and five strains (N. oxyphylla, N. brachiata and Neopestalotiopsis sp.5 XC11-0709) closely related to N. aotearoa were isolated. Thus, it suggests that some pestalotioid species may infect both the rubber tree and A. oxyphylla. The promotion of medicinal plant cultivation under forest trees should be carried out with attention to the occurrence of cross-infection diseases in order to prevent them.
A comprehensive understanding of the species and genetic diversity of pathogens is the foundation for sustainable disease management. Since there is no research about the resistance varieties of A. oxyphylla to RLB disease, the strains with different characteristics and pathogenicities that were isolated in this study may provide a material basis for the subsequent screening of resistant varieties, including highly active biological and chemical agents friendly to the environment.

Author Contributions

Formal analysis, X.C.; Methodology, Z.H. and Y.L. (Yingbin Li); Resources, X.C., Z.H. and J.Z.; Software, S.S.; Supervision, J.L., Y.L. (Yixiang Liu) and L.L.; Visualization, M.C.; Writing—original draft, X.C. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the Major Science and Technology Project in Yunnan Province (202102AE090042-02) and the leading fund project of the Sanya Research Institute of China Agricultural University (SYND-2022-11).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

All sequence data are available in NCBI GenBank following the accession numbers in the manuscript.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Qiu, L.Y. Investigation of Germplasm Resources of Alpinia oxyphylla Miq. in Hainan Island. Master’s Thesis, Hainan University, Hainan, China, 2015. [Google Scholar]
  2. Pharmacopoeia of the People’s Republic of China. Alpiniae oxyphyllae Fructus; The Medicine Science and Technology Press of China: Beijing, China, 2020. [Google Scholar]
  3. Zhang, Q.; Zheng, Y.L.; Hu, X.J.; Hu, X.L.; Lv, W.W.; Lv, D.; Chen, J.J.; Wu, M.L.; Song, Q.C.; Shentu, J.Z. Ethnopharmacological uses, phytochemistry, biological activities, and therapeutic applications of Alpinia oxyphylla Miguel: A review. J. Ethnopharmacol. 2018, 224, 149–168. [Google Scholar] [CrossRef] [PubMed]
  4. Zhang, J.Q.; Wang, S.; Li, Y.H.; Xu, P.; Chen, F.; Tan, Y.F.; Duan, J.A. Anti-diarrheal constituents of Alpinia oxyphylla. Fitoterapia 2013, 89, 149–156. [Google Scholar] [CrossRef] [PubMed]
  5. Zhou, J.Z.; Zhang, K.; Zhang, L.Y.; Xian, Q.Q.; Sun, P.Z.; Du, Z.Y. Geographical distribution and prediction of potential region of Alpinia oxyphylla Miq. Anhui Agric. Sci. 2018, 46, 1–3+8. [Google Scholar] [CrossRef]
  6. Wang, Y.F. Exploration of Metabolites and Related Genes of Volatile Oil from Wild Alpinia oxyphylla Miq. in Hainan Province; Central University for Nationalities: Beijing, China, 2022. [Google Scholar]
  7. Chen, L.Z.; Liufu, Y.Q.; Lin, S.C.; Xian, S.Q. Analysis of the basic biological characteristics and high yield cultivation techniques of Alpinia oxyphylla Miq. South China Agric. 2018, 12, 27+29. [Google Scholar] [CrossRef]
  8. Zhang, C.; Wu, Y.G.; Yang, H.G.; Yao, G.L.; Zhang, J.F.; Yu, J.; Yang, D.M.; Chen, P. The current planting situation and industrial development countermeasures of Alpinia oxyphylla Miq. in Hainan Province. Mod. Hortic. 2021, 44, 63–67. [Google Scholar] [CrossRef]
  9. He, H.M. Analysis of biological characteristics and environment for high production of Alpinia oxyphylla. Chin. J. Mod. Appl. Pharm. 1992, 5, 205–207. [Google Scholar]
  10. Yan, X.X.; Ren, B.L.; Wang, M.Y.; Wang, Q.L.; Yang, Q.; Tang, H.; Wang, Z.N. Present situation and development strategy of Alpinia oxyphylla. China J. Chin. Mater. Med. 2019, 44, 1960–1964. [Google Scholar] [CrossRef]
  11. Hong, X.Q.; Chen, J.J. Three important new diseases of Alpinia oxyphylla Miq. Chin. J. Trop. Agric. 1986, 3, 50–53. [Google Scholar]
  12. Xu, X.R.; Zhou, J.; Wu, X.P.; Lei, X.T. The main diseases and pests of Alpinia oxyphylla and their prevention and control. China Trop. Agric. 2012, 48, 56–58. [Google Scholar]
  13. Fu, M.Y.; Zeng, X.P.; Rui, K.; Wang, H.F.; Chen, M.C. The occurrence and control of the leaf blight disease of Alpinia oxyphylla in Hainan Island. Mod. Agric. Sci. Technol. 2015, 655, 170–171. [Google Scholar]
  14. Qi, P.K. Fungal Diseases of Cultivated Medicinal Plants in Guangdong Province; Guangdong Science and Technology Press: Guangzhou, China, 1994. [Google Scholar]
  15. Maharachchikumbura, S.S.N.; Guo, L.D.; Chukeatirote, E.; Bahkali, A.H.; Hyde, K.D. Pestalotiopsis-morphology, phylogeny, biochemistry and diversity. Fungal Divers. 2011, 50, 167–187. [Google Scholar] [CrossRef]
  16. Maharachchikumbura, S.S.N.; Guo, L.D.; Cai, L.; Chukeatirote, E.; Wu, W.P.; Sun, X.; Crous, P.W.; Bhat, D.J.; McKenzie, E.H.C.; Bahkali, A.H.; et al. A multi-locus backbone tree for Pestalotiopsis, with a polyphasic characterization of 14 new species. Fungal Divers. 2012, 56, 95–129. [Google Scholar] [CrossRef]
  17. Maharachchikumbura, S.S.N.; Hyde, K.D.; Groenewald, J.Z.; Xu, J.; Crous, P.W. Pestalotiopsis revisited. Stud. Mycol. 2014, 79, 121–186. [Google Scholar] [CrossRef] [PubMed]
  18. Sun, Y.R.; Jayawardena, R.S.; Sun, J.E.; Wang, Y. Pestalotioid species associated with medicinal plants in southwest China and Thailand. Microbiol. Spectrum 2023, 11, e0398722. [Google Scholar] [CrossRef] [PubMed]
  19. Li, L.L.; Yang, Q.; Li, H. Morphology, phylogeny, and pathogenicity of pestalotioid species on Camellia oleifera in China. J. Fungi 2021, 7, 1080. [Google Scholar] [CrossRef] [PubMed]
  20. Diogo, E.; Goncalves, C.I.; Silva, A.C.; Valente, C.; Braganca, H.; Phillips, A.J.L. Five new species of Neopestalotiopsis associated with diseased Eucalyptus spp. in Portugal. Mycol. Prog. 2021, 20, 1441–1456. [Google Scholar] [CrossRef]
  21. Lin, H.F.; Chen, T.H.; Liu, S.D. Bioactivity of antifungal substance iturin a produced by Bacillus subtilis strain BS-99-H against Pestalotiopsis eugeniae, a causal pathogen of wax apple fruit rot. Plant Pathol. Bull. 2010, 19, 225–233. [Google Scholar]
  22. Prasannath, K.; Shivas, R.G.; Galea, V.J.; Akinsanmi, O.A. Neopestalotiopsis species associated with flower diseases of Macadamia integrifolia in Australia. J. Fungi 2021, 7, 771. [Google Scholar] [CrossRef] [PubMed]
  23. Tsai, I.; Chung, C.L.; Lin, S.R.; Hung, T.H.; Shen, T.L.; Hu, C.Y.; Hozzein, W.N.; Ariyawansa, H.A. Cryptic diversity, molecular systematics, and pathogenicity of genus Pestalotiopsis and allied genera causing gray blight disease of tea in Taiwan, With a description of a new Pseudopestalotiopsis species. Plant Dis. 2021, 105, 425–443. [Google Scholar] [CrossRef]
  24. Maharachchikumbura, S.S.N.; Larignon, P.; Hyde, K.D.; Al-Sadi, A.M.; Liu, Z.Y. Characterization of Neopestalotiopsis, Pestalotiopsis and Truncatella species associated with grapevine trunk diseases in France. Phytopathol. Mediterr. 2016, 55, 380–390. [Google Scholar] [CrossRef]
  25. Ayoubi, N.; Soleimani, M.J. Strawberry fruit rot caused by Neopestalotiopsis iranensis sp nov., and N. mesopotamica. Curr. Microbiol. 2016, 72, 329–336. [Google Scholar] [CrossRef] [PubMed]
  26. Chamorro, M.; Aguado, A.; De los Santos, B. First report of root and crown rot caused by Pestalotiopsis clavispora (Neopestalotiopsis clavispora) on strawberry in Spain. Plant Dis. 2016, 100, 1495. [Google Scholar] [CrossRef]
  27. Jeewon, R.; Liew, E.C.Y.; Hyde, K.D. Phylogenetic relationships of Pestalotiopsis and allied genera inferred from ribosomal DNA sequences and morphological characters. Mol. Phylogenet. Evol. 2002, 25, 378–392. [Google Scholar] [CrossRef] [PubMed]
  28. Jeewon, R.; Liew, E.C.Y.; Simpson, J.A.; Hodgkiss, I.J.; Hyde, K.D. Phylogenetic significance of morphological characters in the taxonomy of Pestalotiopsis species. Mol. Phylogenet. Evol. 2003, 27, 372–383. [Google Scholar] [CrossRef]
  29. Gualberto, G.F.; Catarino, A.D.; Sousa, T.F.; Cruz, J.C.; Hanada, R.E.; Caniato, F.F.; Silva, G.F. Pseudopestalotiopsis gilvanii sp. nov. and Neopestalotiopsis formicarum leaves spot pathogens from guarana plant: A new threat to global tropical hosts. Phytotaxa 2021, 489, 121–139. [Google Scholar] [CrossRef]
  30. He, Y.K.; Yang, Q.; Sun, Y.R.; Zeng, X.Y.; Jayawardena, R.S.; Hyde, K.D.; Wang, Y. Additions to Neopestalotiopsis (Amphisphaeriales, Sporocadaceae) fungi: Two new species and one new host record from China. Biodivers. Data J. 2022, 10, e90709. [Google Scholar] [CrossRef] [PubMed]
  31. Li, W.L.; Dissanayake, A.J.; Zhang, T.; Maharachchikumbura, S.S.N.; Liu, J.K. Identification and pathogenicity of pestalotioid fungi associated with woody oil plants in Sichuan Province, China. J. Fungi 2022, 8, 1175. [Google Scholar] [CrossRef] [PubMed]
  32. Prematunga, C.J.; You, L.Q.; Gomdola, D.; Balasuriya, A.; Yang, Y.H.; Jayawardena, R.S.; Luo, M. An addition to pestalotioid fungi in China: Neopestalotiopsis fragariae sp. nov. causing leaf spots on Fragaria × ananassa. Asian J. Mycol. 2022, 5, 220–238. [Google Scholar] [CrossRef]
  33. Yang, Q.; He, Y.K.; Yuan, J.; Wang, Y. Two new Pseudopestalotiopsis species isolated from Celtis sinensis and Indocalamus tessellatus plants in southern China. Phytotaxa 2022, 543, 274–282. [Google Scholar] [CrossRef]
  34. Yang, Q.; Zeng, X.Y.; Yuan, J.; Zhang, Q.; He, Y.K.; Wang, Y. Two new species of Neopestalotiopsis from southern China. Biodivers. Data J. 2021, 9, e70446. [Google Scholar] [CrossRef]
  35. White, T.J. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In PCR Protocols; Academic Press, Inc.: Cambridge, MA, USA, 1990; pp. 315–322. [Google Scholar]
  36. Carbone, I.; Kohn, L.M. A method for designing primer sets for speciation studies in filamentous ascomycetes. Mycologia 1999, 91, 553–556. [Google Scholar] [CrossRef]
  37. O’Donnell, K.; Kistler, H.C.; Cigelnik, E.; Ploetz, R.C. Multiple evolutionary origins of the fungus causing Panama disease of banana: Concordant evidence from nuclear and mitochondrial gene genealogies. Proc. Natl. Acad. Sci. USA 1998, 95, 2044–2049. [Google Scholar] [CrossRef] [PubMed]
  38. Glass, N.L.; Donaldson, G.C. Development of primer sets designed for use with the PCR to amplify conserved genes from filamentous ascomycetes. Appl. Environ. Microbiol. 1995, 61, 1323–1330. [Google Scholar] [CrossRef] [PubMed]
  39. Odonnell, K.; Cigelnik, E. Two divergent intragenomic rDNA ITS2 types within a monophyletic lineage of the fungus Fusarium are nonorthologous. Mol. Phylogenet. Evol. 1997, 7, 103–116. [Google Scholar] [CrossRef] [PubMed]
  40. Vaidya, G.; Lohman, D.J.; Meier, R. SequenceMatrix: Concatenation software for the fast assembly of multi-gene datasets with character set and codon information. Cladistics 2011, 27, 171–180. [Google Scholar] [CrossRef] [PubMed]
  41. Norphanphoun, C.; Jayawardena, R.S.; Chen, Y.; Wen, T.C.; Meepol, W.; Hyde, K.D. Morphological and phylogenetic characterization of novel pestalotioid species associated with mangroves in Thailand. Mycosphere 2019, 10, 531–578. [Google Scholar] [CrossRef]
  42. Kumar, V.; Cheewangkoon, R.; Gentekaki, E.; Maharachchikumbura, S.S.N.; Brahmanage, R.S.; Hyde, K.D. Neopestalotiopsis alpapicalis sp. nov. a new endophyte from tropical mangrove trees in Krabi Province (Thailand). Phytotaxa 2019, 393, 251–262. [Google Scholar] [CrossRef]
  43. Bezerra, J.D.P.; Machado, A.R.; Firmino, A.L.; Rosado, A.W.C.; de Souza, C.A.F.; de Souza-Motta, C.M.; Freire, K.; Paiva, L.M.; Magalhaes, O.M.C.; Pereira, O.L.; et al. Mycological diversity description I. Acta Bot. Bras. 2018, 32, 656–666. [Google Scholar] [CrossRef]
  44. Jiang, N.; Fan, X.; Tian, C. Identification and characterization of leaf-inhabiting fungi from Castanea Plantations in China. J. Fungi 2021, 7, 64. [Google Scholar] [CrossRef]
  45. Liu, X.F.; Tibpromma, S.; Zhang, F.; Xu, J.C.; Chethana, K.W.T.; Karunarathna, S.C.; Mortimer, P.E. Neopestalotiopsis cavernicola sp. nov. from Gem Cave in Yunnan Province, China. Phytotaxa 2021, 512, 1–27. [Google Scholar] [CrossRef]
  46. Tibpromma, S.; Hyde, K.D.; McKenzie, E.H.C.; Bhat, D.J.; Phillips, A.J.L.; Wanasinghe, D.N.; Samarakoon, M.C.; Jayawardena, R.S.; Dissanayake, A.J.; Tennakoon, D.S.; et al. Fungal diversity notes 840–928: Micro-fungi associated with Pandanaceae. Fungal Divers. 2018, 93, 1–160. [Google Scholar] [CrossRef]
  47. Song, Y.; Geng, K.; Zhang, B.; Hyde, K.D.; Zhao, W.S.; Wei, J.G.; Kang, J.C.; Wang, Y. Two new species of Pestalotiopsis from Southern China. Phytotaxa 2013, 126, 22–30. [Google Scholar] [CrossRef]
  48. Peng, C.; Crous, P.W.; Jiang, N.; Fan, X.; Liang, Y.; Tian, C. Diversity of Sporocadaceae (pestalotioid fungi) from rosa in China. Persoonia 2022, 49, 201–260. [Google Scholar] [CrossRef] [PubMed]
  49. Ma, X.Y.; Maharachchikumbura, S.S.N.; Chen, B.W.; Hyde, K.D.; McKenzie, E.H.C.; Chomnunti, P.; Kang, J.C. Endophytic pestalotioid taxa in Dendrobium orchids. Phytotaxa 2019, 419, 268–286. [Google Scholar] [CrossRef]
  50. Crous, P.W.; Wingfield, M.J.; Le Roux, J.J.; Richardson, D.M.; Strasberg, D.; Shivas, R.G.; Alvarado, P.; Edwards, J.; Moreno, G.; Sharma, R.; et al. Fungal Planet description sheets: 371-399. Persoonia 2015, 35, 264–327. [Google Scholar] [CrossRef] [PubMed]
  51. Konta, S.; Tibpromma, S.; Karunarathna, S.C.; Samarakoon, M.C.; Steven, L.S.; Mapook, A.; Boonmee, S.; Senwanna, C.; Balasuriya, A.; Eungwanichayapant, P.D.; et al. Morphology and multigene phylogeny reveal ten novel taxa in Ascomycota from terrestrial palm substrates (Arecaceae) in Thailand. Mycosphere 2023, 14, 107–152. [Google Scholar] [CrossRef]
  52. Ul Haq, I.; Ijaz, S.; Khan, N.A. Genealogical concordance of phylogenetic species recognition-based delimitation of Neopestalotiopsis species associated with leaf spots and fruit canker disease affected guava plants. Pak. J. Agric. Sci. 2021, 58, 1301–1313. [Google Scholar] [CrossRef]
  53. Zhang, Z.; Liu, R.; Liu, S.; Mu, T.; Zhang, X.; Xia, J. Morphological and phylogenetic analyses reveal two new species of Sporocadaceae from Hainan, China. MycoKeys 2022, 88, 171–192. [Google Scholar] [CrossRef]
  54. Freitas, E.F.S.; Da Silva, M.; Barros, M.V.P.; Kasuya, M.C.M. Neopestalotiopsis hadrolaeliae sp. nov., a new endophytic species from the roots of the endangered orchid Hadrolaelia jongheana in Brazil. Phytotaxa 2019, 416, 211–220. [Google Scholar] [CrossRef]
  55. Huanaluek, N.; Jayawardena, R.S.; Maharachchikum-Bura, S.S.N.; Harishchandra, D.L. Additions to pestalotioid fungi in Thailand: Neopestalotiopsis hydeana sp. nov. and Pestalotiopsis hydei sp. nov. Phytotaxa 2021, 479, 23–43. [Google Scholar] [CrossRef]
  56. Akinsanmi, O.A.; Nisa, S.; Jeff-Ego, O.S.; Shivas, R.G.; Drenth, A. Dry flower disease of macadamia in Australia caused by Neopestalotiopsis macadamiae sp. nov. and Pestalotiopsis macadamiae sp. nov. Plant Dis. 2017, 101, 45–53. [Google Scholar] [CrossRef]
  57. Maharachchikumbura, S.S.; Guo, L.D.; Chukeatirote, E.; Hyde, K.D. Improving the backbone tree for the genus Pestalotiopsis; addition of P. steyaertii and P. magna sp. nov. Mycol. Prog. 2014, 13, 617–624. [Google Scholar] [CrossRef]
  58. Crous, P.W.; Wingfield, M.J.; Chooi, Y.H.; Gilchrist, C.L.M.; Lacey, E.; Pitt, J.I.; Roets, F.; Swart, W.J.; Cano-Lira, J.F.; Valenzuela-Lopez, N.; et al. Fungal Planet description sheets: 1042-1111. Persoonia 2020, 44, 301–459. [Google Scholar] [CrossRef]
  59. Liu, F.; Bonthond, G.; Groenewald, J.Z.; Cai, L.; Crous, P.W. Sporocadaceae, a family of coelomycetous fungi with appendage-bearing conidia. Stud. Mycol. 2019, 92, 287–415. [Google Scholar] [CrossRef]
  60. Silverio, M.L.; Calvacanti, M.A.d.Q.; Silva, G.A.d.; Oliveira, R.J.V.d.; Bezerra, J.L. A new epifoliar species of Neopestalotiopsis from Brazil. Agrotropica 2016, 28, 151–158. [Google Scholar] [CrossRef]
  61. Crous, P.W.; Summerell, B.A.; Swart, L.; Denman, S.; Taylor, J.E.; Bezuidenhout, C.M.; Palm, M.E.; Marincowitz, S.; Groenewald, J.Z. Fungal pathogens of Proteaceae. Persoonia 2011, 27, 20–45. [Google Scholar] [CrossRef]
  62. Chaiwan, N.; Jeewon, R.; Pem, D.; Jayawardena, R.S.; Nazurally, N.; Mapook, A.; Promputtha, I.; Hyde, K.D. Fungal species from Rhododendron sp.: Discosia rhododendricola sp. nov, Neopestalotiopsis rhododendricola sp. nov. and Diaporthe nobilis as a new host record. J. Fungi 2022, 8, 907. [Google Scholar] [CrossRef]
  63. Ariyawansa, H.A.; Hyde, K.D. Additions to Pestalotiopsis in Taiwan. Mycosphere 2018, 9, 999–1013. [Google Scholar] [CrossRef]
  64. Santos, J.; Hilario, S.; Pinto, G.; Alves, A. Diversity and pathogenicity of pestalotioid fungi associated with blueberry plants in Portugal, with description of three novel species of Neopestalotiopsis. Eur. J. Plant Pathol. 2022, 162, 539–555. [Google Scholar] [CrossRef]
  65. Fiorenza, A.; Gusella, G.; Aiello, D.; Polizzi, G.; Voglmayr, H. Neopestalotiopsis siciliana sp. nov. and N. rosae causing stem lesion and dieback on avocado plants in Italy. J. Fungi 2022, 8, 562. [Google Scholar] [CrossRef]
  66. Jayawardena, R.S.; Liu, M.; Maharachchikumbura, S.S.N.; Zhang, W.; Xing, Q.; Hyde, K.D.; Nilthong, S.; Li, X.; Yan, J. Neopestalotiopsis vitis sp. nov. causing grapevine leaf spot in China. Phytotaxa 2016, 258, 63–74. [Google Scholar] [CrossRef]
  67. Liu, X.F.; Tibpromma, S.; Hughes, A.C.; Chethana, K.W.T.; Wijayawardene, N.N.; Dai, D.Q.; Du, T.Y.; Elgorban, A.M.; Stephenson, S.L.; Suwannarach, N.; et al. Culturable mycota on bats in central and southern Yunnan Province, China. Mycosphere 2023, 14, 497–662. [Google Scholar] [CrossRef]
  68. Liu, F.; Hou, L.w.; Raza, M.; Cai, L. Pestalotiopsis and allied genera from Camellia, with description of 11 new species from China. Sci. Rep. 2017, 7, 866. [Google Scholar] [CrossRef]
  69. Gu, R.; Bao, D.F.; Shen, H.W.; Su, X.J.; Li, Y.X.; Luo, Z.L. Endophytic Pestalotiopsis species associated with Rhododendron in Cangshan Mountain, Yunnan Province, China. Front. Microbiol. 2022, 13, 1016782. [Google Scholar] [CrossRef]
  70. Crous, P.W.; Boers, J.; Holdom, D.; Osieck, E.R.; Steinrucken, T.V.; Tan, Y.P.; Vitelli, J.S.; Shivas, R.G.; Barrett, M.; Boxshall, A.G.; et al. Fungal Planet description sheets: 1383–1435. Persoonia 2022, 48, 261–371. [Google Scholar] [CrossRef]
  71. Ariyawansa, H.A.; Hyde, K.D.; Jayasiri, S.C.; Buyck, B.; Chethana, K.W.T.; Dai, D.Q.; Dai, Y.C.; Daranagama, D.A.; Jayawardena, R.S.; Lucking, R.; et al. Fungal diversity notes 111-252-taxonomic and phylogenetic contributions to fungal taxa. Fungal Divers. 2015, 75, 27–274. [Google Scholar] [CrossRef]
  72. Chaiwan, N.; Wanasinghe, D.N.; Mapook, A.; Jayawardena, R.S.; Norphanphoun, C.; Hyde, K.D. Novel species of Pestalotiopsis fungi on Dracaena from Thailand. Mycology 2020, 11, 306–315. [Google Scholar] [CrossRef]
  73. Liu, J.K.; Hyde, K.D.; Jones, E.B.G.; Ariyawansa, H.A.; Bhat, D.J.; Boonmee, S.; Maharachchikumbura, S.S.N.; McKenzie, E.H.C.; Phookamsak, R.; Phukhamsakda, C.; et al. Fungal diversity notes 1–110: Taxonomic and phylogenetic contributions to fungal species. Fungal Divers. 2015, 72, 1–197. [Google Scholar] [CrossRef]
  74. Silva, N.; Maharachchikumbura, S.; Thambugala, K.; Bhat, D.J.; Hyde, K.D. Morpho-molecular taxonomic studies reveal a high number of endophytic fungi from Magnolia candolli and M. garrettii in China and Thailand. Mycosphere 2021, 12, 163–237. [Google Scholar] [CrossRef]
  75. Yan, M.Z.; Maharachchikumbura, S.; Tian, Q.; Hyde, K.D. Pestalotiopsis species on ornamental plants in Yunnan Province, China. Sydowia 2013, 65, 113–128. [Google Scholar]
  76. Maharachchikumbura, S.S.N.; Chukeatirote, E.; Guo, L.D.; Crous, P.W.; Mckenzie, E.H.C.; Hyde, K.D. Pestalotiopsis species associated with Camellia sinensis (tea). Mycotaxon 2013, 123, 47–61. [Google Scholar] [CrossRef]
  77. Monteiro, P.; Gonçalves, M.F.M.; Pinto, G.; Silva, B.; Martín-García, J.; Diez, J.J.; Alves, A. Three novel species of fungi associated with pine species showing needle blight-like disease symptoms. Eur. J. Plant Pathol. 2022, 162, 183–202. [Google Scholar] [CrossRef]
  78. Hyde, K.D.; Jeewon, R.; Chen, Y.-J.; Bhunjun, C.S.; Calabon, M.S.; Jiang, H.-B.; Lin, C.-G.; Norphanphoun, C.; Sysouphanthong, P.; Pem, D.; et al. The numbers of fungi: Is the descriptive curve flattening? Fungal Divers. 2020, 103, 219–271. [Google Scholar] [CrossRef]
  79. Das, K.; Lee, S.Y.; Jung, H.Y. Pestalotiopsis kaki sp. nov., a novel species isolated from persimmon tree (Diospyros kaki) Bark in Korea. Mycobiology 2020, 49, 54–60. [Google Scholar] [CrossRef] [PubMed]
  80. Chen, Y.Y.; Maharachchikumbura, S.S.N.; Liu, J.K.; Hyde, K.D.; Nanayakkara, R.R.; Zhu, G.S.; Liu, Z.Y. Fungi from Asian Karst formations I. Pestalotiopsis photinicola sp nov., causing leaf spots of Photinia serrulata. Mycosphere 2017, 8, 103–110. [Google Scholar] [CrossRef]
  81. Harishchandra, D.L.; Aluthmuhandiram, J.V.S.; Yan, J.; Hyde, K.D. Molecular and morpho-cultural characterisation of Neopestalotiopsis and Pestalotiopsis species associated with ornamental and forest plants in China. Lett. Appl. Microbiol. 2020, 7, 352–362. [Google Scholar]
  82. Zhang, Y.; Maharachchikumbura, S.S.N.; McKenzie, E.H.C.; Hyde, K.D. A novel species of Pestalotiopsis causing leaf spots of Trachycarpus fortunei. Cryptogam. Mycol. 2012, 33, 311–318. [Google Scholar] [CrossRef]
  83. Wei, J.G.; Phan, C.K.; Wang, L.; Xu, T.; Luo, J.T.; Sun, X.; Guo, L.D. Pestalotiopsis yunnanensis sp. nov., an endophyte from Podocarpus macrophyllus (Podocarpaceae) based on morphology and ITS sequence data. Mycol. Prog. 2013, 12, 563–568. [Google Scholar] [CrossRef]
  84. Maharachchikumbura, S.S.N.; Guo, L.D.; Liu, Z.Y.; Hyde, K.D. Pseudopestalotiopsis ignota and Ps. camelliae spp. nov associated with grey blight disease of tea in China. Mycol. Prog. 2016, 15, 22. [Google Scholar] [CrossRef]
  85. Catarino, A.d.M.; Hanada, R.E.; de Queiroz, C.A.; Sousa, T.F.; Lima, Í.N.; Gasparotto, L.; da Silva, G.F. First report of Pseudopestalotiopsis dawaina causing spots in Caryota mitis in Brazil. Plant Dis. 2020, 104, 989. [Google Scholar] [CrossRef]
  86. Nozawa, S.; Ando, K.; Phay, N.; Watanabe, K. Pseudopestalotiopsis dawaina sp. nov. and Ps. kawthaungina sp. nov.: Two new species from Myanmar. Mycol. Prog. 2018, 17, 865–870. [Google Scholar] [CrossRef]
  87. Tsai, I.; Maharachchikumbura, S.S.N.; Hyde, K.D.; Ariyawansa, H.A. Molecular phylogeny, morphology and pathogenicity of Pseudopestalotiopsis species on Ixora in Taiwan. Mycol. Prog. 2018, 17, 941–952. [Google Scholar] [CrossRef]
  88. Lateef, A.A.; Sepiah, M.; Bolhassan, M.H. Description of Pseudopestalotiopsis kubahensis sp. nov., a new species of microfungi from Kubah National Park, Sarawak, Malaysia. Curr. Res. Environ. Appl. Mycol. 2015, 5, 376–381. [Google Scholar] [CrossRef]
  89. Nozawa, S.; Yamaguchi, K.; Yen, L.T.H.; Hop, D.V.; Phay, N.; Ando, K.; Watanabe, K. Identification of two new species and a sexual morph from the genus Pseudopestalotiopsis. Mycoscience 2017, 58, 328–337. [Google Scholar] [CrossRef]
  90. Song, Y.; Tangthirasunun, N.; Maharachchikumbura, S.S.N.; Jiang, Y.L.; Xu, J.J.; Hyde, K.D.; Wang, Y. Novel Pestalotiopsis species from Thailand point to the rich undiscovered diversity of this chemically creative genus. Cryptogam. Mycol. 2014, 35, 139–149. [Google Scholar] [CrossRef]
  91. Miller, M.A.; Pfeiffer, W.T.; Schwartz, T. Creating the CIPRES science gateway for inference of large phylogenetic trees. In Proceedings of the Gateway Computing Environments Workshop (GCE), New Orleans, LA, USA, 14 November 2010; pp. 1–8. [Google Scholar] [CrossRef]
  92. Ronquist, F.; Huelsenbeck, J.P. MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 2003, 19, 1572–1574. [Google Scholar] [CrossRef]
  93. Quaedvlieg, W.; Binder, M.; Groenewald, J.Z.; Summerell, B.A.; Carnegie, A.J.; Burgess, T.I.; Crous, P.W. Introducing the consolidated species concept to resolve species in the Teratosphaeriaceae. Persoonia 2014, 33, 1–40. [Google Scholar] [CrossRef] [PubMed]
  94. Bruen, T.C.; Philippe, H.; Bryant, D. A simple and robust statistical test for detecting the presence of recombination. Genetics 2006, 172, 2665–2681. [Google Scholar] [CrossRef] [PubMed]
  95. Huson, D.H.; Bryant, D. Application of phylogenetic networks in evolutionary studies. Mol. Biol. Evol. 2006, 23, 254–267. [Google Scholar] [CrossRef]
  96. Pornsuriya, C.; Chairin, T.; Thaochan, N.; Sunpapao, A. Identification and characterization of Neopestalotiopsis fungi associated with a novel leaf fall disease of rubber trees (Hevea brasiliensis) in Thailand. J. Phytopathol. 2020, 168, 416–427. [Google Scholar] [CrossRef]
  97. Khoo, Y.W.; Tan, H.T.; Khaw, Y.S.; Li, S.F.; Chong, K.P. First report of Neopestalotiopsis cubana causing leaf blight on Ixora chinensis in Malaysia. Plant Dis. 2022, 106, 2749. [Google Scholar] [CrossRef]
Jof 10 00371 g001
Figure 1. RAxML tree of Neopestalotiopsis isolates based on ITS, tef-1α and tub2 sequences. The roots of this tree are Pestalotiopsis diversiseta MFLUCC 12-0287 and P. colombiensis CBS 118553. The strains isolated in this study are marked in red. Ex-type strains are marked with T. ML bootstrap values ≥ 50% and BI probabilities (in red) ≥ 0.90 are displayed at the nodes.
Figure 1. RAxML tree of Neopestalotiopsis isolates based on ITS, tef-1α and tub2 sequences. The roots of this tree are Pestalotiopsis diversiseta MFLUCC 12-0287 and P. colombiensis CBS 118553. The strains isolated in this study are marked in red. Ex-type strains are marked with T. ML bootstrap values ≥ 50% and BI probabilities (in red) ≥ 0.90 are displayed at the nodes.
Jof 10 00371 g001
Jof 10 00371 g002
Figure 2. RAxML tree of Pestalotiopsis isolates based on ITS, tef-1α and tub2 sequences. The root of this tree is N. cubana CBS 600.9. The strains isolated in this study are marked in red. Ex-type strains are marked with T. ML bootstrap values ≥ 50% and BI probabilities (in red) ≥ 0.90 are displayed at the nodes.
Figure 2. RAxML tree of Pestalotiopsis isolates based on ITS, tef-1α and tub2 sequences. The root of this tree is N. cubana CBS 600.9. The strains isolated in this study are marked in red. Ex-type strains are marked with T. ML bootstrap values ≥ 50% and BI probabilities (in red) ≥ 0.90 are displayed at the nodes.
Jof 10 00371 g002
Jof 10 00371 g003
Figure 3. RAxML tree of Pseudopestalotiopsis isolates based on ITS, tef-1α and tub2 sequences. The root of this tree is P. trachycaroicola OP068. The strains isolated in this study are marked in red. Ex-type strains are marked with T. ML bootstrap values ≥ 50% and BI probabilities (in red) ≥ 0.90 are displayed at the nodes.
Figure 3. RAxML tree of Pseudopestalotiopsis isolates based on ITS, tef-1α and tub2 sequences. The root of this tree is P. trachycaroicola OP068. The strains isolated in this study are marked in red. Ex-type strains are marked with T. ML bootstrap values ≥ 50% and BI probabilities (in red) ≥ 0.90 are displayed at the nodes.
Jof 10 00371 g003
Jof 10 00371 g004
Figure 4. Split graphs showing the results of the PHI test of new (a) N. baotingensis SX41-0706, N. oblatespora YJ11-0708, (b) N. olivaceous LF25-0709, and (c) N. yongxunensis YX101-0708 and N. wuzhishanensis YX116-0708 with their most closely related species. The new species in each graph is shown in red font. Ex-type strains are marked with “T”.
Figure 4. Split graphs showing the results of the PHI test of new (a) N. baotingensis SX41-0706, N. oblatespora YJ11-0708, (b) N. olivaceous LF25-0709, and (c) N. yongxunensis YX101-0708 and N. wuzhishanensis YX116-0708 with their most closely related species. The new species in each graph is shown in red font. Ex-type strains are marked with “T”.
Jof 10 00371 g004
Jof 10 00371 g011
Figure 11. Pathogenicity test results of 20 pestalotioid species on Alpinia oxyphylla leaves. (A) Symptoms on leaves after 5 days. Icons in figures, in sequence, are CK, P. hydei BA11-0708, Ps. myanmarina JR34-0709, Ps. avicenniae LF48-0709, N. coffeae-arabicae BL32-0708, N. coffeae-arabicae LF51-0709, Neopestalotiopsis sp.4 MH133-0708, N. coffeae-arabicae NM42-0706, N. cubana MH51-0708, N. cubana YX112-0708, N. wuzhishanensis YX116-0708, N. yongxunensis YX101-0708, N. baotingensis SX41-0706, N. oblatespora YJ11-0708, N. vaccinii JR31-0709, N. rosicola NM47-0708, N. oxyphylla LF55-0709, N. brachiata SX31-0706, Neopestalotiopsis sp.5 XC11-0709, N. olivaceous LF25-0709 and Neopestalotiopsis sp.3 SX11-0706. (B) Pathogenicity of the isolates was evaluated by measuring the area of the necrotic lesions after 5 days. Error bars indicate the standard deviation of the mean. Significant differences (p < 0.05) are indicated with different letters according to Duncan’s multiple range test. The abscissa designation corresponds sequentially to (A), excluding “CK”.
Figure 11. Pathogenicity test results of 20 pestalotioid species on Alpinia oxyphylla leaves. (A) Symptoms on leaves after 5 days. Icons in figures, in sequence, are CK, P. hydei BA11-0708, Ps. myanmarina JR34-0709, Ps. avicenniae LF48-0709, N. coffeae-arabicae BL32-0708, N. coffeae-arabicae LF51-0709, Neopestalotiopsis sp.4 MH133-0708, N. coffeae-arabicae NM42-0706, N. cubana MH51-0708, N. cubana YX112-0708, N. wuzhishanensis YX116-0708, N. yongxunensis YX101-0708, N. baotingensis SX41-0706, N. oblatespora YJ11-0708, N. vaccinii JR31-0709, N. rosicola NM47-0708, N. oxyphylla LF55-0709, N. brachiata SX31-0706, Neopestalotiopsis sp.5 XC11-0709, N. olivaceous LF25-0709 and Neopestalotiopsis sp.3 SX11-0706. (B) Pathogenicity of the isolates was evaluated by measuring the area of the necrotic lesions after 5 days. Error bars indicate the standard deviation of the mean. Significant differences (p < 0.05) are indicated with different letters according to Duncan’s multiple range test. The abscissa designation corresponds sequentially to (A), excluding “CK”.
Jof 10 00371 g011
Table 1. PCR primers and procedures used in this study.
Table 1. PCR primers and procedures used in this study.
LocusPrimes NameSequence (5′ to 3′)PCR ProceduresReference
ITSITS5GGAAGTAAAAGTCGTAACAAGG95 °C for 5 min; 94 °C for 25 s; 52 °C for 25 s; 72 °C for 10 s; repeat 2 to 4 for 35 cycles; 72 °C for 5 min; 4 °C on hold[35]
ITS4TCCTCCGCTTATTGATATGC
tef-1αEF1-728FCATCGAGAAGTTCGAGAAGG95 °C for 5 min; 94 °C for 25 s; 52 °C for 25 s; 72 °C for 10 s (15 s); repeat 2 to 4 for 35 cycles; 72 °C for 5 min; 4 °C on hold[36,37]
EF1-526FGTCGTYGTYATYGGHCAYGT
EF2GGARGTACCAGTSATCATGTT
tub2T1AACATGCGTGAGATTGTAAGT95 °C for 5 min; 94 °C for 25 s; 55 °C for 25 s; 72 °C for 15 s; repeat 2 to 4 for 35 cycles; 72 °C for 5 min; 4 °C on hold[38,39]
Bt2bACCCTCAGTGTAGTGACCCTTGGC
Table 2. The strain information and gene accession numbers for pestalotioid species used in this study.
Table 2. The strain information and gene accession numbers for pestalotioid species used in this study.
Taxonomic StatusStrain No.Host/SubstrateOriginGenBank Accession NumbersReferences
ITStub 2tef-lα
Neopestalotiopsis acrostichiMFLUCC 17-1754TAcrostichum aureumThailandMK764272MK764338MK764316[41]
N. acrostichiMFLUCC 17-1755Acrostichum aureumThailandMK764273MK764339MK764317[41]
N. alpapicalisMFLUCC 17-2544TRhizophora mucronataThailandMK357772MK463545MK463547[42]
N. alpapicalisMFLUCC 17-2545Rhizophora mucronataThailandMK357773MK463546MK463548[42]
N. amomiHKAS 124563TAmomum villosumChinaOP498012OP752133OP653489[18]
N. amomiHKAS 124564Amomum villosumChinaOP498013OP765913OP753382[18]
N. aotearoaCBS 367.54TCanvasNew ZealandKM199369KM199454KM199526[17]
N. asiaticaMFLUCC 12-0286TPrunus dulcisChinaJX398983JX399018JX399049[17]
N. australisCBS 114159TTelopea sp.AustraliaKM199348KM199432KM199537[17]
N. baotingensisSX41-0706TAlpinia oxyphyllaChinaPP621751PP767811PP767847In this study
N. baotingensisYJ34-0708Alpinia oxyphyllaChinaPP621765PP767815PP767851In this study
N. brachiataMFLUCC 17-1555Rhizophora apiculataThailandMK764274MK764340MK764318[41]
N. brachiataSX31-0706Alpinia oxyphyllaChinaPP621749PP767809PP767845In this study
N. brasiliensisCOAD 2166TPsidium guajavaBrazilMG686469MG692400MG692402[43]
N. brasiliensisCFCC 54341Castanea mollissimaChinaMW166229MW218522MW199748[44]
N. camelliae-oleiferaeCSUFTCC81TCamellia oleiferaChinaOK493585OK562360OK507955[19]
N. camelliae-oleiferaeCSUFTCC82Camellia oleiferaChinaOK493586OK562361OK507956[19]
N. cavernicolaKUMCC 20-0269TCaveChinaMW545802MW557596MW550735[45]
N. chiangmaiensisMFLUCC 18–0113Pandanus sp.ThailandNAMH412725MH388404[46]
N. chryseaMFLUCC 12-0261TDead leavesChinaJX398985JX399020JX399051[16]
N. chryseaMFLUCC 12-0262Dead leavesChinaJX398986JX399021JX399052[16]
N. clavisporaMFLUCC 12-0281TMagnolia sp.ChinaJX398979JX399014JX399045[16]
N. clavisporaMFLUCC 12-0280Magnolia sp.ChinaJX398978JX399013JX399044[16]
N. cocoesMFLUCC 15-0152TCocos nuciferaThailandKX789687NAKX789689[41]
N. coffeae-arabicaeHGUP4015Coffea arabicaChinaKF412647KF412641KF412644[47]
N. coffeae-arabicaeHGUP4019TCoffea arabicaChinaKF412649KF412643KF412646[47]
N. coffeae-arabicaeBL32-0708Alpinia oxyphyllaChinaPP621754PP767790PP767826In this study
N. coffeae-arabicaeJR23-0709Alpinia oxyphyllaChinaPP621735PP767791PP767827In this study
N. coffeae-arabicaeLF26-0709Alpinia oxyphyllaChinaPP621742PP767797PP767833In this study
N. coffeae-arabicaeLF33-0709Alpinia oxyphyllaChinaPP621743PP767798PP767834In this study
N. coffeae-arabicaeLF51-0709Alpinia oxyphyllaChinaPP621745PP767799PP767835In this study
N. coffeae-arabicaeNM42-0706Alpinia oxyphyllaChinaPP621767PP767804PP767840In this study
N. concentricaCFCC 55162TRosa chinensisChinaOK560707OM117698OM622433[48]
N. cubanaCBS 600.96TLeaf litterCubaKM199347KM199438KM199521[17]
N. cubanaMH51-0708Alpinia oxyphyllaChinaPP621752PP767802PP767838In this study
N. cubanaNM48-0706Alpinia oxyphyllaChinaPP621770PP767807PP767843In this study
N. cubanaYJ33-0708Alpinia oxyphyllaChinaPP621764PP767814PP767850In this study
N. cubanaYX112-0708Alpinia oxyphyllaChinaPP621761PP767817PP767853In this study
N. cubanaYX41-0708Alpinia oxyphyllaChinaPP621757PP767819PP767855In this study
N. cubanaYX44-0708Alpinia oxyphyllaChinaPP621758PP767820PP767856In this study
N. dendrobiiMFLUCC 14-0106TDendrobium cariniferumThailandMK993571MK975835MK975829[49]
N. dendrobiiMFLUCC 14-0099Dendrobium cariniferumThailandMK993570MK975834MK975828[49]
N. drenthiiBRIP 72263aMacadamia integrifoliaAustraliaMZ303786MZ312679MZ344171[22]
N. drenthiiBRIP 72264aTMacadamia integrifoliaAustraliaMZ303787MZ312680MZ344172[22]
N. egyptiacaCBS 140162TMangifera indicaEgyptKP943747KP943746KP943748[50]
N. elaeagniHGUP10002TElaeagnus pungensChinaMW930716MZ683391MZ203452[30]
N. elaeidisMFLUCC 15-0735Elaeis guineensisThailandON650689NAON734012[51]
N. ellipsosporaMFLUCC 12-0283TDead plantChinaJX398980JX399016JX399047[16]
N. eucalyptorumCBS 147684TEucalyptus globulusPortugalMW794108MW802841MW805397[20]
N. eucalypticolaCBS 264.37TEucalyptus globulusNAKM199376KM199431KM199551[17]
N. fragariaeZHKUCC 22-0115Fragaria x ananassaChinaON651146ON685199ON685197[32]
N. foedansCGMCC 3.9123TMangrove plantChinaJX398987JX399022JX399053[16]
N. foedansCGMCC 3.9178Neodypsis decaryiChinaJX398989JX399024JX399055[16]
N. formicarumCBS 362.72TDead antCubaKM199358KM199455KM199517[17]
N. formicarumCBS 115.83Plant debrisCubaKM199344KM199444KM199519[17]
N. guajavaeFMBCC 11.1TPsidium guajavaPakistanMF783085MH460871MH460868[52]
N. guajavicolaFMBCC 11.4TPsidium guajavaPakistanMH209245MH460873MH460870[52]
N. haikouensisSAUCC212271TIlexchinensis sp.ChinaOK087294OK104870OK104877[53]
N. hadrolaeliaeCOAD 2637THadrolaelia jongheanaBrazilMK454709MK465120MK465122[54]
N. hispanicaCBS 147686TEucalyptus globulusPortugalMW794107MW802840MW805399[20]
N. honoluluanaCBS 114495TTelopea sp.USAKM199364KM199457KM199548[17]
N. hydeanaMFLUCC 20-0132TArtocarpus heterophyllusThailandMW266069MW251119MW251129[55]
N. hypericiHKAS 124561Hypericum monogynumChinaOP498010OP765908OP713768[18]
N. ibericaCBS 147688TEucalyptus globulusPortugalMW794111MW802844MW805402[20]
N. javaensisCBS 257.31TCocos nuciferaIndonesiaKM199357KM199437KM199543[17]
N. lusitanicaCBS 147690TEucalyptus globulusPortugalMW794110MW802843MW805406[20]
N. longiappendiculataCBS 147692TEucalyptus globulusPortugalMW794112MW802845MW805404[20]
N. macadamiaeBRIP 63737cTMacadamia integrifoliaAustraliaKX186604KX186654KX186627[56]
N. macadamiaeBRIP 63742aMacadamia integrifoliaAustraliaKX186599KX186657KX186629[56]
N. maddoxiiBRIP 72266aTMacadamia integrifoliaAustraliaMZ303782MZ312675MZ344167[22]
N. magnaMFLUCC 12-0652TPteridium sp.FranceKF582795KF582793KF582791[57]
N. mesopotamicaCBS 336.86TPinus brutiaIraqKM199362KM199441KM199555[17]
N. mesopotamicaCBS 299.74Eucalyptus sp.TurkeyKM199361KM199435KM199541[17]
N. mianyangensisHKAS 123211Paeonia suffruticosaChinaOP546681OP672161OP723490[31]
N. musaeMFLUCC 15-0776TMusa sp.ThailandKX789683KX789686KX789685[41]
N. natalensisCBS 138.41TAcacia mollissimaSouth AfricaKM199377KM199466KM199552[17]
N. nebuloidesBRIP 66617TSporobolus elongatusAustraliaMK966338MK977632MK977633[58]
N. oblatesporaYJ11-0708TAlpinia oxyphyllaChinaPP621763PP767813PP767849In this study
N. olivaceousLF25-0709TAlpinia oxyphyllaChinaPP621741PP767796PP767832In this study
N. olivaceousSX33-0706Alpinia oxyphyllaChinaPP621750PP767810PP767846In this study
N. olivaceousYX45-0708Alpinia oxyphyllaChinaPP621759PP767821PP767857In this study
N. olumideaeBRIP 72273aTMacadamia integrifoliaAustraliaMZ303790MZ312683MZ344175[22]
N. oxyphyllaLF55-0709TAlpinia oxyphyllaChinaPP621746PP767800PP767836In this study
N. oxyphyllaMJ31-0708Alpinia oxyphyllaChinaPP621766PP767803PP767839In this study
N. oxyphyllaNM44-0706Alpinia oxyphyllaChinaPP621768PP767805PP767841In this study
N. paeonieaCBS 318.74Anacardium occidentaleNigeriaMH554031MH554707NA[59]
N. paeonia-suffruticosaHKAS 123212TPaeonia suffruticosaChinaOP082292OP235980OP204794[31]
N. pernambucanaURM 7148-01TVismia guianensisBrazilKJ792466NAKU306739[60]
N. perukaeFMBCC11.3TGuavaPakistanMH209077MH460876MH523647[52]
N. petilaMFLUCC 17-1737Rhizophora mucronataThailandMK764275MK764341MK764319[41]
N. petilaMFLUCC 17-1738TRhizophora mucronataThailandMK764276MK764342MK764320[41]
N. phangngaensisMFLUCC 18-0119TPandanus sp.ThailandMH388354MH412721MH388390[46]
N. piceanaCBS 254.32Cocos nuciferaIndonesiaKM199372KM199452KM199529[17]
N. piceanaCBS 394.48TPicea sp.The UKKM199368KM199453KM199527[17]
N. photiniaeMFLUCC 22-0129TPhotinia serratifoliaChinaOP498008OP752131OP753368[18]
N. protearumCBS 114178TLeucospermum cuneiformeZimbabweJN712498KM199463LT853201[61]
N. psidiiFMBCC 11.2TPsidium guajavaPakistanMF783082MH477870MH460874[52]
N. rhapidisGUCC 21501TRhododendron simsiiChinaMW931620MW980441MW980442[34]
N. rhizophoraeMFLUCC 17-1551TRhizophora mucronataThailandMK764277MK764343MK764321[41]
N. rhizophoraeMFLUCC 17 1550Rhizophora mucronataThailandMK764278MK764344MK764322[41]
N. rhododendriGUCC 21504TRhododendron simsiiChinaMW979577MW980443MW980444[34]
N. rhododendricolaKUN-HKAS-123204TRhododendron sp.ChinaOK283069OK274147OK274148[62]
N. rosaeCBS 101057TRosa sp.New ZealandKM199359KM199429KM199523[17]
N. rosicolaCFCC 51992TRosa chinensisChinaKY885239KY885245KY885243[63]
N. rosicolaCFCC 51993Rosa chinensisChinaKY885240KY885246KY885244[63]
N. rosicolaNM47-0706Alpinia oxyphyllaChinaPP621769PP767806PP767842In this study
N. samarangensisCBS 115451Unidentified treeChinaKM199365KM199447KM199556[17]
N. saprophyticaMFLUCC 12-0282TMagnolia sp.ChinaJX398982JX399017JX399048[17]
N. scalabiensisCAA 1029TVaccinium corymbosumPortugalMW969748MW934611MW959100[64]
N. sichuanensisCFCC 54338TCastanea mollissimaChinaMW166231MW218524MW199750[44]
N. sicilianaAC46Persea americanaItalyON117813ON209162ON107273[65]
N. sonnerataeMFLUCC 17-1744Sonneronata albaThailandMK764279MK764345MK764323[41]
N. sonnerataeMFLUCC 17-1745TSonneronata albaThailandMK764280MK764346MK764324[41]
N. steyaertiiIMI 192475TEucalyptus viminalisAustraliaKF582796KF582794KF582792[17]
N. surinamensisCBS 450.74TSoil under Elaeis guineensisSurinameKM199351KM199465KM199518[17]
N. subepidermalisCFCC 55160Rosa chinensisChinaOK560699OM117690OM622425[48]
N. suphanburiensisMFLUCC 22-0126TUnknownThailandOP497994OP752135OP753372[18]
N. terricolaHKAS 123213Paeonia suffruticosaChinaOP082294OP235982OP204796[31]
N. thailandicaMFLUCC 17-1730TRhizophora mucronataThailandMK764281MK764347MK764325[41]
N. thailandicaMFLUCC 17-1731Rhizophora mucronataThailandMK764282MK764348MK764326[41]
N. umbrinosporaMFLUCC 12-0285TUnidentified plantChinaJX398984JX399019JX399050[16]
N. vacciniiCAA 1059TVaccinium corymbosumPortugalMW969747MW934610MW959099[64]
N. vacciniiJR31-0709Alpinia oxyphyllaChinaPP621736PP767792PP767828In this study
N. vacciniiJR41-0709Alpinia oxyphyllaChinaPP621738PP767793PP767829In this study
N. vacciniiJR44-0709Alpinia oxyphyllaChinaPP621739PP767794PP767830In this study
N. vacciniiJR51-0709Alpinia oxyphyllaChinaPP621740PP767795PP767831In this study
N. vacciniicolaCAA 1055TVaccinium corymbosumPortugalMW969751MW934614MW959103[64]
N. vheenaeBRIP 72293aTMacadamia integrifoliaAustraliaMZ303792MZ312685MZ344177[22]
N. vitisMFLUCC 15-1265TVitis vinifera cv. “Summer black”ChinaKU140694KU140685KU140676[66]
N. vitisMFLUCC 15-1270Vitis vinifera cv. “Kyoho”ChinaKU140699KU140690KU140681[66]
N. wuzhishanensisYX116-0708TAlpinia oxyphyllaChinaPP621762PP767818PP767854In this study
N. xishuangbannaensisKUMCC 21-0424TKerivoula hardwickii (bat)ChinaON426865OR025934OR025973[67]
N. xishuangbannaensisKUMCC 21-0425Kerivoula hardwickii (bat)ChinaON426866 OR025935OR025974[67]
N. yongxunensisYX101-0708TAlpinia oxyphyllaChinaPP621760PP767816PP767852In this study
N. zakeeliiBRIP 72282aTMacadamia integrifoliaAustraliaMZ303789MZ312682MZ344174[22]
N. zimbabwanaCBS 111495TLeucospermum cunciformeZimbabweNAKM199456KM199545[17]
N. zingiberisGUCC 21001TZingiber officinaleChinaMW930715MZ683390MZ683389[30]
Neopestalotiopsis sp.2CFCC 54340Castanea mollissimaChinaMW166235MW218528MW199754[44]
Neopestalotiopsis sp.2ZX22BCastanea mollissimaChinaMW166236MW218529MW199755[44]
Neopestalotiopsis sp. nov.GUCC 210003UnknownChinaMW930717MZ683392MZ540914[34]
Neopestalotiopsis sp.1CFCC 54337Castanea mollissimaChinaMW166233MW218526MW199752[44]
Neopestalotiopsis sp.1ZX121Castanea mollissimaChinaMW166234MW218527MW199753[44]
Neopestalotiopsis sp.3SX11-0706Alpinia oxyphyllaChinaPP621748PP767808PP767844In this study
Neopestalotiopsis sp.4MH133-0708Alpinia oxyphyllaChinaPP621753PP767801PP767837In this study
Neopestalotiopsis sp.5XC11-0709Alpinia oxyphyllaChinaPP621747PP767812PP767848In this study
Pestalotiopsis adustaICMP 6088TRefrigerator doorFijiJX399006JX399037JX399070[16]
P. adustaMFLUCC 10-0146Syzygium sp.ThailandJX399007JX399038JX399071[16]
P. aggestorumLC6301TCamellia sinensisChinaKX895015KX895348KX895234[68]
P. appendiculataCGMCC 3.23550TRhododendron sp.ChinaOP082431OP185516OP185509[69]
P. australasiaeCBS 114126TKnightia sp.New ZealandKM199297KM199409KM199499[17]
P. australasiaeCBS 11141Protea sp.New South WalesKM199298KM199410KM199501[17]
P. australisCBS 114193TGrevillea sp.New South WalesKM199332KM199383KM199475[17]
P. biciliataCBS 124463TPlatanus × hispanicaSlovakiaKM199308KM199399KM199505[17]
P. brachiataLC2988TCamellia sp.ChinaKX894933KX895265KX895150[68]
P. brassicaeCBS 170.26TBrassica napusNew ZealandKM199379NAKM199558[17]
P. camelliaeMFLUCC 12-0277TCamellia japonicaChinaJX399010JX399041JX399074[16]
P. camelliae-oleiferaeCSUFTCC08TCamellia oleiferaChinaOK493593OK562368OK507963[19]
P. chamaeropisCBS 186.71TChamaerops humilisItalyKM199326KM199391KM199473[17]
P. chiangmaiensisMFLUCC 22-0127TPhyllostachys edulisThailandOP497990OP752137OP753374[18]
P. chiaroscuroBRIP 72970Sporobolus natalensisAustraliaOK422510OK423752OK423753[70]
P. clavataMFLUCC 12-0268TBuxus sp.ChinaJX398990JX399025JX399056[16]
P. colombiensisCBS 118553TEucalyptus eurograndisColombiaKM199307KM199421KM199488[17]
P. daliensisCGMCC 3.23548TRhododendron sp.ChinaOP082429OP185518OP185511[69]
P. diploclisiaeCBS 115587TDiploclisia glaucescensChinaKM199320KM199419KM199486[17]
P. diversisetaMFLUCC 12-0287TRhododendron sp.ChinaNR 120187JX399040JX399073[16]
P. dracaenaeHGUP4037TDracaena fragransChinaNAMT598645MT598644[71]
P. dracaenicolaMFLUCC 18-0913TDracaena sp.ThailandMN962731MN962733MN962732[72]
P. dracontomelonMFUCC 10-0149TDracontomelon daoThailandKP781877NAKP781880[73]
P. endophyticaMFLUCC 18-0932Endophytic on healthy leaves of Magnolia candollThailandNR 172439NAMW417119[74]
P. ericacearumIFRDCC 2439TRhododendron delavayiChinaKC537807KC537821KC537814[75]
P. etonensisBRI P 66615Sporobolus jacquemontiiAustraliaMK966339MK977634MK977635[58]
P. formosanaNTUCC 17-009TDead grassChinaMH809381MH809385MH809389[63]
P. furcataMFLUCC 12-0054TCamellia sinensisThailandJQ683724JQ683708JQ683740[76]
P. fusoideaCGMCC 3.23545TEndophytic in fresh Rhododendron delavayi leavesChinaOP082427OP185519OP185512[69]
P. grevilleaeCBS 114127TGrevillea sp.AustraliaKM199300KM199407KM199504[17]
P. hawaiiensisCBS 114491TLeucospermum sp.HawaiiKM199339KM199428KM199514[17]
P. hispanicaCBS 115391TProtea ‘Susara’SpainMH553981MH554640MH554399[59]
P. hydeiMFLUCC 20-0135TLitsea PetiolataThailandMW266063MW251112MW251113[55]
P. hydeiGUCC 21-0816Dead twigsChinaOP753660OP765909OP753383[18]
P. hydeiBA11-0708Alpinia oxyphyllaChinaPP621755PP767822PP767858In this study
P. hydeiBA42-0708Alpinia oxyphyllaChinaPP621756PP767823PP767859In this study
P. hollandicaCBS 265.33TSciadopitys verticillataThe NetherlandsKM199328KM199388KM199481[17]
P. humusCBS 336.97TSoilPapua New GuineaKM199317KM199420KM199484[17]
P. hunanensisCSUFTCC15TCamellia oleiferaChinaOK493599OK562374OK507969[19]
P. ibericaCAA1006TPinus radiataSpainMW732249MW759036MW759039[77]
P. inflexaMFLUCC 12-0270TUnidentified treeChinaJX399008JX399039JX399072[16]
P. intermediaMFLUCC 12-0259TUnidentified treeChinaJX398993JX399028JX399059[16]
P. jiangxiensisLC4399TEurya sp.ChinaKX895009KX895341KX895227[68]
P. jinchanghensisLC6636TCamellia sinensisChinaKX895028KX895361KX895247[68]
P. kandelicolaNCYU 19-0355TKandelia candelChinaMT560722MT563099MT563101[78]
P. kakiKNU-PT-1804TDiospyros kakiKoreaLC552953LC552954LC553555[79]
P. kenyanaCBS 442.67TCoffea sp.KenyaKM199302KM199395KM199502[17]
P. kenyanaCBS 911.96Raw material from agar–agarNAKM199303KM199396KM199503[17]
P. knightiaeCBS 114138TKnightia sp.New ZealandKM199310KM199408KM199497[17]
P. knightiaeCBS 111963Knightia sp.New ZealandKM199311KM199406KM199495[17]
P. linearisMFLUCC 12-0271Trachelospermum sp.ChinaJX398992JX399027JX399058[16]
P. loeianaMFLUCC 22-0123Dead leavesThailandOP497988OP713769OP737881[18]
P. lushanensisLC4344TCamellia sp.ChinaKX895005KX895337KX895223[68]
P. macadamiaeBRIP 63738BTMacadamia integrifoliaAustraliaKX186588KX186680KX186621[56]
P. malayanaCBS 102220TMacaranga trilobaMalaysiaKM199306KM199411KM199482[17]
P. monochaetaCBS 144.97TQuercus roburThe NetherlandsKM199327KM199386KM199479[17]
P. jesteriMFLUCC 12-0279TFagraea bodeniiChinaJX399012JX399043JX399076[16]
P. nanjingensisCSUFTCC16TCamellia oleiferaChinaOK493602OK562377OK507972[19]
P. nanningensisCSUFTCC10TCamellia oleiferaChinaOK493596OK562371OK507966[19]
P. neolitseaeNTUCC 17-011TNeolitsea villosaChina, TaiwanMH809383MH809387MH809391[63]
P. oryzaeCBS 353.69TOryza sativaDenmarkKM199299KM199398KM199496[17]
P. papuanaCBS 331.96TCoastal soilPapua New GuineaKM199321KM199413KM199491[17]
P. photinicolaGZCC 16-0028TPhotinia serrulataChinaKY092404KY047663KY047662[80]
P. rhizophoraeMFLUCC 17-0416TRhizophora apiculataThailandMK764283MK764349MK764327[41]
P. rhodomyrtusHGUP4230TRhodomyrtus tomentosaChinaKF412648KF412642KF412645[47]
P. rosarioidesCGMCC 3.23549TRhododendron decorumChinaOP082430OP185520OP185513[69]
P. roseaMFLUCC 12-0258TPinus sp.ChinaJX399005JX399036JX399069[16]
P. scopariaCBS176.25TChamaecyparis sp.NAKM199330KM199393KM199478[17]
P. shandogensisJZB340038TUnknownChinaMN625275MN626729MN626740[81]
P. smilacicolaMFLUCC 22-0125TSmilax sp.ThailandOP497991OP762673OP753376[18]
P. suaeCGMCC 3.23546TRhododendron delavayiChinaOP082428OP185521OP185514[69]
P. telopeaeCBS 114161TTelopea sp.AustraliaKM199296KM199403KM199500[17]
P. telopeaeCBS 114137Protea sp.AustraliaKM199301KM199469KM199559[17]
P. thailandicaMFLUCC 17-1616TRhizophora apiculataThailandMK764285MK764351MK764329[41]
P. trachycarpicolaOP068TTrachycarpus fortuneiChinaJQ845947JQ845945JQ845946[82]
P. unicolorMFLUCC 12-0276TRhododendron sp.ChinaJX398999JX399030NA[16]
P. verruculosaMFLUCC 12-0274TRhododendron sp.ChinaJX398996NAJX399061[16]
P. yanglingensisLC4553TCamellia sinensisChinaKX895012KX895345KX895231[83]
Pseudopestalotiopsis ampullaceaLC6618TCamellia sinensisChinaKX895025KX895358KX895244[68]
Ps. annellataNTUCC 17-030TCamellia sinensisChina, TaiwanMT322087MT321889MT321988[23]
Ps. avicenniaeMFLUCC 17-0434TAvicennia marinaThailandMK764287MK764353MK764331[41]
Ps. avicenniaeLF48-0709Alpinia oxyphyllaChinaPP621744PP767825PP767861In this study
Ps. camelliaeCGMCC 3.9192Camellia sinensisChinaNAKU562851KU562850[84]
Ps. camelliae-sinensisNTUCC 18-031Camellia sinensisChina, TaiwanMT322047MT321849MT321948[23]
Ps. camelliae-sinensisLC3490TCamellia sinensisChinaKX894985KX895316KX895202[68]
Ps. chinensisNTUCC 18-066Camellia sinensisChina, TaiwanMT322083MT321885MT321984[23]
Ps. chinensisLC3011TCamellia sinensisChinaKX894937KX895269KX895154[68]
Ps. chinensisNTUCC 18-038Camellia sinensisChina, TaiwanMT322055MT321857MT321956[23]
Ps. cocosCBS 272.29TCocos nuciferaJavaMH855069KM199467KM199553[17]
Ps. celtidisGUCC 21599TCeltis sinensisChinaOL423535OL439010OL439012[33]
Ps. curvatisporaMFLUCC 17-1723Rhizophora mucronataThailandMK764290MK764356MK764334[41]
Ps. curvatisporaMFLUCC 17-1722TRhizophora mucronataThailandMK764289MK764355MK764333[41]
Ps. dawainaINPA 2912Caryota mitisBrazilMN096659MN151310MN151308[85]
Ps. dawainaMM14-F0015TUnknownDawei, MyanmarLC324750LC324751LC324752[86]
Ps. gilvaniiINPA 2913TPaullinia cupanaBrazilMN385951MN385954MN385957[29]
Ps. hydeaeNTUCC 17-003.1Diospyros sp.China, TaiwanMG816313MG816323MG816333[87]
Ps. ignotaNN 42909TCamellia sinensisChinaKU500020NAKU500016[84]
Ps. indicaCBS 459.78THibiscus rosa-sinensisIndiaKM199381KM199470KM199560[17]
Ps. indocalamiGUCC 21600TIndocalamus tessellatusChinaOL423536OL439011OL439013[33]
Ps. ixoraeNTUCC 17-001.1TLxora sp.NAMG816316MG816326MG816336[87]
Ps. kawthaunginaMM14F0083TUnknownKawthaung, MyanmarLC324753LC324754LC324755[86]
Ps. kubahensisUMAS-KUB-P20TMacaranga sp.Sarawak, MalaysiaMG818971NANA[88]
Ps. myanmarinaNBRC 112264TAverrhoa carambolaDawei, MyanmarLC114025LC114045LC114065[89]
Ps. myanmarinaJR34-0709Alpinia oxyphyllaChinaPP621737PP767824PP767860In this study
Ps. rhizophoraeMFLUCC 17-1560TRhizophora apiculataThailandMK764291MK764357MK764335[41]
Ps. simitheaeKUMCC 17-0255Magnolia candolliChinaMW244023MW602387MW273930[74]
Ps. simitheaeMFLUCC12-0121TPandanus odoratissimusThailandKJ503812KJ503815KJ503818[90]
Ps. solicolaCBS 386.97TSoil in tropical forestPapua New GuineaMH554039MH554715MH554474[59]
Ps. taiwanensisNTUCC 17-002.1TIxora sp.China, TaiwanMG816319MG816329MG816339[87]
Ps. thailandicaMFLUCC 17-1724TRhizophora mucronataThailandMK764292MK764358MK764336[41]
Ps. thailandicaMFLUCC 17-1725Rhizophora mucronataThailandMK764293MK764359MK764337[41]
Ps. theaeMFLUCC 12-0055TCamellia sinensisThailandJQ683727JQ683711JQ683743[16]
Ps. vietnamensisNBRC 112252Fragaria sp.Hue, VietnamLC114034LC114054LC114074[89]
Ex-type strains are labeled with T. NA: not available. The strains in this study are indicated in bold font.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Cui, X.; Hao, Z.; Chen, M.; Song, S.; Zhang, J.; Li, Y.; Li, J.; Liu, Y.; Luo, L. Identification and Pathogenicity of Pestalotioid Species on Alpinia oxyphylla in Hainan Province, China. J. Fungi 2024, 10, 371. https://doi.org/10.3390/jof10060371

AMA Style

Cui X, Hao Z, Chen M, Song S, Zhang J, Li Y, Li J, Liu Y, Luo L. Identification and Pathogenicity of Pestalotioid Species on Alpinia oxyphylla in Hainan Province, China. Journal of Fungi. 2024; 10(6):371. https://doi.org/10.3390/jof10060371

Chicago/Turabian Style

Cui, Xiufen, Zhigang Hao, Menghuai Chen, Shuang Song, Jinan Zhang, Yingbin Li, Jianqiang Li, Yixiang Liu, and Laixin Luo. 2024. "Identification and Pathogenicity of Pestalotioid Species on Alpinia oxyphylla in Hainan Province, China" Journal of Fungi 10, no. 6: 371. https://doi.org/10.3390/jof10060371

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop