Colletotrichum Species Associated with Apple Bitter Rot and Glomerella Leaf Spot: A Comprehensive Overview
Abstract
1. Introduction
2. History of Occurrence Apple Bitter Rot and Glomerella Leaf Spot
3. History of Taxonomy Colletotrichum Species Causing Apple Bitter Rot and Glomerella Leaf Spot
4. Symptoms of Apple Bitter Rot
5. Symptoms of Apple Glomerella Leaf Spot
6. Geographical Distribution
7. Economic Importance
8. Colletotrichum Species Causing Apple Bitter Rot
9. Colletotrichum Species Causing Glomerella Leaf Spot in Apple
10. Disease Cycle
11. Epidemiology
12. Molecular Characterization
13. Control
13.1. Sanitation
13.2. Cultural Practices
13.3. Biological Control
13.4. Chemical Control
13.5. Resistant Varieties
13.6. Apple Fruit Protection in Storage
14. Conclusions
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Freeman, S.; Katan, T.; Shabi, E. Characterization of Colletotrichum species responsible for anthracnose diseases of various fruits. Plant Dis. 1998, 82, 596–605. [Google Scholar] [CrossRef] [PubMed]
- Cannon, P.F.; Damm, U.; Johnston, P.R.; Weir, B.S. Colletotrichum: Current status and future directions. Stud. Mycol. 2012, 73, 181–213. [Google Scholar] [CrossRef] [PubMed]
- Damm, U.; Cannon, P.F.; Woudenberg, J.H.C.; Crous, P.W. The Colletotrichum acutatum species complex. Stud. Mycol. 2012, 73, 37–113. [Google Scholar] [CrossRef] [PubMed]
- Aćimović, S.G.; Martin, P.L.; Khodadadi, F.; Peter, K.A. One Disease Many Causes: The key Colletotrichum species causing apple bitter rot in New York, Pennsylvania and Virginia, their distribution, habitats and management options. Fruit Q. Winter 2020, 28, 12–21. [Google Scholar]
- Khodadadi, F.; González, J.B.; Martin, P.L.; Giroux, E.; Bilodeau, G.J.; Peter, K.A.; Doyle, V.P.; Aćimović, S.G. Identification and characterization of Colletotrichum species causing apple bitter rot in New York and description of C. noveboracense sp. nov. Sci. Rep. 2020, 10, 11043. [Google Scholar]
- Khodadadi, F.; Giroux, E.; Bilodeau, G.J.; Jurick, W.M.; Aćimović, S.G. Genomic resources of four Colletotrichum species (C. fioriniae, C. chrysophilum, C. noveboracense and C. nupharicola) threatening commercial apple production in the Eastern United States. Mol. Plant-Microbe Interact. 2023, 36, 529–532. [Google Scholar] [CrossRef]
- Chen, Y.; Fu, D.; Wang, W.; Gleason, M.L.; Zhang, R.; Liang, X.; Sun, G. Diversity of Colletotrichum species causing apple bitter rot and Glomerella leaf spot in China. J. Fungi 2022, 8, 740. [Google Scholar] [CrossRef]
- Peres, N.A.; Kuramae, E.E.; Dias, M.S.; De Souza, N.L. Identification and characterization of Colletotrichum spp. affecting fruit after harvest in Brazil. J. Phytopathol. 2002, 150, 128–134. [Google Scholar] [CrossRef]
- Damm, U.; Cannon, P.F.; Woudenberg, J.H.C.; Johnston, P.R.; Weir, B.S.; Tan, Y.P.; Shivas, R.G.; Crous, P.W. The Colletotrichum boninense species complex. Stud. Mycol. 2012, 73, 1–3. [Google Scholar] [CrossRef]
- Weir, B.S.; Johnston, P.R.; Damm, U. The Colletotrichum gloeosporioides species complex. Stud. Mycol. 2012, 73, 115–180. [Google Scholar] [CrossRef]
- Peres, N.A.; Timmer, L.W.; Adaskaveg, J.E.; Correll, J.C. Lifestyles of Colletotrichum acutatum. Plant Dis. 2005, 89, 784–796. [Google Scholar] [CrossRef] [PubMed]
- Trkulja, V. Patogene, Morfološke i Odgajivačke Odlike Colletotrichum spp. Prouzrokovača Gorke Truleži Ploda Jabuke. Ph.D. Dissertation, Agricultural Faculty, Belgrade-Zemun, Serbia, 2004. (In Serbian). [Google Scholar]
- Sutton, T.B. Bitter Rot. In Compendium of Apple and Pear Diseases and Pests, 2nd ed.; Sutton, T.B., Aldwinckle, H.S., Agnello, A.M., Walgenbach, J.F., Eds.; APS Press, The American Phytopathological Society: St. Paul, MN, USA, 2014; pp. 20–21. [Google Scholar]
- Walker, J.C. Plant Pathology; McGraw-Hill Book Company, Inc.: New York, NY, USA; Toronto, ON, Canada; London, UK, 1950. [Google Scholar]
- Berkeley, M.J.; Curtis, M.A. Notices of North American Fungi. Gloeosporium versicolor B. & C. Grevillea 1874, 3, 13. [Google Scholar]
- von Schrenk, H.; Spaulding, P. The bitter rot of apples. USDA Bur. Plant Ind. Bull. 1903, 44, 1–54. [Google Scholar]
- Anderson, H.W. Apple bitter rot. In Disease of Fruit Crops; McGraw-Hill Book Company: New York, NY, USA, 1956; pp. 64–72. [Google Scholar]
- Murray, C.H. Bitter rot. Trans. Illin. Hortic. Soc. 1870, 4, 346. [Google Scholar]
- Galloway, B.T. Bitter Rot of the Apple. In Report of the U. S. Department of Agriculture; U.S. Department of Agriculture: Washington, DC, USA, 1887; pp. 348–350. [Google Scholar]
- Galloway, B.T. Bitter Rot of the Apple. In Report U.S. Department of Agriculture; U.S. Department of Agriculture: Washington, DC, USA, 1889; pp. 412–413. [Google Scholar]
- Garman, H. Gleosporium versicolor. Bull. Ky. Agric. Exp. Stn. 1893, 44, 3–31. [Google Scholar]
- Burrill, T.J.; Blair, J.C. Bitter Rot of Apples. Bull. Ill. Agric. Exp. Stn. 1902, 77, 351–366. [Google Scholar]
- Alwood, W.B. Ripe rot or bitter rot of apples. Bull. Va. Agric. Exp. Stn. 1894, 40, 59–82. [Google Scholar]
- Galloway, B.T. Ripe Rot of Grapes and Apples. Gleosporium fructigenum Berk. In Report U. S. Department of Agriculture; U.S. Department of Agriculture: Washington, DC, USA, 1890; p. 408. [Google Scholar]
- Southworth, E.A. Ripe Rot of Grapes and Apples. J. Mycol. 1891, 6, 164–173. [Google Scholar] [CrossRef]
- Leite, R.P.; Tsuneta, M.; Kishino, A.Y. Ocorrência de mancha foliar de Glomerella em macieira no Estado do Paraná. Fundação Institito Agronômico do Paraná. Inf. Pesqui. Fundação Institito Agronômico Paraná 1988, 81, 6. [Google Scholar]
- Berkeley, M.J. Septoria rufomaculans. In Gardeners’ Chronicle; The Gardeners’ Chronicle Ltd.: London, UK, 1854; p. 676. [Google Scholar]
- Berkeley, M.J. Ascochyta rufomaculans. In Outlines of British Fungology; L. Reeve: London, UK, 1860; p. 320. [Google Scholar]
- Burrill, T.J. Bitter rot of apples: Botanical investigations. Bull. Agric. Exp. Stn. Univ. Ill. Urbana-Champaign 1907, 118, 555–608. [Google Scholar]
- Von Thümen, F. Gleosporium rufomaculans (Berk.). In Fungi Pomicoli; Braumüller: Vienna, Austria-Hungary, 1879; p. 59. [Google Scholar]
- Berkeley, M.J. Gleosporium fructigenum. In Gardeners’ Chronicle; The Gardeners’ Chronicle Ltd.: London, UK, 1856; p. 245. [Google Scholar]
- Berkeley, M.J. Gleosporium leaticolor. In Gardeners’ Chronicle; The Gardeners’ Chronicle Ltd.: London, UK, 1859; p. 604. [Google Scholar]
- Curtis, M.A. Gleosporium versicolor. In Botany: Containing a Catalogue of the Indigenous and Naturalized Plants of the State; North Carolina Geological and Natural History Survey: Raleigh, NC, USA, 1867; p. 126. [Google Scholar]
- Halsted, B.D. Apple bitter rot or ripe rot. In Report New Jersey Agricultural Experiment Station; New Jersey Agricultural Experiment Station: New Brunswick, NJ, USA, 1892; p. 338. [Google Scholar]
- von Arx, J.A. Die Arlen der Gattung Colletotrichum Corda. Phytopathol. Zeitschrijt 1957, 29, 413–468. [Google Scholar]
- von Arx, J.A. Revision der zu Gloeosporium gestellten Pilze. Proc. Koninklyke Ned. Akad. Van Wet. Ser. C 1957, 51, 1–153. [Google Scholar]
- Clinton, G.P. Bitter Rot. Bull. Agric. Exp. Stn. Univ. Ill. Urbana-Champaign 1902, 69, 193–211. [Google Scholar]
- Stoneman, B. Gnomoniopsis n. gen. Botanical Gazette 1898, 26, 114. [Google Scholar]
- Atkinson, G.F. A new anthracnose of the privet. Bulletin From the Cornell University Agricultural Experiment Station; Cornell University: Ithaca, NY, USA, 1892; Volume 5, pp. 306–314. [Google Scholar]
- Stoneman, B. A comparative study of the development of some anthracnoses. Bot. Gaz. 1898, 26, 69–120. [Google Scholar] [CrossRef]
- Berlese, A.N. Gnomoniopsis n. gen. Icones Fungorum 1893, 1, 93. [Google Scholar]
- von Schrenk, H.; Spaulding, P. The bitter rot fungus. Science 1903, 147, 750–751. [Google Scholar] [CrossRef]
- Müller, H.J. Beitrage zur kenntnis von Gloeosporium fructigenum Berk. und Gloeosporium musarum Cke. et Mass. Phytopathol. Z. 1962, 44, 381–412. [Google Scholar] [CrossRef]
- Sneh, B.; Corke, A.T.K. Factors affecting the sporulation of Gloeosporium perennans and Gloeosporium fructigenum in vitro. Ann. Appl. Biol. 1979, 91, 319–323. [Google Scholar] [CrossRef]
- Vojvodić, Đ.; Vrabl, S. Bolesti i Štetočine Jabuke i Kruške; Nolit: Belgrade, Serbia, 1984; 145p. (In Serbian) [Google Scholar]
- Desmazieres, J.B.H.J.; Montagne, J.C.F. Quaterzieme notice sur les plantes cryptogames recemment decouvertes en France. Ann. Sci. Nat. 1849, 3, 295. [Google Scholar]
- Schaffnit, E.; Bohning, K. Die Brennfleckenkrankheit der Bohnen, eine monographische Studie auf biologischer Grundlage. Zentralblatt Für Bakteriol. Parasitenkd. Und Infekt. 1925, 263, 176–254. [Google Scholar]
- Frost, R.R. Seta formation in Colletotrichum. Nature 1964, 201, 730–731. [Google Scholar] [CrossRef]
- Baxter, A.P.; Westhuizen, G.C.A.; van der Eicker, A. A review of literature on the taxonomy, morphology and biology of the fungal genus Colletotrichum. Phytophylactica 1985, 17, 15–18. [Google Scholar]
- Von Arx, J.A. A revision of the fungi classified as Gloeosporium. In Bibliotheca Mycologia Band 24; J. Cramer: Lehre, Germany, 1970; 203p. [Google Scholar]
- Sutton, B.C.; Waterson, J.M. Colletotrichum musae. In CMI Descriptions of Pathogenic Fungi and Bacteria, No. 222; Commonwealth Mycological Institute: Kew, UK, 1970. [Google Scholar]
- Sutton, B.C. The genus Glomerella and its anamorph Colletotrichum. In Colletotrichum: Biology, Pathology and Contro; Bailey, J.A., Jeger, M.J., Eds.; CAB Internacional: Wallingford, UK, 1992; pp. 1–26. [Google Scholar]
- Sutton, B.C. Colletotrichum dematium (Pres. ex Fries) Grove and C. trichellum (Fr. ex Fr.) Duke. Trans. Brit. Mycol. Soc. 1962, 45, 222–232. [Google Scholar]
- Sutton, B.C. The Coelomycetes—Fungi Imperfecti with Pycnidia, Acervuli and Stromata; Commonwealth Mycological Institute: Kew, Surrey, UK, 1980. [Google Scholar]
- von Arx, J.A. The Genera of Fungi Sporulating in Pure Culture, 3rd ed.; J. Cramer: Vaduz, Liechtenstein, 1981; 424p. [Google Scholar]
- Hyde, K.D.; Cai, L.; Cannon, P.F.; Crouch, J.A.; Crous, P.W.; Damm, U.; Goodwin, P.H.; Chen, H.; Johnston, P.R.; Jones, E.B.G.; et al. Colletotrichum—Names in current use. Fungal Divers. 2009, 39, 147–182. [Google Scholar]
- Jayawardena, R.S.; Hyde, K.D.; Damm, U.; Cai, L.; Liu, M.; Li, X.H.; Zhang, W.; Zhao, W.S.; Yan, J.Y. Notes on currently accepted species of Colletotrichum. Mycosphere 2016, 7, 1192–1260. [Google Scholar] [CrossRef]
- Jayawardena, R.S.; Bhunjun, C.S.; Hyde, K.D.; Gentekaki, E.; Itthayakorn, P. Colletotrichum: Lifestyles, biology, morpho-species, species complexes and accepted species. Mycosphere 2021, 12, 519–669. [Google Scholar] [CrossRef]
- Wingfield, M.J.; De Beer, Z.W.; Slippers, B.; Wingfield, B.D.; Groenewald, J.Z.; Lombard, L.; Crous, A.W. One fungus, one name promotes progressive plant pathology. Mol. Plant Pathol. 2012, 13, 604–613. [Google Scholar] [CrossRef]
- Hibbett, D.S.; Taylor, J.W. Fungal systematics: Is a new age of enlightenment at hand? Nat. Rev. Microbiol. 2013, 11, 129–132. [Google Scholar] [CrossRef]
- Crous, P.W.; Hawksworth, D.L.; Wingfield, M.J. Identifying and naming plant-pathogenic fungi: Past, present, and future. Annu. Rev. Phytopathol. 2015, 53, 247–267. [Google Scholar] [CrossRef]
- Gams, W. Recent Changes in Fungal Nomenclature and Their Impact on Naming of Microfungi. In Biology of Microfungi; Li, D.W., Ed.; Springer International Publishing AD: Cham, Switzerland, 2016; pp. 7–23. [Google Scholar]
- Cai, L.; Weir, B.S. International Subcommission on Colletotrichum Taxonomy. In Inaugural General Meeting Minutes; Beijing, China, 9 August 2012. [Google Scholar]
- Zhang, N.; Rossman, A.Y.; Seifert, K.; Bennett, J.W.; Cai, G.; Cai, L.; Hillman, B.; Luo, J.; Manamgoda, D.; Meyer, W.; et al. Impacts of the International Code of Nomenclature for Algae, Fungi, and Plants (Melbourne Code) on the Scientific Names of Plant Pathogenic Fungi; APS FEATURE, The American Phytopathological Society: St. Paul, MN, USA, 2013; Available online: https://www.apsnet.org/edcenter/apsnetfeatures/Pages/Melbourne.aspx (accessed on 17 May 2024).
- Taylor, J. A necrotic leaf blotch and fruit rot of apple caused by a strain of Glomerella cingulata. Phytopathology 1971, 61, e224. [Google Scholar] [CrossRef]
- Sutton, T.B.; Sanhueza, R.M. Necrotic leaf blotch of Golden Delicious—Glomerella leaf spot: A resolution of common names. Plant Dis. 1998, 82, 267–268. [Google Scholar] [CrossRef] [PubMed][Green Version]
- González, E.; Sutton, T.B. First report of Glomerella leaf spot (Glomerella cingulata) of apple in the United States. Plant Dis. 1999, 83, 1074. [Google Scholar] [CrossRef] [PubMed]
- González, E.; Sutton, T.B.; Correll, J.C. Clarification of the etiology of Glomerella leaf spot and bitter rot of apple caused by Colletotrichum spp. based on morphology and genetic, molecular, and pathogenicity tests. Phytopathology 2006, 96, 982–992. [Google Scholar] [CrossRef] [PubMed]
- González, E. Characterization of Isolates of Glomerella cingulata Causal Agent of Glomerella Leaf Spot and Bitter Rot of Apples Based on Morphology and Genetic, Molecular, and Pathogenicity Tests. Ph.D. Dissertation, North Carolina State University, Raleigh, NC, USA, 2003; pp. 1–121. [Google Scholar]
- Velho, A.C.; Stadnik, M.J.; Casanova, L.; Mondino, P.; Alaniz, S. First report of Colletotrichum karstii causing Glomerella leaf spot on apple in Santa Catarina State, Brazil. Plant Dis. 2014, 98, 157. [Google Scholar] [CrossRef]
- Velho, A.C.; Alaniz, S.; Casanova, L.; Mondino, P.; Stadnik, M.J. New insights into the characterization of Colletotrichum species associated with apple diseases in southern Brazil and Uruguay. Fungal Biol. 2015, 119, 229–244. [Google Scholar] [CrossRef]
- Velho, A.C.; Stadnik, M.J.; Wallhead, M. Unraveling Colletotrichum species associated with Glomerella leaf spot of apple. Trop. Plant Pathol. 2019, 44, 197–204. [Google Scholar] [CrossRef]
- Wang, W.; Fu, D.D.; Zhang, R.; Sun, G.Y. Etiology of apple leaf spot caused by Colletotrichum spp. Mycosystema 2015, 34, 13–25. [Google Scholar]
- Wang, N.; Xu, J.; Zhao, X.; Wang, M.; Zhang, J. First report of Glomerella leaf spot of apple caused by Colletotrichum asianum. Plant Dis. 2020, 104, 2734. [Google Scholar] [CrossRef]
- Stadnik, M.J.; Velho, A.C.; Rockenbach, M.F.; Alaniz, S.; Mondino, P. Genetic and pathogenic diversity of Colletotrichum species associated with apple diseases in southern Brazil and Uruguay. In Proceedings of the I International Apple Symposium, Yangling, China, 10–16 October 2016; pp. 71–76. [Google Scholar]
- Moreira, R.R.; Peres, N.A.; Mio, L.L.M.D. Colletotrichum acutatum and C. gloeosporioides species complexes associated with apple in Brazil. Plant Dis. 2019, 103, 268–275. [Google Scholar] [CrossRef]
- Trkulja, V. Vrste roda Colletotrichum prouzrokovači gorke truleži ploda jabuke i mogućnosti njihovog suzbijanja. Biljni Lekar 2000, 5, 354–362. (In Serbian) [Google Scholar]
- Trkulja, V. Bolesti uskladištenog voća i faktori koji utiču na njihovu pojavu. Biljni Lekar 2004, 3–4, 255–266. (In Serbian) [Google Scholar]
- Bompeix, G.; Julio, E.V.R.; Phillips, D.H. Glomerella cingulata (Stoneman) Spaulding & v. Schrenk. In European Handbook of Plant Diseases; Smith, I.M., Dunez, J., Lelliott, R.A., Phillips, D.H., Archer, S.A., Eds.; Blackwell Scientific Publications: Oxford, UK, 1988; pp. 325–327. [Google Scholar]
- Ivanović, M.; Ivanović, D. Mikoze i Pseudomikoze Biljaka; P.P. De-eM-Ve: Belgrade, Serbia, 2001. (In Serbian) [Google Scholar]
- Trkulja, V.; Bagi, F. Patogeni uskladištenih plodova jabuke. Biljni Lekar 2022, 6, 462–492. (In Serbian) [Google Scholar] [CrossRef]
- Trkulja, V. Uticaj nekih faktora prije i poslije berbe voća na pojavu bolesti plodova u skladištima. In Zbornik Rezimea XII Simpozijuma o Zaštiti Bilja i Savetovanja o Primeni Pesticida; The Plant Protection Society of Serbia: Zlatibor, Serbia, 25–29 November 2002; pp. 36–37. (In Serbian) [Google Scholar]
- Trkulja, V. Pojava Colletotrichum gloeosporioides prouzrokovača gorke truleži plodova jabuke u voćnjacima u okolini Banja Luke. In Zbornik Rezimea Naučno-Stručnog Savjetovanja Agronoma Republike Srpske; Faculty of Agriculture, Banja Luka: Teslić, Republic of Srpska, Bosnia and Herzegovina, 13–17 March 2000; pp. 141–142. (In Serbian) [Google Scholar]
- Trkulja, V. Uzroci masovne pojave truleži plodova jabuke u skladištima privatnih proizvođača u okoloni Gradiške krajem 2000. godine. In Zbornik Rezimea Naučno-Stručnog Savjetovanja Agronoma Republike Srpske; Faculty of Agriculture, Banja Luka: Teslić, Republic of Srpska, Bosnia and Herzegovina, 17–19 March 2001; pp. 137–138. (In Serbian) [Google Scholar]
- Shane, W.W.; Sutton, T.B. Germination, appressorium formation, and infection of immature and mature apple fruit by Glomerella cingulata. Phytopathology 1981, 71, 454–457. [Google Scholar] [CrossRef]
- Araújo, L.; Stadnik, M.J. Cultivar-specific and ulvan-induced resistance of apple plants to Glomerella leaf spot are associated with enhanced activity of peroxidases. Acta Sci. Agron. 2013, 35, 287–293. [Google Scholar] [CrossRef]
- Carvalho, F.M.; Júnior, R.P.; Ueno, B. Pathogenic characterization of Colletotrichum spp. associated with apple diseases in Southern Brazil. Fitopatol. Bras. 2000, 25, 72–78. [Google Scholar]
- Casanova, L.; Hernández, L.; Martínez, E.; Velho, A.C.; Rockenbach, M.F.; Stadnik, M.J.; Alaniz, S.; Mondino, P. First report of Glomerella leaf spot of apple caused by Colletotrichum fructicola in Uruguay. Plant Dis. 2017, 101, 834. [Google Scholar] [CrossRef]
- Wang, C.X.; Zhang, Z.F.; Li, B.H.; Wang, H.Y.; Dong, X.L. First report of Glomerella leaf spot of apple caused by Glomerella cingulata in China. Plant Dis. 2012, 96, 912. [Google Scholar] [CrossRef]
- Børve, J.; Stensvand, A. Colletotrichum acutatum on apple in Norway. IOBC-WPRS Bull. 2015, 110, 151–157. [Google Scholar]
- Rockenbach, M.F.; Velho, A.C.; Gonçalves, A.E.; Mondino, P.E.; Alaniz, S.M.; Stadnik, M.J. Genetic structure of Colletotrichum fructicola associated to apple bitter rot and Glomerella leaf spot in southern Brazil and Uruguay. Phytopathology 2016, 106, 774–781. [Google Scholar] [CrossRef]
- Liu, W.; Liang, X.; Gleason, M.L.; Cao, M.; Zhang, R.; Sun, G. Transcription factor CfSte12 of Colletotrichum fructicola is a key regulator of early apple Glomerella leaf spot pathogenesis. Appl. Environ. Microbiol. 2020, 87, e02212-20. [Google Scholar] [CrossRef] [PubMed]
- Baum-Tchoumakova, M.E. Bitter rot of apples caused by Glomerella cingulata. Morbi Plant. 1930, 19, 55–69. [Google Scholar]
- Arsenijević, M.; Jančurić, J.; Trkulja, V.; Gavrilović, V. Mikoflora uskladištenih plodova jabuke. In Uvodni Referati i Abstrakti Desetog Kongresa Voćara Jugoslavije; Jugoslovensko Naučno Voćarsko Društvo: Čačak, Serbia, 28 October–1 November; 1996; p. 217. (In Serbian) [Google Scholar]
- Grahovac, M.; Inđić, D.; Vuković, S.; Hrustć, J.; Gvozdenac, S.; Mihajlović, M.; Tanović, B. Morphological and ecological features as differentiation criteria for Colletotrichum species. Zemdirb. Agric. 2012, 99, 189–196. [Google Scholar]
- Trkulja, V. Colletotrichum acutatum—nov parazit jabuke kod nas. In Zbornik Rezimea XI Jugoslovenskog Simpozijuma o Zaštiti Bilja i Savetovanja o Primeni Pesticida; The Plant Protection Society of Serbia: Zlatibor, Serbia, 4–9 December 2000; p. 34. (In Serbian) [Google Scholar]
- Trkulja, V. Paraziti uskladištenih plodova jabuke i mogućnosti njihovog suzbijanja. Biljni Lekar 2000, 6, 467–479. (In Serbian) [Google Scholar]
- Børve, J.; Stensvand, A. Colletotrichum acutatum found on apple buds in Norway. Plant Health Prog. 2007, 8, 49. [Google Scholar] [CrossRef]
- Børve, J.; Stensvand, A. Physiological disorders, bitter rot and other fungal decay of ‘Aroma’ apple fruit stored in controlled atmosphere. Acta Agric. Scand. 2016, 66, 461–467. [Google Scholar] [CrossRef]
- Weber, R.W.S.; Palm, G. Resistance of storage rot fungi Neofabraea perennans, N. alba, Glomerella acutata and Neonectria galligena against thiophanate-methyl in Northern German apple production/Resistenz der Lagerfäule-Erreger Neofabraea perennans, N. alba, Clomerella acutata und Neonectria galligena gegen Thiophanate-Methyl in der Apfelproduktion Norddeutschlands. J. Plant Dis. Prot. 2010, 117, 185–191. [Google Scholar]
- Ivic, D.; Voncina, D.; Sever, Z.; Simon, S.; Pejic, I. Identification of Colletotrichum species causing bitter rot of apple and pear in Croatia. Phytopathology 2013, 161, 284–286. [Google Scholar] [CrossRef]
- Mari, M.; Guidarelli, M.; Martini, C.; Spadoni, A. First report of Colletotrichum acutatum causing bitter rot on apple in Italy. Plant Dis. 2012, 96, 144. [Google Scholar] [CrossRef]
- Amaral Carneiro, G.; Baric, S. Colletotrichum fioriniae and Colletotrichum godetiae causing postharvest bitter rot of apple in South Tyrol (Northern Italy). Plant Dis. 2021, 105, 3118–3126. [Google Scholar] [CrossRef]
- Amaral Carneiro, G.; Baric, S. Single-spore isolation protocol for characterization of postharvest pathogens causing bitter rot of apple in South Tyrol. Acta Hortic. 2021, 1325, 1–6. [Google Scholar] [CrossRef]
- Amaral Carneiro, G.; Storti, A.; Baric, S. First report of Colletotrichum salicis causing bitter rot of apple in Italy. Plant Dis. 2021, 105, 224. [Google Scholar] [CrossRef] [PubMed]
- Wenneker, M.; Pham, K.T.K.; Kerkhof, E.; Harteveld, D.O. First report of preharvest fruit rot of ‘Pink Lady’apples caused by Colletotrichum fructicola in Italy. Plant Dis. 2021, 105, 1561. [Google Scholar] [CrossRef] [PubMed]
- Deltedesco, E.; Oettl, S. First report of preharvest decay caused by Colletotrichum chrysophilum on apples in Italy (South Tyrol). Plant Dis. 2023, 107, 967. [Google Scholar] [CrossRef] [PubMed]
- Calì, M.; Amaral-Carneiro, G.; Cappelletti, E.; Bugiani, R.; Baschieri, T.; Baroncelli, R.; Prodi, A. First report of Colletotrichum grossum causing apple bitter rot worldwide (Italy). Plant Dis. 2024, 108, 218. [Google Scholar] [CrossRef]
- Víchová, J.; Staňková, B.; Pokorný, R. First report of Colletotrichum acutatum on tomato and apple fruits in the Czech Republic. Plant Dis. 2012, 96, 769. [Google Scholar] [CrossRef]
- Baroncelli, R.; Sreenivasaprasad, S.; Thon, M.R.; Sukno, S.A. First report of apple bitter rot caused by Colletotrichum godetiae in the United Kingdom. Plant Dis. 2014, 98, 1000. [Google Scholar] [CrossRef]
- Munda, A. First report of Colletotrichum fioriniae and C. godetiae causing apple bitter rot in Slovenia. Plant Dis. 2014, 98, 1282. [Google Scholar] [CrossRef]
- Grantina-Ievina, L. Fungi causing storage rot of apple fruit in integrated pest management system and their sensitivity to fungicides. Rur. Sustain. Res. 2015, 34, 2–11. [Google Scholar] [CrossRef]
- Volkova, J.; Juhņeviča-Radenkova, K. Bitter rot of apple: Different causal agents, two diseases. In Zinātniski Praktiskā Konference “Līdzsvarota Lauksaimniecība 2015”; Latvijas Biozinātņu un Tehnoloģiju Universitāte: Jelgava, Latvia, 19–20 February 2015; pp. 149–152. [Google Scholar]
- Nodet, P.; Baroncelli, R.; Faugère, D.; Le Floch, G. First report of apple bitter rot caused by Colletotrichum fioriniae in Brittany, France. Plant Dis. 2016, 100, 1497. [Google Scholar] [CrossRef]
- Nodet, P.; Chalopin, M.; Crété, X.; Baroncelli, R.; Le Floch, G. First report of Colletotrichum fructicola causing apple bitter rot in Europe. Plant Dis. 2019, 103, 1767. [Google Scholar] [CrossRef]
- Wenneker, M.; Pham, K.T.K.; Lemmers, M.E.C.; de Boer, F.A.; van der Lans, A.M.; van Leeuwen, P.J.; Hollinger, T.C. First report of Colletotrichum godetiae causing bitter rot on ‘Golden Delicious’ apples in the Netherlands. Plant Dis. 2016, 100, 218. [Google Scholar] [CrossRef]
- Grammen, A.; Wenneker, M.; Van Campenhout, J.; Pham, K.T.K.; Van Hemelrijck, W.; Bylemans, D.; Geeraerd, A.; Keulemans, W. Identification and pathogenicity assessment of Colletotrichum isolates causing bitter rot of apple fruit in Belgium. Eur. J. Plant Pathol. 2019, 153, 47–63. [Google Scholar] [CrossRef]
- Kovacevik, B.; Mitrev, S. Phenotypic and pathogenic characterization of Colletotrichum spp. associated with bitter rot on apple fruits in post-harvest storage. In Proceedings of the 2nd International Meeting Agriscience & Practice (ASP 2019), PPR 5, Stip, North Macedonia, 12 April 2019. [Google Scholar]
- Cabrefiga, J.; Pizà, D.; Vilardell, P.; Luque, J. First report of Colletotrichum chrysophilum causing apple bitter rot in Spain. Plant Dis. 2022, 106, 1752. [Google Scholar] [CrossRef] [PubMed]
- Głos, H.M.; Bryk, H.; Michalecka, M.; Puławska, J. The recent occurrence of biotic postharvest diseases of apples in Poland. Agronomy 2022, 12, 399. [Google Scholar] [CrossRef]
- Lee, D.H.; Kim, D.H.; Jeon, Y.A.; Uhm, J.Y.; Hong, S.B. Molecular and cultural characterization of Colletotrichum spp. causing bitter rot of apples in Korea. Plant Pathol. J. 2007, 23, 37–44. [Google Scholar] [CrossRef]
- Lee, S.Y.; Ten, L.N.; Ryu, J.J.; Kang, I.K.; Jung, H.Y. Colletotrichum aenigma associated with apple bitter rot on newly bred cv. RubyS apple. Res. Plant Dis. 2021, 27, 70–75. [Google Scholar] [CrossRef]
- Cheon, W.; Lee, S.G.; Jeon, Y. First report on fruit spot caused by Colletotrichum gloeosporioides in Apple (Malus pumila Mill.) in Korea. Plant Dis. 2016, 100, 210. [Google Scholar] [CrossRef]
- Oo, M.M.; Yoon, H.Y.; Jang, H.A.; Oh, S.K. Identification and characterization of Colletotrichum species associated with bitter rot disease of apple in South Korea. Plant Pathol. J. 2018, 34, 480. [Google Scholar] [CrossRef]
- Park, M.S.; Kim, B.R.; Park, I.H.; Hahm, S.S. First report of two Colletotrichum species associated with bitter rot on apple fruit in Korea—C. fructicola and C. siamense. Mycobiology 2018, 46, 154–158. [Google Scholar] [CrossRef]
- Nam, Y.J.; Lee, S.Y.; Cho, W.D.; Jung, H.Y. First report of anthracnose caused by Colletotrichum grevilleae on apple in Korea. Plant Dis. 2024, 108, 1115. [Google Scholar] [CrossRef] [PubMed]
- Fu, D.D.; Wang, W.; Qin, R.F.; Zhang, R.; Sunb, G.Y.; Gleason, M.L. Colletotrichum fructicola, first record of bitter rot of apple in China. Mycotaxon 2014, 126, 23–30. [Google Scholar] [CrossRef]
- Zhang, Z.; Yan, M.; Li, W.; Guo, Y.; Liang, X. First report of Colletotrichum aenigma causing apple Glomerella leaf spot on the Granny Smith cultivar in China. Plant Dis. 2021, 105, 1563. [Google Scholar] [CrossRef] [PubMed]
- Arzanlou, M.; Bakhshi, M.; Karimi, K.; Torbati, M. Multigene phylogeny reveals three new records of Colletotrichum spp. and several new host records for the mycobiota of Iran. J. Plant Prot. Res. 2015, 55, 199–211. [Google Scholar] [CrossRef]
- Singh, G.; Choudhary, P.; Ahmad, R.; Rawat, R.S.; Jat, B.L. Characterization of Colletotrichum species causing bitter rot of apples in Kashmir orchards. World J. Pharm. Res. 2016, 5, 878–904. [Google Scholar]
- Yokosawa, S.; Eguchi, N.; Kondo, K.I.; Sato, T. Phylogenetic relationship and fungicide sensitivity of members of the Colletotrichum gloeosporioides species complex from apple. J. Gen. Plant Pathol. 2017, 83, 291–298. [Google Scholar] [CrossRef]
- Abid, M.; Chohan, S.; Perveen, R.; Anees, M. First report of bitter rot of apple caused by Colletotrichum siamense in Pakistan. Plant Dis. 2019, 103, 583. [Google Scholar] [CrossRef]
- Latham, A.J.; Williams, J.C. Cultural characteristics and pathogenicity of Glomerella cingulata isolates from apples in Alabama. Plant Dis. 1983, 67, 1065–1068. [Google Scholar] [CrossRef]
- Jones, A.L.; Ehret, G.R.; Meyer, M.P.; Shane, W.W. Occurrence of bitter rot on apple in Michigan. Plant Dis. 1996, 80, 1294–1297. [Google Scholar] [CrossRef]
- Shi, Y.; Correll, J.C.; Guerher, J.C.; Rom, C.R. Frequency of Colletotrichum species causing bitter rot of apple in the southeastern United States. Plant Dis. 1996, 80, 692–696. [Google Scholar] [CrossRef]
- González, E.; Sutton, T.B. Population diversity within isolates of Colletotrichum spp. causing Glomerella leaf spot and bitter rot of apples in three orchards in North Carolina. Plant Dis. 2004, 88, 1335–1340. [Google Scholar] [CrossRef] [PubMed]
- Munir, M.; Amsden, B.; Dixon, E.; Vaillancourt, L.; Gauthier, N.W. Characterization of Colletotrichum species causing bitter rot of apple in Kentucky orchards. Plant Dis. 2016, 100, 2194–2203. [Google Scholar] [CrossRef] [PubMed]
- McCulloch, M.J.; Gauthier, N.W.; Vaillancourt, L.J. First report of bitter rot of apple caused by a Colletotrichum sp. in the C. kahawae clade in Kentucky. Plant Dis. 2020, 104, 289. [Google Scholar] [CrossRef]
- Acheampong, F.; Miller, A.; Babadoost, M. Occurrence and management of apple bitter rot in Illinois. In Plant Health; 2020. Available online: https://experts.illinois.edu/en/publications/occurrence-and-management-of-apple-bitter-rot-in-illinois (accessed on 2 March 2024).
- Acheampong, F.; Miller, A.N.; Babadoost, M. Occurrence of bitter rot of apple in Illinois orchards. In Abstracts of Presentations, Plant Health 2021; Phytopathology S2.137; American Phytopathological Society: St. Paul, MN, USA, 2021; p. 137. [Google Scholar]
- Martin, P.L.; Krawczyk, T.; Khodadadi, F.; Aćimović, S.G.; Peter, K.A. Bitter rot of apple in the mid-Atlantic United States: Causal species and evaluation of the impacts of regional weather patterns and cultivar susceptibility. Phytopathology 2021, 111, 966–981. [Google Scholar] [CrossRef]
- Munawar, A.; Grigg McGuffin, K.; McDonald, M.R.; Jordan, K.S. First report of Apple bitter rot caused by Colletotrichum godetiae in Ontario. Plant Dis. 2024, 108, 1109. [Google Scholar] [CrossRef]
- Velho, A.C.; Stadnik, M.J.; Casanova, L.; Mondino, P.; Alaniz, S. First report of Colletotrichum nymphaeae causing apple bitter rot in southern Brazil. Plant Dis. 2014, 98, 567. [Google Scholar] [CrossRef]
- Velho, A.C.; Mondino, P.; Stadnik, M.J. Extracellular enzymes of Colletotrichum fructicola isolates associated to apple bitter rot and Glomerella leaf spot. Mycology 2018, 9, 145–154. [Google Scholar] [CrossRef]
- Bragança, C.A.; Damm, U.; Baroncelli, R.; Júnior, N.S.M.; Crous, P.W. Species of the Colletotrichum acutatum complex associated with anthracnose diseases of fruit in Brazil. Fungal Biol. 2016, 120, 547–561. [Google Scholar] [CrossRef]
- Hamada, N.A.; Moreira, R.R.; Figueiredo, J.A.G.; Mio, L.L.M.D. Colletotrichum acutatum complex isolated from apple flowers can cause bitter rot and Glomerella leaf spot. Bragantia 2020, 79, 399–406. [Google Scholar] [CrossRef]
- Astolfi, P.; Velho, A.C.; Moreira, V.; Mondino, P.E.; Alaniz, S.M.; Stadnik, M.J. Reclassification of the main causal agent of Glomerella leaf spot on apple into Colletotrichum chrysophilum in southern Brazil and Uruguay. Phytopathology 2022, 112, 1825–1832. [Google Scholar] [CrossRef]
- Alaniz, S.; Hernandez, L.; Damasco, D.; Mondino, P. First report of Colletotrichum acutatum and C. fragariae causing bitter rot of apple in Uruguay. Plant Dis. 2012, 96, 458. [Google Scholar] [CrossRef]
- Alaniz, S.; Hernández, L.; Mondino, P. Colletotrichum fructicola is the dominant and one of the most aggressive species causing bitter rot of apple in Uruguay. Trop. Plant Pathol. 2015, 40, 265–274. [Google Scholar] [CrossRef]
- Fernandez, L.N.; Alaniz, S.; Mondino, P.; Roeschlin, R.A.; Maumary, R.L.; Gariglio, N.F.; Favaro, M.A. First report of Colletotrichum siamense causing apple bitter rot in Central Argentina. Plant Dis. 2018, 102, 250. [Google Scholar] [CrossRef]
- Brook, P.J. Glomerella cingulata and bitter rot of apple. N. Z. J. Agric. Res. 1977, 20, 547–555. [Google Scholar] [CrossRef]
- Johnston, P.R.; Pennycook, S.R.; Manning, M.A. Taxonomy of fruit-rotting fungal pathogens what’s really out there? N. Z. J. Agric. Res. 2005, 58, 42–46. [Google Scholar]
- Everett, K.R.; Timudo-Torrevilla, O.E.; Pushparajah, I.P.S.; Scheper, R.W.A.; Shaw, P.W.; Spiers, T.M.; Ah Chee, A.; Taylor, J.T.; Wood, P.; Wallis, D.R.; et al. Infection of apples by Colletotrichum acutatum in New Zealand is limited by temperature. In Proceedings of the APPS 2009 Plant Health Management: An Integrated Approach, Newcastle, Australia, 29 September–1 October 2009; p. 45. [Google Scholar]
- Everett, K.R.; Pushparajah, I.P.S.; Taylor, J.T.; Timudo-Torrevilla, O.E.; Spiers, T.M.; Chee, A.A.; Shaw, P.W.; Wallis, D.R. Evaluation of fungicides for control of bitter and sprinkler rots on apple fruit. N. Z. Plant Prot. 2015, 68, 264–274. [Google Scholar] [CrossRef]
- Everett, K.R.; Pushparajah, I.P.S.; Timudo, O.E.; Ah Chee, A.; Scheper, R.W.A.; Shaw, P.W.; Taylor, J.T.; Wallis, D.R.; Wood, P.N. Infection criteria, inoculum sources and splash dispersal pattern of Colletotrichum acutatum causing bitter rot of apple in New Zealand. Eur. J. Plant Pathol. 2018, 152, 367–383. [Google Scholar] [CrossRef]
- Cooke, A.; Persley, D.; House, S. Diseases of Fruit Crops in Australia; CSIRO Publishing: Collingwood, Australia, 2009; pp. 1–276. [Google Scholar]
- Agrios, G.N. Plant Pathology, 5th ed.; Elsevier Academic Press: Amsterdam, The Netherlands, 2005. [Google Scholar]
- Mordue, J.E.M. Glomerella cingulata. In CMI Descriptions of Pathogenic Fungi and Bacteria, No. 315; Commonwealth Mycological Institute: Kew, UK, 1971. [Google Scholar]
- Noe, J.P.; Starkey, T.E. Relationship of apple fruit maturity and inoculum concetracion to infection by Glomerella cingulata. Plant Dis. 1982, 66, 379–381. [Google Scholar] [CrossRef]
- Taylor, J. Epidemiology and symptomatology of apple bitter rot. Phytopathology 1971, 60, 1028–1029. [Google Scholar] [CrossRef]
- Simmonds, J.H. A study of the species of Colletotrichum causing ripe fruit rots in Queensland. Q. J. Agric. Anim. Sci. 1965, 22, 437–459. [Google Scholar]
- Dharmaputra, O.S.; Putri, A.S.R.; Dewi, A.U. Mycobiota of apple fruit: Effects on bitter rot caused by Colletotrichum acutatum. In Proceedings of the IV International Symposium on Tropical and Subtropical Fruits, Bogor, Indonesia, 3–7 November 2008; pp. 223–229. [Google Scholar]
- Nekoduka, S.; Tanaka, K.; Sano, T. Epidemiology of apple bitter rot caused by Colletotrichum acutatum sensu lato. J. Gen. Plant Pathol. 2018, 84, 262–271. [Google Scholar] [CrossRef]
- Børve, J.; Djønne, R.T.; Stensvand, A. Colletotrichum acutatum; a post harvest pathogen on apple in Norway. J. Plant Pathol. 2008, 90, 507. [Google Scholar]
- Leonberger, K.; McCulloch, M.; Gauthier, N.W. Bitter rot of apple. In Plant Pathology Fact Sheet PPFS-FR-T-24; Extension Plant Pathology, University of Kentucky, College of Agriculture, Food and Environment: Lexington, KY, USA, 2019; pp. 1–6. [Google Scholar]
- Hoge, B.L. Characterization of the Genetic Diversity and Developmental Biology of the Colletotrichum gloeosporioides Species Complex in NC Apple Orchards. Master’s Thesis, North Carolina State University, Raleigh, NC, USA, 2017; p. 90. [Google Scholar]
- Willis, J.C. DCLII—Tea and coffee diseases. In Bulletin of Miscellaneous Information Royal Botanical Gardens; Kew: Surrey, UK, 1899; pp. 89–94. [Google Scholar]
- Vieira, W.A.; Lima, W.G.; Nascimento, E.S.; Michereff, S.J.; Câmara, M.P.; Doyle, V.P. The impact of phenotypic and molecular data on the inference of Colletotrichum diversity associated with Musa. Mycologia 2017, 109, 912–934. [Google Scholar] [CrossRef] [PubMed]
- Faedda, R.; Agosteo, G.E.; Schena, L.; Mosca, S.; Frisullo, S.; di San Lio, G.M.; Cacciola, S.O. Colletotrichum clavatum sp. nov. identified as the causal agent of olive anthracnose in Italy. Phytopathol. Mediterr. 2011, 50, 283–302. [Google Scholar]
- Diao, Y.Z.; Zhang, C.; Liu, F.; Wang, W.Z.; Liu, L.; Cai, L.; Liu, X.L. Colletotrichum species causing anthracnose disease of chili in China. Persoonia 2017, 38, 20–37. [Google Scholar] [CrossRef]
- Marcelino, J.; Giordano, R.; Gouli, S.; Gouli, V.; Parker, B.L.; Skinner, M.; TeBeest, D.; Cesnik, R. Colletotrichum acutatum var. fioriniae (teleomorph: Glomerella acutata var. fioriniae var. nov.) infection of a scale insect. Mycologia 2008, 100, 353–374. [Google Scholar]
- Guerber, J.C.; Liu, B.; Correll, J.C.; Johnston, P.R. Characterization of diversity in Colletotrichum acutatum sensu lato by sequence analysis of two gene introns, mtDNA and intron RFLPs, and mating compatibility. Mycologia 2003, 95, 872–895. [Google Scholar] [CrossRef]
- Kou, L.P.; Gaskins, V.; Luo, Y.G.; Jurick, W.M. First report of Colletotrichum fioriniae causing postharvest decay on ‘Nittany’apple fruit in the United States. Plant Dis. 2014, 98, 993. [Google Scholar] [CrossRef]
- Prihastuti, H.; Cai, L.; Chen, H.; McKenzie, E.H.C.; Hyde, K.D. Characterization of Colletotrichum species associated with coffee berries in northern Thailand. Fungal Divers. 2009, 39, 89–109. [Google Scholar]
- Kong, Y.; Yuan, Y.; Menghan, Y.; Yiming, L.; Liang, X.; Gleason, M.L.; Rong, Z.; Sun, G. CfCpmd1 regulates pathogenicity and sexual development of plus and minus strains in Colletotrichum fructicola causing Glomerella leaf spot on apple in China. Phytopathology 2023, 113, 1985–1993. [Google Scholar] [CrossRef]
- Onofre, S.B.; Antoniazzi, D. Behavior of the fungus Colletotrichum gloeosporioides (Penz & Sacc.), which causes bitter rot in apples after harvesting. Adv. Microbiol. 2014, 4, 202–206. [Google Scholar]
- Sutton, T.B.; Shane, W.W. Epidemiology of the perfect stage of Glomerella cingulata on apples. Phytopathology 1983, 73, 1179–1183. [Google Scholar] [CrossRef]
- Camilo, A.P.; Lamb, R.C.; Aldwinckle, H.S. Genetic resistance to bitter rot incited by Glomerella cingulata (Stoneman) Spaulding & Von Schrenk in apple (Malus domestica (Borkh.). In Proceedings of the International Workshop on Apple Culture in the Tropics and Subtropics, Florianópolis, Brazil, 14–18 September 1987; pp. 37–45. [Google Scholar]
- Liu, F.; Damm, U.; Cai, L.; Crous, P.W. Species of the Colletotrichum gloeosporioides complex associated with anthracnose diseases of Proteaceae. Fungal Divers. 2013, 61, 89–105. [Google Scholar] [CrossRef]
- Liu, F.; Weir, B.S.; Damm, U.; Crous, P.W.; Wang, Y.; Liu, B.; Wang, M.; Zhang, M.; Cai, L. Unravelling Colletotrichum species associated with Camellia: Employing ApMat and GS loci to resolve species in the C. gloeosporioides complex. Persoonia 2015, 35, 63–86. [Google Scholar] [CrossRef] [PubMed]
- Waller, J.M.; Bridge, P.D.; Black, R.; Hakiza, G. Characterization of the coffee berry disease pathogen, Colletotrichum kahawae sp. nov. Mycol. Res. 1993, 97, 989–994. [Google Scholar] [CrossRef]
- Johnson, D.A.; Carris, L.M.; Rogers, J.D. Morphological and molecular characterization of Colletotrichum nymphaeae and C. nupharicola sp. nov. on water-lilies (Nymphaea and Nuphar). Mycol. Res. 1997, 101, 641–649. [Google Scholar] [CrossRef]
- Wu, W.X.; Huang, X.Q.; Liu, Y.; Zhang, L. First report of apple bitter rot caused by Colletotrichum rhombiforme in China. Plant Dis. 2017, 101, 1033. [Google Scholar] [CrossRef]
- Han, F.Y.; Zhang, Y.T.; Liu, Z.Z.; Ge, L.; Wang, L.D.; Ji, Y.P.; Qi, Y.K.; Zhu, W.C.; Wang, Q.H. First report of red-fleshed apple anthracnose caused by Colletotrichum siamense. Plant Dis. 2022, 106, 1299. [Google Scholar] [CrossRef]
- Rojas, E.I.; Rehner, S.A.; Samuels, G.J.; Van Bael, S.A.; Herre, E.A.; Cannon, P.; Chen, R.; Pang, J.; Wang, R.; Zhang, Y.; et al. Colletotrichum gloeosporioides s.l. associated with Theobroma cacao and other plants in Panama: Multilocus phylogenies distinguish host-associated pathogens from asymptomatic endophytes. Mycologia 2010, 102, 1318–1338. [Google Scholar] [CrossRef]
- Børve, J.; Stensvand, A. Colletotrichum acutatum occurs asymptomatically on apple leaves. Eur. J. Plant Pathol. 2017, 147, 943–948. [Google Scholar] [CrossRef]
- Wallhead, M.; Broders, G.; Beaudoin, E.; Peralta, C.; Broders, K. Phylogenetic assessment of Colletotrichum species associated with bitter rot and Glomerella leaf spot in the northeastern US. Phytopathol. APS Annu. Meet. 2014, 104, 123–124. [Google Scholar]
- Alaniz, S.; Cuozzo, V.; Martínez, V.; Stadnik, M.J.; Mondino, P. Ascospore infection and Colletotrichum species causing Glomerella leaf spot of apple in Uruguay. Plant Pathol. J. 2019, 35, 100–111. [Google Scholar] [CrossRef] [PubMed]
- Yang, Y.; Cai, L.; Yu, Z.; Liu, Z.; Hyde, K.D. Colletotrichum species on Orchidaceae in southwest China. Cryptogam. Mycol. 2011, 32, 229–253. [Google Scholar]
- Roberts, J.W. The sources of apple bitter-rot infections. U.S. Dept. Agric. Bull. 1918, 684, 1–26. [Google Scholar]
- Roberts, J.W. Apple bitter rot and its control. U.S. Dept. Agric. Bull. 1935, 938, 1–10. [Google Scholar]
- Shane, W.W.; Sutton, T.B. The Glomerella cingulata perfect stage and apple bitter rot. Plant Dis. 1981, 65, 135–137. [Google Scholar] [CrossRef]
- Crusius, L.U.; Forcelini, C.A.; Sanhueza, R.M.; Fernandes, J.M. Epidemiology of apple leaf spot. Fitopatol. Bras. 2002, 27, 65–70. [Google Scholar] [CrossRef]
- Ellis, M.A. Bitter rot of apples. In Agriculture and Natural Resources; The Ohio State University Extension, The Ohio State University: Columbus, OH, USA, 2008; pp. 1–3. [Google Scholar]
- Hamada, N.A.; Mio, L.M.D. Survival of pathogenic Colletotrichum isolates on dormant buds, twigs and fallen leaves of apple trees in commercial orchards. Fruits 2017, 72, 158–165. [Google Scholar] [CrossRef]
- Dowling, M.; Peres, N.; Villani, S.; Schnabel, G. Managing Colletotrichum on fruit crops: A “complex” challenge. Plant Dis. 2020, 104, 2301–2316. [Google Scholar] [CrossRef]
- Argenta, L.C.; de Freitas, S.T.; Mattheis, J.P.; Vieira, M.J.; Ogoshi, C. Characterization and quantification of postharvest losses of apple fruit stored under commercial conditions. Hort. Sci. 2021, 56, 608–616. [Google Scholar] [CrossRef]
- Carraro, T.A.; Moreira, R.R.; Gelain, J.; May de Mio, L.L. Etiology and epidemiology of diseases caused by Colletotrichum spp. in persimmon, apple, peach, and grapevine. Rev. Anual Patol. Plantas 2022, 28, 136–162. [Google Scholar] [CrossRef]
- Yang, X.; Wilson, L.L.; Madden, L.V.; Ellis, M.A. Rain splash dispersal of Colletotrichum acutatum from infected strawberry fruit. Phytopathology 1990, 80, 590–595. [Google Scholar] [CrossRef]
- Katsurayama, Y.; da Silva Boneti, J.I.; Becker, W.F. Mancha foliar da Gala: Principal doença de verão da cultura da macieira. Agropec. Catarin. 2000, 13, 15–19. [Google Scholar]
- Wang, B.; Li, B.H.; Dong, X.L.; Wang, C.X.; Zhang, Z.F. Effects of temperature, wetness duration, and moisture on the conidial germination, infection, and disease incubation period of Glomerella cingulata. Plant Dis. 2015, 99, 249–256. [Google Scholar] [CrossRef]
- Hamada, N.A.; Moreira, R.R.; Nesi, C.N.; Mio, L.L.M.D. Pathogen dispersal and Glomerella leaf spot progress within apple canopy in Brazil. Plant Dis. 2019, 103, 3209–3217. [Google Scholar] [CrossRef]
- Moreira, R.R.; Zielinski, E.C.; Castellar, C.; Bergamin Filho, A.; May De Mio, L.L. Study of infection process of five species of Colletotrichum comparing symptoms of glomerella leaf spot and bitter rot in two apple cultivars. Eur. J. Plant Pathol. 2021, 159, 37–53. [Google Scholar] [CrossRef]
- Araújo, L.; Gonçalves, A.E.; Stadnik, M.J. Ulvan effect on conidial germination and appressoria formation of Colletotrichum gloeosporioides. Phytoparasitica 2014, 42, 631–640. [Google Scholar] [CrossRef]
- Nita, M.; Atwal, A.; Bly, A.; Lewallen, K. The growth rate of apple bitter rot lesion, caused by Colletotrichum spp., is affected by temperature, fungal species, and cultivar. Int. J. Phytopathol. 2019, 8, 31–36. [Google Scholar] [CrossRef]
- González, E.; Sutton, T.B. Differentiation of isolates of Glomerella cingulata and Colletotrichum spp. associated with Glomerella leaf spot and bitter rot of apples using growth rate, response to temperature, and benomyl sensitivity. Plant Health Prog. 2005, 6, 6. [Google Scholar] [CrossRef]
- Freeman, S.; Minz, D.; Jurkevitch, E.; Maymon, M.; Shabi, E. Molecular analyses of Colletotrichum species from almond and other fruits. Phytopathology 2000, 90, 608–614. [Google Scholar] [CrossRef]
- Cai, L.; Hyde, K.D.; Taylor, P.W.J.; Weir, B.; Waller, J.; Abang, M.M.; Zhang, J.Z.; Yang, Y.L.; Phoulivong, S.; Liu, Z.Y.; et al. A polyphasic approach for studying Colletotrichum. Fun. Divers. 2009, 39, 183–204. [Google Scholar]
- Vieira, W.A.; Bezerra, P.A.; da Silva, A.C.; Veloso, J.S.; Câmara, M.P.S.; Doyle, V.P. Optimal markers for the identification of Colletotrichum species. Mol. Phylogenet. Evol. 2020, 143, 106694. [Google Scholar] [CrossRef] [PubMed]
- White, T.J.; Bruns, T.; Lee, S.J.W.T.; Taylor, J. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In PCR Protocols a Guide to Methods and Applications; Academic Press, Inc.: Cambridge, MA, USA, 1990; Volume 18, pp. 315–322. [Google Scholar]
- Brown, A.; Sreenivasaprasad, S.; Timmer, L.W. Molecular characterization of slow-growing orange and key lime anthracnose strains of Colletotrichum from citrus as C. acutatum. Phytopathology 1996, 86, 523–527. [Google Scholar] [CrossRef]
- Glass, N.L.; Donaldson, G.C. Development of primer sets designed for use with the PCR to amplify conserved genes from filamentous ascomycetes. Appl. Environ. Microbiol. 1995, 61, 1323–1330. [Google Scholar] [CrossRef]
- O’Donnell, K.; Cigelnik, E. Two divergent intragenomic rDNA ITS2 types within a monophyletic lineage of the fungus Fusarium are nonorthologous. Mol. Phylogenet. Evol. 1997, 7, 103–116. [Google Scholar] [CrossRef]
- Woudenberg, J.H.C.; Aveskamp, M.M.; De Gruyter, J.; Spiers, A.G.; Crous, P.W. Multiple Didymella teleomorphs are linked to the Phoma clematidina morphotype. Pers.—Mol. Phylogeny Evol. Fungi 2009, 22, 56–62. [Google Scholar] [CrossRef]
- Baroncelli, R. Colletotrichum acutatum sensu lato: From Diversity Study to Genome Analysis. Ph.D. Dissertation, University of Warwick, Coventry, UK, 2012; pp. 1–194. [Google Scholar]
- Carbone, I.; Kohn, L.M. A method for designing primer sets for speciation studies in filamentous ascomycetes. Mycologia 1999, 91, 553–556. [Google Scholar] [CrossRef]
- Crous, P.W.; Groenewald, J.Z.; Risède, J.M.; Simoneau, P.; Hywel-Jones, N.L. Calonectria species and their Cylindrocladium anamorphs: Species with sphaeropedunculate vesicles. Stud. Mycol. 2004, 50, 415–430. [Google Scholar]
- Stephenson, S.A.; Green, J.R.; Manners, J.M.; Maclean, D.J. Cloning and characterisation of glutamine synthetase from Colletotrichum gloeosporioides and demonstration of elevated expression during pathogenesis on Stylosanthes guianensis. Curr. Genet. 1997, 31, 447–454. [Google Scholar] [CrossRef]
- Talhinhas, P.; Sreenivasaprasad, S.; Neves-Martins, J.; Oliveira, H. Genetic and morphological characterization of Colletotrichum acutatum causing anthracnose of lupins. Phytopathology 2002, 92, 986–996. [Google Scholar] [CrossRef] [PubMed]
- Gonçalves, A.E.; Velho, A.C.; Stadnik, M.J. Formation of conidial anastomosis tubes and melanization of appressoria are antagonistic processes in Colletotrichum spp. from apple. Eur. J. Plant Pathol. 2016, 146, 497–506. [Google Scholar] [CrossRef]
- Jiang, B.; Cai, T.; Yang, X.; Dai, Y.; Yu, K.; Zhang, P.; Li, P.; Wang, C.; Liu, N.; Li, B.; et al. Comparative transcriptome analysis reveals significant differences in gene expression between pathogens of apple Glomerella leaf spot and apple bitter rot. BMC Genom. 2022, 23, 246. [Google Scholar] [CrossRef]
- Trkulja, V.; Predić, T.; Zavišić, N.; Simić, D.; Miladinović, Z.; Tanasić, B.; Babić, G.; Mihić Salapura, J.; Cvijanović, T.; Vuković, B.; et al. Integralna Proizvodnja Jabučastog Voća; JU Poljoprivredni Institut Republike Srpske: Banja Luka, Bosnia and Herzegovina, 2020. (In Serbian) [Google Scholar]
- Naqvi, S.A.M.H. Diseases of Fruits and Vegetables; Springer: Berlin/Heidelberg, Germany, 2004; pp. 1–679. [Google Scholar]
- Martin, P.L.; King, W.L.; Bell, T.H.; Peter, K.A. The decay and fungal succession of apples with bitter rot across a vegetation diversity gradient. Phytobiomes J. 2022, 6, 26–34. [Google Scholar] [CrossRef]
- Schubert, T.S. Bitter Rot of Apple; Plant Pathology Circular No. 248; Florida Department of Agriculture and Consumer Services: Gainesville, FL, USA, 1983; pp. 1–2. [Google Scholar]
- Everett, K.R.; Timudo-Torrevilla, O.E.; Scheper, R.W.A.; Shaw, P.W.; Wood, P.N.; Mundy, D.C.; Wallis, D.R. The influence of nutrition maturity and canopy density on the incidence of apple bitter rot. N. Z. Plant Prot. 2016, 69, 99–110. [Google Scholar] [CrossRef]
- Biggs, A.R. Effects of calcium salts on apple bitter rot caused by two Colletotrichum spp. Plant Dis. 1999, 83, 1001–1005. [Google Scholar] [CrossRef]
- Trkulja, V. Bolesti uskladištenih plodova jabuke. Glas. Zaštite Bilja 2003, 6, 5–29. (In Croatian) [Google Scholar]
- Boyd-Wilson, K.S.H.; Glithero, N.; Ma, Q.; Alspach, P.A.; Walter, M. Yeast isolates to inhibit blue mould and bitter rot of apples. N. Z. Plant Prot. 2006, 59, 86–91. [Google Scholar] [CrossRef]
- Suzzi, G.; Romano, P.; Ponti, I.; Montuschi, C. Natural wine yeasts as biocontrol agents. J. Appl. Microbiol. 1995, 78, 304–308. [Google Scholar] [CrossRef]
- Lee, G.W.; Ko, J.A.; Oh, B.T.; Choi, J.R.; Lee, K.J.; Chae, J.C.; Kamala-Kannan, S. Biological control of postharvest diseases of apples, peaches and nectarines by Bacillus subtilis S16 isolated from halophytes rhizosphere. Biocontrol Sci. Technol. 2012, 22, 351–361. [Google Scholar] [CrossRef]
- Sadeghian, M.; Bonjar, G.H.S.; Sirchi, G.R.S. Post harvest biological control of apple bitter rot by soil-borne Actinomycetes and molecular identification of the active antagonist. Postharvest Biol. Technol. 2016, 112, 46–54. [Google Scholar] [CrossRef]
- Moline, H.E.; Locke, J.C. Comparing neem seed oil with calcium chloride and fungicides for controlling postharvest apple decay. HortScience 1993, 28, 719–720. [Google Scholar] [CrossRef]
- Zivanov, D.; Petreš, M.; Popov, M.; Grahovac, M. Antifungal activity of root extract of Asclepias syriaca L. on causal agents of apple bitter rot. Res. J. Agric. Sci. 2020, 52, 210–219. [Google Scholar]
- Wang, D.; Wang, G.; Wang, J.; Zhai, H.; Xue, X. Inhibitory effect and underlying mechanism of cinnamon and clove essential oils on Botryosphaeria dothidea and Colletotrichum gloeosporioides causing rots in postharvest bagging-free apple fruits. Front. Microbiol. 2023, 14, 1109028. [Google Scholar] [CrossRef]
- Gregori, R.; Mari, M.; Bertolini, P.; Barajas, J.S.; Tian, J.B.; Labavitch, J.M. Reduction of Colletotrichum acutatum infection by a polygalacturonase inhibitor protein extracted from apple. Postharvest Biol. Technol. 2008, 48, 309–313. [Google Scholar] [CrossRef]
- Gregori, R.; Guidarelli, M.; Mari, M. Preliminary studies on partial reduction of Colletotrichum acutatum infection by proteinase inhibitors extracted from apple skin. Physiol. Mol. Plant Pathol. 2010, 74, 303–308. [Google Scholar] [CrossRef]
- Janisiewicz, W.J.; Leverentz, B.; Conway, W.S.; Saftner, R.A.; Reed, A.N.; Camp, M.J. Control of bitter rot and blue mold of apples by integrating heat and antagonist treatments on 1-MCP treated fruit stored under controlled atmosphere conditions. Postharvest Biol. Technol. 2003, 29, 129–143. [Google Scholar] [CrossRef]
- Shi, X.C.; Wang, S.Y.; Duan, X.C.; Wang, Y.Z.; Liu, F.Q.; Laborda, P. Biocontrol strategies for the management of Colletotrichum species in postharvest fruits. Crop Prot. 2021, 141, 105454. [Google Scholar] [CrossRef]
- Cerezine, P.C.; Leite, R.P., Jr.; Tsuneta, M. Efeito de tratamentos químicos no controle da mancha foliar de Glomerella em maciera, no Estado do Paraná. Fitopatol. Bras. 1992, 17, 258–267. [Google Scholar]
- Shi, Y.; Rom, C.R.; Correll, J.C. The effect of fungicide on the growth of apple bitter rot pathogens. HortScience 1996, 31, 757. [Google Scholar] [CrossRef]
- Martin, P.L.; Krawczyk, T.; Pierce, K.; Thomas, C.; Khodadadi, F.; Aćimović, S.G.; Peter, K.A. Fungicide sensitivity of Colletotrichum species causing bitter rot of apple in the mid-Atlantic USA. Plant Dis. 2022, 106, 549–563. [Google Scholar] [CrossRef] [PubMed]
- Johnson, K.A. Characterization and Fungicide Efficacy of North Carolina Colletotrichum Populations Causing Glomerella Leaf Spot and Fruit Rot on Apple. Master’s Thesis, North Carolina State University, Raleigh, NC, USA, 2018; pp. 1–106. [Google Scholar]
- Chechi, A.; Stahlecker, J.; Dowling, M.E.; Schnabel, G. Diversity in species composition and fungicide resistance profiles in Colletotrichum isolates from apples. Pestic. Biochem. Physiol. 2019, 158, 18–24. [Google Scholar] [CrossRef] [PubMed]
- Rosenberger, D.; Cox, K.; Rugh, A.; Villani, S.; Fredericks, Z. A new fungicide for controlling summer diseases on apples? N. Y. Fruit Q. 2012, 20, 9–13. [Google Scholar]
- Kowata, L.S.; Strapasson, M.; Challiol, M.A.; Mio, M.D.; Larissa, L. Glomerella leaf spot in apple: Validation of proposed diagrammatic scale and efficiency of fungicides. Cienc. Rural. 2010, 40, 1502–1508. [Google Scholar] [CrossRef]
- Abbott, C.P.; Beckerman, J.L. Incorporating adjuvants with captan to manage common apple diseases. Plant Dis. 2018, 102, 231–236. [Google Scholar] [CrossRef] [PubMed]
- Trkulja, V. Zaštita uskladištenog voća od bolesti. In Zaštita Uskladištenih Poljoprivrednih Proizvoda od Štetnih Organizama; Kljajić, P., Ed.; Institut za Pesticide i Zaštitu Životne Sredine: Belgrade, Serbia, 2008; Chapter 8; pp. 193–213. (In Serbian) [Google Scholar]
- Shi, Y.; Rom, C.; Correll, J.C. Disease reactions of apple genotypes to several bitter rot pathogens. HortScience 1994, 29, 432. [Google Scholar] [CrossRef]
- Biggs, A.R.; Miller, S.S. Relative susceptibility of selected apple cultivars to Colletotrichum acutatum. Plant Dis. 2001, 85, 657–660. [Google Scholar] [CrossRef] [PubMed]
- Jílková, B.; Víchová, J. Susceptibility of apple fruits from selected cultivars to the Colletotrichum acutatum species complex. Plant Prot. Sci. 2022, 58, 298–304. [Google Scholar] [CrossRef]
- Trkulja, V. Sensitivity of fruits of different varieities or combinations of apple variety/rootstocks according to the selected isolates Colletotrichum acutatum. In Book of Proceedings V Congress on Plant Protection; The Plant Protection Society of Serbia: Zlatibor, Serbia, 22–26 November 2004; pp. 184–187. [Google Scholar]
- Liu, Y.; Li, B.; Wang, C.; Liu, C.; Kong, X.; Zhu, J.; Dai, H. Genetics and molecular marker identification of a resistance to glomerella leaf spot in apple. Hortic. Plant J. 2016, 2, 121–125. [Google Scholar] [CrossRef]
- Nybom, H.; Ahmadi-Afzadi, M.; Rumpunen, K.; Tahir, I. Review of the impact of apple fruit ripening, texture and chemical contents on genetically determined susceptibility to storage rots. Plants 2020, 9, 831. [Google Scholar] [CrossRef]
- Shi, Y.; Rom, C.; Correll, J.C. Effect of fruit maturity on bitter rot of apple. HortScience 1995, 30, 762. [Google Scholar] [CrossRef]
- Ahmadi-Afzadi, M.; Tahir, I.; Nybom, H. Impact of harvesting time and fruit firmness on the tolerance to fungal storage diseases in an apple germplasm collection. Postharvest Biol. Technol. 2013, 82, 51–58. [Google Scholar] [CrossRef]
- Tahir, I.I.; Johansson, E.; Olsson, M.E. Improvement of apple quality and storability by a combination of heat treatment and controlled atmosphere storage. HortScience 2009, 44, 1648–1654. [Google Scholar] [CrossRef]
Gene | Primer Name | Sequence | Amplicon Length (bp) | Reference |
---|---|---|---|---|
ITS | ITS1 | TCCGTAGGTGAACCTGCGG | ||
ITS4 | TCCTCCGCTTATTGATATGC | 610 | [210] | |
ITS5 | GGAAGTAAAAGTCGTAACAAGG | - | ||
CaInt2 | GGGGAAGCCTCTCGCGG | 490 | [211] | |
CgInt | GGCCTCCCGCCTCCGGGCGG | 450 | ||
TUB2 | T1 | AACATGCGTGAGATTGTAAGT | 1500 | [213] |
T2 | TAG TGA CCC TTG GCC CAGT TG | |||
Bt2b | ACCCTCAGTGTAGTGACCCTTGGC | 500 | [212] | |
Bt2a | GGTAACCAAATCGGTGCTGCTTTC | |||
GAPDH | GDF1 | GCCGTCAACGACCCCTTCATTGA | 270 | [172] |
GDR1 | GGGTGGAGTCGTACTTGAGCATGT | |||
TUB | TB5 | GGTAACCAGATTGGTGCTGCCTT | 550 | [219] |
TB6 | GCAGTCGCAGCCCTCAGCCT | |||
ACT | ACT-512F | ATGTGCAAGGCCGGTTTCGC | 270 | [216] |
ACT-783R | TACGAGTCCTTCTGGCCCAT | |||
CHS-1 | CHS-345R | TGGAAGAACCATCTGTGAGAGTTG | 300 | [216] |
CHS-79F | TGGGGCAAGGATGCTTGGAAGAAG | |||
HIS3 | CYLH3F | AGGTCCACTGGTGGCAAG | - | [217] |
CYLH3R | AGCTGGATGTCCTTGGACTG | - | ||
TUB | BT2Fd | GTBCACCTYCARACCGGYCARTG | 333 | [214] |
BT4R | CCRGAYTGRCCRAARACRAAG | |||
CAL | CL1C | GAATTCAAGGAGGCCTTCTC | 830 | [10] |
CL2C | CTTCTGCATCATGAGGTGGAC | |||
GS | GSF | ATGGCCGAGTACATCTGG | 900 | [218] |
GSR | GAACCGTCGAAGTTCCAC | |||
ApMat | CgDL-F6 | AGTGGAGGTGCGGGACGTT | 870 | [185] |
CgMAT1F2 | TGATGTATCCCGACTACCG | |||
APN2 | ColDL-F3 | GGGAGAAGCGAACATACCA | 900 | [185] |
CgDL-R1 | GCCCGACGAGCAGAGGACGTAGTC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Trkulja, V.; Čojić, B.; Trkulja, N.; Tomić, A.; Matić, S.; Ikanović, J.; Popović Milovanović, T. Colletotrichum Species Associated with Apple Bitter Rot and Glomerella Leaf Spot: A Comprehensive Overview. J. Fungi 2024, 10, 660. https://doi.org/10.3390/jof10090660
Trkulja V, Čojić B, Trkulja N, Tomić A, Matić S, Ikanović J, Popović Milovanović T. Colletotrichum Species Associated with Apple Bitter Rot and Glomerella Leaf Spot: A Comprehensive Overview. Journal of Fungi. 2024; 10(9):660. https://doi.org/10.3390/jof10090660
Chicago/Turabian StyleTrkulja, Vojislav, Bojana Čojić, Nenad Trkulja, Andrija Tomić, Slavica Matić, Jela Ikanović, and Tatjana Popović Milovanović. 2024. "Colletotrichum Species Associated with Apple Bitter Rot and Glomerella Leaf Spot: A Comprehensive Overview" Journal of Fungi 10, no. 9: 660. https://doi.org/10.3390/jof10090660
APA StyleTrkulja, V., Čojić, B., Trkulja, N., Tomić, A., Matić, S., Ikanović, J., & Popović Milovanović, T. (2024). Colletotrichum Species Associated with Apple Bitter Rot and Glomerella Leaf Spot: A Comprehensive Overview. Journal of Fungi, 10(9), 660. https://doi.org/10.3390/jof10090660