Next Article in Journal
Structural and Functional Alterations Caused by Aureobasidin A in Clinical Resistant Strains of Candida spp.
Previous Article in Journal
Cortinarius and Tomentella Fungi Become Dominant Taxa in Taiga Soil after Fire Disturbance
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
JoF
Volume 9
Issue 11
10.3390/jof9111114
jof-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Serendipita indica Promotes the Growth of Tartary Buckwheat by Stimulating Hormone Synthesis, Metabolite Production, and Increasing Systemic Resistance

by
Meijia Zheng
,
Shanpu Zhong
,
Wenjing Wang
,
Zizhong Tang
,
Tongliang Bu
and
Qingfeng Li
*
College of Life Sciences, Sichuan Agricultural University, Ya’an 625014, China
*
Author to whom correspondence should be addressed.
J. Fungi 2023, 9(11), 1114; https://doi.org/10.3390/jof9111114
Submission received: 2 October 2023 / Revised: 14 November 2023 / Accepted: 15 November 2023 / Published: 17 November 2023
Browse Figures
Review Reports Versions Notes

Abstract

:
The main objective of this study was to investigate the influence of Serendipita indica on the growth of Tartary buckwheat plants. This study highlighted that the roots of Tartary buckwheat can be colonized by S. indica and that this fungal endophyte improved plants height, fresh weight, dry weight, and grain yield. In the meantime, the colonization of S. indica in Tartary buckwheat leaves resulted in elevated levels of photosynthesis, plant hormone content, antioxidant enzyme activity, proline content, chlorophyll content, soluble sugars, and protein content. Additionally, the introduction of S. indica to Tartary buckwheat roots led to a substantial rise in the levels of flavonoids and phenols found in the leaves and seeds of Tartary buckwheat. In addition, S. indica colonization reduced the content of malondialdehyde and hydrogen peroxide when compared to non-colonized plants. Importantly, the drought tolerance of Tartary buckwheat plants is increased, which benefits from physiology and bio-chemical changes in plants after S. indica colonized. In conclusion, we have shown that S. indica can improve systematic resistance and promote the growth of Tartary buckwheat by enhancing the photosynthetic capacity of Tartary buckwheat, inducing the production of IAA, increasing the content of secondary metabolites such as total phenols and total flavonoids, and improving the antioxidant enzyme activity of the plant.

1. Introduction

Tartary buckwheat (Fagopyrum tataricum Gaertn.) is a group of pseudocereals of the genus Fagopyrum in the Polygonaceae family. Tartary buckwheat is considered an important medicinal and edible food crop. It is rich in proteins and flavonoids, has hypoglycemic and anti-inflammatory effects, and can enhance the immunity of the body, which is quite beneficial to one’s health [1,2,3]. A survey of the Tartary buckwheat cultivation in China shows that it can grow in high-altitude areas in the southwest [4]. Sichuan Yi Autonomous Prefecture in China is located in the center of cultivated Tartary buckwheat [5]. As one of the main crops, the growth and development of Tartary buckwheat face issues such as poor planting areas, low soil fertility, drought, and salt stress in the plantation areas, resulting in low emergence rates and poor seedling quality, ultimately affecting the production of Tartary buckwheat. Therefore, it is necessary to find an efficient, environmentally friendly, and promotional way to solve the growth problem of Tartary buckwheat. Many studies have highlighted that several endophytic fungal microorganisms improve their plant hosts’ vegetative performance and their resistance to biotic and abiotic stresses. Endophytic fungal microorganisms have also recently been identified in Tartary buckwheat, with beneficial effects in the same plants. Researchers have examined the influence of soil microorganisms on endophytic fungi in Tartary buckwheat and determined that firmicutes is the predominant microbial group of Tartary buckwheat, which is passed down through generations [6]. A previous study has indicated that the endophytic fungus Fusarium oxysporum Fat9 enhances the growth, accumulation of flavonoids, and antioxidant properties of Tartary buckwheat through the use of water-extracted mycelia polysaccharide (WPS), sodium hydroxide-extracted mycelia polysaccharide (SPS), hydrochloric-extracted mycelia polysaccharide (APS), and exo-polysaccharide (EPS) [7]. Meanwhile, studies have shown that endophytic fungi Fusarium oxysporum Fat9 and Alternaria sp. Fat15 can stimulate the phenylpropanoid pathway and promote an increase in Tartary buckwheat rutin content [8]. Thus, endophytic fungi can promote the growth of Tartary buckwheat and accumulate its metabolites.
As an endophytic fungus in plant roots, Serendipita indica has a wide range of hosts and can interact with a variety of plants to promote their growth and enhance stress tolerance [9]. It belongs to Basidiomycota, Agaricomycotina, Hymenomycetes, Sebacinales, Sebacinaceae and Serendipita. In recent years, the endophytic fungus S. indica in plant roots has received a great deal of attention due to its wide colonization range and promoting effects on plants. According to existing data, the number of plants colonized by S. indica exceeds 200, and it has been clearly shown to have promoting effect on 24 host plants in 12 families [10,11]. The fungus is easily cultivable, lacks host specificity, and colonizes the roots of many different plants, for the most part in an endophytic manner [12]. S. indica is a kind of biological nutrient symbiotic root system that can promote plant growth [13]. It was originally isolated from the roots of a shrub in the Thar desert in northwest India by Indian scientist Verma in 1998. Studies showed that it had the ability to simulate typical arbuscular mycorrhizal fungi (AMF) [12,14]. Colonization by S. indica has been reported to help in increasing crop yield [15,16,17], promote host plant growth, improve crop quality [18,19,20], stimulate the accumulation of plant metabolites [21], and enhance resistance to host plant stresses [22,23,24,25,26]. Since the discovery of S. indica, research into their growth-promoting effects on plants and on their ability to enhance the stress resistance of host plants has been continuously developing.
The objective of this study was to determine the influence of S. indica on the growth of Tartary buckwheat plants. The growth parameters and some physiological parameters were measured in S. indica-colonized Tartary buckwheat plants. The physiological and biochemical changes of colonized and non-colonized Tartary buckwheat of S. indica were also observed under drought conditions. In conclusion, the results of this study contribute to the elucidating the growth promoting and stress resistance mechanism of S. indica in Tartary buckwheat, and provide a foundation for the future application of S. indica in the production of Tartary buckwheat.

2. Materials and Methods

2.1. Plant Materials and Fungi Preparation

The seed liquid selection method (a method that uses clean water or various solutions with different relative densities to select seeds) is used to screen the seeds of Tartary buckwheat, remove the dried seeds, and soak the selected plump seeds in 42 °C water for 2 h before use. S. indica was propagated on solid CM medium and incubated at 28 °C for 2 weeks. For inoculation, 200 mL of CM liquid medium was supplied by S. indica with a diameter of 7.5 mm and incubated for 20 days at 28 °C and 120 rpm on a rotary shaker. For plant inoculation, pure white mycelium was collected and washed 3 times with sterile double distilled water, 2 g of S. indica mycelium was mixed with 100 mL sterilized double distilled water to produce a 2% (w/v) S. indica suspension (±1.5 × 107 spores/mL) [27]. One group was treated with freshly prepared S. indica chlamydospore suspension at a final content of 100 mL/kg soil, and the other group was treated with distilled water and used as controls [19,28]. The S. indica group and the control group have eight pots, with four plants per pot.

2.2. Microscopy and Detection of S. indica in Colonized Roots

The mixed soil was sterilized at 120 °C for 20 min with an autoclave. Soak Tartary buckwheat seeds in water, remove seed skins, disinfect them with 0.1% mercuric chloride solution for 5–10 min, rinse with sterile water after removal and set aside. After 15 days of co-cultivation, roots of S. indica treated Tartary buckwheat were collected and washed under running water to remove the attached nutrient soil, cut into 1 cm segments, soaked in 10% KOH at room temperature for 30 min, soaked in 1% HCl solution for 20 min, stained with 0.02% Trypan Blue solution for 2 h, and finally decolorized with 50% lactophenol solution for 2 h [29]. Then, roots were washed with sterile water three times. After removing the surface water with filter paper, the S. indica colonization in root segments was observed under an Olympus fluorescence microscope BX53 (Olympus, Shanghai, China).

2.3. Plant Growth-Related Parameters

After about 40 days of co-cultivation, 4 plants were taken from each pot to measure or calculate growth related parameters, such as plant height, leaf width, leaf length, petiole length, fresh and dry weight of aboveground parts, and root fresh and dry weight of both colonized and non-colonized control seedlings. Measure the height of the Tartary buckwheat plant with a line, and then measure the length of the line with a ruler to obtain the height of the plant. The following methods were used to measure leaf width, leaf length, and petiole length. Leaf width was measured at the widest part of the Tartary buckwheat leaf. The distance from tip to petiole was the length of the leaf. The fresh weight of Tartary buckwheat overground parts and roots were weighed using an MTQ300 electronic scale (Meilun, Shenzhen, China). The plant samples were dried to constant weight in an oven at 80 °C and weighed using an MTQ300 electronic scale (Meilun, Shenzhen, China) to obtain the dry weight of the plants.

2.4. Determination of Chlorophyll and Photosynthesis Parameters

The contents of chlorophyll A, chlorophyll B, total chlorophyll in leaves of S. indica-colonized and non-colonized control seedlings were determined. Clean fresh plant leaves and absorb surface moisture. Grind them into powder with liquid nitrogen under dark conditions. Soak 0.1 g of plant leaf samples in 5 mL of acetone–ethanol mixed extracting solution (acetone/ethanol = 2:1, v/v) and in dark for more than 3 h until the leaves completely turn white. Then, centrifuge the supernatant and use the blank extract solution as the control. With absorbance at 663, 645 nm wavelengths was determined using a V-1100D spectrophotometer (MAPADA, Jinan, China). The concentrations of various pigments were calculated from the absorbance values using the same equations described by Arnon [30].
The fluorescence imaging system GFS-3000 (WALZ, Nuremberg, Germany) was used to measure the transpiration rate (Tr), stomatal conductance (Gs), intercellular CO2 concentration (Ci), and net photosynthetic rate (Pn) of plants colonized and non-colonized by S. indica. Three plants were tested for each treatment, and one well-grown leaf from the same location was selected for each plant.

2.5. Determination of Total Phenols and Flavonoids Content

To determine the total phenolic content of both S. indica-colonized and non-colonized Tartary buckwheat leaves, 0.1 g of leaf sample was taken, and the leaves were extracted with 2 mL of 60% ethanol. After vortex mixing, they were extracted at 60 °C for 30 min and centrifuged at 4000 rpm for 10 min to collect the supernatant. Then, the total phenolic content of Tartary buckwheat leaves was determined using a plant total phenolic test kit (colorimetric method) (Nanjing Jiancheng Bioengineering Institute, Nanjing, China) and an enzyme-labeled instrument, Multiskan SkyHigh 500C (ThermoFisher Scientific, Shanghai, China). For each parameter, three replications were made.
Firstly, extract total flavonoids from Tartary buckwheat leaves and seeds. Weigh 0.1 g of sample powder with dry weight, add 5 mL of 70% ethanol at 40 °C to a water bath for ultrasonic treatment for 2 h, centrifuge at 12,000 rpm for 5 min to collect the supernatant, add Petroleum ether for fractionation, collect the lower liquid, repeatedly extract until the upper Petroleum ether is clarified, and pass through a 0.45 nm filter membrane to obtain total flavonoids. Then, the total flavonoid content was determined using the AlCl3 colorimetric method [31]. Take 0.1 mL of flavonoid sample, add 2 mL of AlCl3 solution, mix well, and let stand for 10 min. Add 3 mL of KOAc solution and dilute to 10 mL with 70% ethanol. After mixing, let stand at room temperature for 30 min for testing. Measure the absorbance of each sample at a wavelength of 420 nm. Compare the standard curve of rutin and calculate the total flavonoid content.

2.6. Drought Treatment and Stomatal Response Analysis of Tartary Buckwheat

After the co-cultivation of S. indica and Tartary buckwheat for 30 days, both colonized and non-colonized Tartary buckwheat plants were subjected to natural drought treatment until their leaves wilted. After treatment, it was divided into four groups: (1) non-drought treatment (control) and non-colonized (CK) groups; (2) non-drought treatment (control) and colonized (P+) groups; (3) drought treatment (drought) and non-colonized (CK) groups; (4) drought treatment (drought) and colonized (P+) groups. (Stomatal density (number/m2) = number of stoma/image area).
Apply transparent nail polish on the leaf epidermis of Tartary buckwheat at the same position, and then place the nail polish transfer film on the slide. Observe the stomatal density and opening/closing of leaves under a microscope.

2.7. Detection of IAA Content in S. indica

The potency of culturable endophytic fungi as an IAA producer was determined according to the method described by [32] with minor modifications. Inoculate S. indica into king B culture medium containing and without tryptophan for seven days. Take 2 mL of bacterial solution at 12,000 rpm and centrifuge for 15 min. Take 1 mL of supernatant and add an equal amount of PC colorimetric solution. React in the dark for 30 min and observe color changes.

2.8. Determination of Antioxidant Enzyme Activity and Antioxidant-Related Molecular Content

To determine the antioxidant enzyme activity and antioxidant-related molecules content of both colonized and non-colonized Tartary buckwheat leaves, 0.1 g of fresh plant leaves were taken, and 9 times the volume of physiological saline was added. 10% tissue homogenate was prepared under ice bath conditions and centrifuged at 3500 rpm for 10 min, and the supernatant was taken for testing. The activity of antioxidant enzymes SOD, CAT, GSH-Px, and POD in Tartary buckwheat leaves, as well as the content of MDA, Pro, H2O2, GSH, SS, and SP, were measured using the relevant reagent kit from Nanjing Jiancheng Bioengineering Institute (Nanjing, China). For each parameter, three replications were made.

2.9. RNA Isolation and Quantitative RT-PCR Analysis

Total RNA was extracted from 50 mg of frozen plant samples using a FastPure Universal Plant Total RNA Isolation Kit (Vazyme, Nanjing, China) according to the manufacturer’s protocol. RNA was used to synthesize complementary (c) DNA using a PrimeScript™ RT reagent Kit with gDNA Eraser (Takara Bio Inc., Shiga, Japan) based on the manufacturer’s instructions. With TB Green ™ Premix Ex Taq ™ II (Tli RNaseH Plus) (Takara Bio Inc., Shiga, Japan), use gene specific primers to amplify genes according to the manufacturer’s instructions.
The real-time quantitative (qRT)-PCR amplification program consisted of 1 cycle at 95 °C for 3 min, followed by 39 cycles of 95 °C for 10 s, and 56 °C for 30 s, and the gene expressions were calculated by 2−ΔΔct method. To normalize the gene transcript level, the Tartary buckwheat FtCACS gene was co-amplified as a reference gene. The gene-specific primers are shown in Table 1.

2.10. Analysis of Plant Hormone Metabolism Pathway

Take 1 g of fresh Tartary buckwheat roots, stems, and leaves, both colonized and non-colonized by S. indica, wash them with double distributed water, dry them, centrifuge them in a suitable size, freeze them in liquid nitrogen for 5–10 min, and store them in a refrigerator at −80 °C. The preserved samples were sent to METWARE Biotechnology Company (Wuhan, China) for plant hormone related metabolic analysis using LC-MS/MS. Plant hormone correlation analysis mainly measured the content of IAA, ACC, ABA, GA, JA, and SA hormones in the roots, stems, and leaves of S. indica-colonized and non-colonized buckwheat plants.

2.11. Statistical Analyses

All graphs were created, and statistical calculations were performed using GraphPad Prism 8.0. The significance of the data obtained was checked by Student’s t-test using the program IBM SPSS Statistics 26. Data are means of at least three independent biological repeats with standard errors.

3. Results

3.1. Detection of S. indica Colonization and Growth Changes of Tartary Buckwheat

S. indica colonization in Tartary buckwheat roots was detected by observing root sections under a microscope after trypan blue staining. After 15 days of co-cultivation of Tartary buckwheat and S. indica, the spores and mycelium of S. indica can be observed in the roots of Tartary buckwheat (Figure 1). This indicates that S. indica can colonize Tartary buckwheat plants, and that the S. indica-colonized seedlings were used in further experiments.
After 40 days of co-cultivation, the phenotypes of S. indica-colonized and non-colonized Tartary buckwheat plants were measured. The colonization of S. indica not only significantly increased the aboveground fresh weight of Tartary buckwheat (p < 0.01), but also extremely significantly improved other growth indicators (p < 0.001) (Figure 2, Table 2). In addition, weighing the mature seeds of S. indica-colonized and non-colonized Tartary buckwheat revealed a significant increase in the hundred-grain weight of S. indica-colonized Tartary buckwheat seeds (p < 0.01) (Table 2). Colonization by S. indica promotes the overall growth of Tartary buckwheat plants.

3.2. Effects of S. indica on Photosynthetic Pigments and Cellular Respiration of Tartary Buckwheat

Photosynthesis is the main method of plant organic matter accumulation. Chlorophyll plays an important role in photosynthesis, such as providing oxygen and converting light energy. Therefore, we measured the chlorophyll content and cellular respiration related parameters of Tartary buckwheat plants colonized and non-colonized by S. indica. The total chlorophyll content, chlorophyll A, and chlorophyll B of Tartary buckwheat colonized seedlings by S. indica were extremely significantly higher than the control group (p < 0.001), with increases of 56.14%, 37.23%, and 51.15%, respectively (Figure 3A). The photosynthetic pigments content in leaves of the two groups was significantly different, and the related parameters of cellular respiration were further determined for the Tartary buckwheat leaves.
Plants undergo photosynthesis under light and absorb CO2 through their stomata, so the stomata must open. However, the opening of stomata inevitably leads to transpiration, and the stomata can adjust the size of the opening according to changes in environmental conditions, allowing plants to obtain the most CO2 under less water-loss conditions. S. indica colonization significantly increased transpiration rate (Tr) (Figure 3B) and stomatal conductance (Gs) (Figure 3C) (p < 0.01), increasing by 122.68% and 133.45%, respectively. There was a difference in net photosynthetic rate (Pn) (Figure 3D) (p < 0.05), but it was not significant, increasing by 68.85%. The intercellular CO2 concentration (Ci) slightly increased to 4.61% (Figure 3E).

3.3. Effect of S. indica on Plant Hormone Content of Tartary Buckwheat

In order to understand the growth promoting mechanism of S. indica colonization on the root system of Tartary buckwheat, we measured the content of different plant hormone in the root, stem and leaf of Tartary buckwheat. The results showed that after the colonization of S. indica, the IAA in the roots, stems, and leaves of Tartary buckwheat plants significantly increased, which were 10.6-fold, 1.7-fold, and 1.5-fold higher than the control group, respectively (Figure 4). The evaluation of the growth promoting function of S. indica revealed that they can produce IAA. ACC is an important precursor for ethylene synthesis. The ACC content in the roots, stems, and leaves of S. indica colonization was 2.7-fold, 2.3-fold, and 1.1-fold higher than that of the control group (Figure 4). IAA and ACC have a synergistic effect and can jointly regulate plant growth and development [33]. The colonization of S. indica significantly increased the IAA and ACC content of Tartary buckwheat, promoting their growth. Meanwhile, in the roots of Tartary buckwheat colonized by S. indica, the content of ABA and JA increased, while the content of GA and SA decreased. In the stem, the content of ABA and SA increased, while the content of GA and JA decreased, and in the leaves, the content of ABA, JA, and SA increased, while the content of GA decreased (Figure 4).

3.4. Effect of S. indica on the Synthesis of Auxin in Tartary Buckwheat

IAA is the main form of plant auxin and plays multiple roles in plant growth and development. It mediates the elongation of stem and root growth, the enlargement of fruits and tubers, and the promotion of cell division, through regulating cell division, expansion, differentiation, and patterning [34]. IAA is the best-studied naturally occurring active auxin. IAA biosynthesis can occur through two major routes: tryptophan (Trp)-dependent and Trp-independent pathways [35]. The classification and enrichment analysis results of KEGG pathway types with significantly different metabolites showed that the colonization of Tartary buckwheat by S. indica affected tryptophan metabolism, Plant hormone signal transduction and other pathways (Figure 5A). Among Trp-dependent pathways, the IPyA pathway is the main contributor to IAA and the only pathway in which every step from Trp to IAA has been identified [36].
S. indica themselves can produce IAA. And after the being colonized by S. indica, the IAA content in the roots, stems, and leaves of Tartary buckwheat also showed an upward trend. In order to understand the reason for the increase in IAA content in Tartary buckwheat after the colonization of S. indica, we measured the expression level of genes related to the IAA synthesis pathway in Tartary buckwheat leaves. We quantitatively analyzed the NIT, AMI1, and YUCCA genes in the IPyA pathway of leaves of S. indica-colonized and non-colonized Tartary buckwheat. At the same time, we also quantitatively analyzed the ARF2 gene that controls leaf senescence and fruit development [37]. The results showed that the colonization of Tartary buckwheat with S. indica significantly increased the expression levels of NIT, AMI1, YUCCA, and ARF2 genes (p < 0.01) ((Figure 5B).

3.5. Effects of S. indica on Metabolites of Tartary Buckwheat

The KEGG enrichment analysis of significant difference metabolites showed that the colonization of S. indica affected the synthesis of secondary metabolites and other metabolic pathways of Tartary buckwheat (Figure 5A). So, we measured the soluble sugar (Figure 6A) and soluble protein (Figure 6B) content of S. indica-colonized and non-colonized Tartary buckwheat. The colonization of Tartary buckwheat by S. indica significantly increased the soluble sugar content in the leaves of Tartary buckwheat (p < 0.01); the soluble protein content also increased (p < 0.05). At the same time, due to the rich content of flavonoids (Figure 6D) and phenolic (Figure 6C) substances in Tartary buckwheat [38], we also measured the total flavonoids and total phenols content of the leaves and seeds of S. indica-colonized and non-colonized Tartary buckwheat. The results showed that the total flavonoid and total phenolic contents in the leaves and seeds of Tartary buckwheat extremely significantly increased after colonization by S. indica (p < 0.001).

3.6. Effects of S. indica Colonization on the Antioxidant System of Tartary Buckwheat under Drought Stress

Flavonoids are synthesized and accumulate in a variety of tissues in many plant species and can help to protect against various stresses [39]. The colonization of Tartary buckwheat by S. indica significantly increased the total flavonoid content in its leaves. Therefore, we subjected S. indica-colonized and non-colonized Tartary buckwheat plants to drought stress. Under natural drought conditions, the overall phenotype of S. indica-colonized Tartary buckwheat is better than that of non-colonized plants (Figure 7A).
Observing the number and opening/closing of stomata under normal growth and drought conditions, the results showed that within the same field of view, the air density and opening and closing of Tartary buckwheat leaves were different (Figure 7). The results showed that the S. indica significantly increased the stomatal densities of Tartary buckwheat leaves under both normal and drought conditions (Figure 7F). When facing drought, plants reduce water transpiration by adjusting the stomatal opening/closing state on the surface of their leaves. The S. indica colonization of Tartary buckwheat increased the number of stomata per unit area of Tartary buckwheat leaves, allowing Tartary buckwheat to reduce water loss and cope with drought stress by regulating stomata.
We further measured the activity of a series of antioxidant enzymes and the content of antioxidant related molecules in the leaves of S. indica-colonized and non-colonized Tartary buckwheat under drought stress. At the same time, quantitative analysis was conducted on genes related to antioxidant activity. Regardless of the conditions, the colonization of S. indica significantly increased the GSH content (Figure 8A) and decreased the H2O2 content in Tartary buckwheat leaves (Figure 8B) (p < 0.001). The MDA content of S. indica-colonized Tartary buckwheat extremely significantly decreased under drought conditions (p < 0.001), and even under non drought conditions, the MDA content in the leaves also decreased (p < 0.05) (Figure 8C). The content of plant osmoregulation factor Pro extremely significantly increased under drought conditions (p < 0.001). Under normal conditions without drought, the colonization of S. indica also led to an increase in Pro content in Tartary buckwheat plants (p < 0.05) (Figure 8D).
Under drought conditions, the colonization of Tartary buckwheat by S. indica extremely significantly increased the activities of antioxidant enzymes GSH-Px, CAT, SOD, and POD in the leaves of Tartary buckwheat (p < 0.001). Under normal conditions without drought, GSH-Px activity extremely significantly decreased (p < 0.001), CAT activity increased (p < 0.05), SOD activity extremely significantly increased (p < 0.001), and POD activity significantly increased (p < 0.01) (Figure 9A–D). The results of gene quantitative analysis showed that the colonization of Tartary buckwheat by S. indica increased the expression levels of FtSOD1 and FtPOD1 genes in the leaves of Tartary buckwheat (p < 0.05); The expression levels of FtSOD2 and FtP5CS genes significantly increased (p < 0.01); The expression level of the FtCAT gene extremely significantly increased (p < 0.001) (Figure 9E).

4. Discussion

Crops are colonized by complex microbial communities, and some of them are detrimental and cause diseases, whereas others promote plant growth and enhance nutrient acquisition as well as tolerance to biotic and abiotic stresses via a multitude of mechanisms [40]. Root-symbiotic microbes can improve nutrient uptake, plant biomass and yield, and may enhance tolerance of host plants to various environmental stresses [40,41]. Tartary buckwheat, as one of the main food crops, encounters a series of problems, such as poor soil quality, during its cultivation. As an efficient and harmless endophytic fungus, S. indica can be effectively used to solve the problems encountered in the cultivation of Tartary buckwheat.
It was proved that the plant-growth promoting effect of S. indica was achieved by increasing the length and number of roots [18,42]). Previous research has also shown that colonization of S. indica can increase the root length, root area, and root weight of plants such as strawberries [15], bananas [28], and longans [20]. While favorable effects of the root-endophytic fungus S. indica on a wide range of plant species has been reported, we demonstrated its potential plant-growth promoting effect on Tartary buckwheat. The results of this study showed that S. indica-colonized the roots of Tartary buckwheat, increasing the biomass of Tartary buckwheat roots (Table 2). This result indicates that S. indica colonization has a promoting effect on the growth of Tartary buckwheat plant roots. The roots have functions such as uptake, support, and storage. S. indica indirectly promoted the growth of Tartary buckwheat plants by promoting the growth of roots, and also have a strong promoting effect on the aboveground parts of Tartary buckwheat (Figure 2, Table 2).
The leaves of plants are the specialized organs for capturing light energy, which is used to support photosynthesis. During this process, the carbon dioxide in the atmosphere is incorporated into the organic compounds of plants, which in turn promotes plant growth [43]. Research shows that S. indica promotes the leaf enlargement of Tartary buckwheat (Figure 2), thus promoting plant photosynthesis. S. indica can promote the increase in photosynthetic pigment content in its host plants, enhance photosynthesis, and ultimately enhance plant growth [15,16]. We further measured the photosynthetic pigment content of S. indica-colonized and non-colonized Tartary buckwheat and found that S. indica-colonized Tartary buckwheat extremely significantly increased the chlorophyll A, chlorophyll B, and total chlorophyll content of Tartary buckwheat plants (Figure 3A). These promoting effects on chlorophyll may be due to the enhanced nutrient uptake and transportation of S. indica colonization roots. In parallel, we also measured the relevant parameters of cellular respiration, and found that the colonization of S. indica also improved the photosynthetic capacity of Tartary buckwheat (Figure 3). Elevated cellular respiration can increase the accumulation of dry matter in Tartary buckwheat, thereby promoting the growth of Tartary buckwheat.
Endogenous plant hormones play an important role in regulating plant growth and root development. IAA is a key regulator of growth, playing multiple roles in almost every aspect of plant growth and development, and is linked to the establishment of a symbiotic relationship between the endophyte and the plant [44]. S. indica has been shown to promote plant growth by stimulating the synthesis of host plant IAA [45,46]. However, it has been also pointed out that the endophytic fungus S. indica in plant roots has different effects on the synthesis of IAA and related genes expression in different host plants [47]. Therefore, we assessed the change in plant hormone content in Tartary buckwheat colonized by S. indica. Before this, we found that S. indica have the ability to produce IAA (Figure 4A). It was found that IAA levels were increased in the roots, stems, and leaves of Tartary buckwheat plants colonized by S. indica (Figure 4B). Ethylene precursor substances, ACC and IAA, can interact synergistically or antagonistically, controlling various plant developmental processes, including root formation and hypocotyl elongation [33]. The colonization of Tartary buckwheat by S. indica resulted in an increase in both the content of IAA and ACC in its root, which may also be used to explain the increase in Tartary buckwheat’s root system. In addition, we tested the expression levels of the IAA-synthesis-related genes. Here, significant increases were observed in the expression of NIT, AMI1, and YUCCA (Figure 5B). While simultaneously measuring the ARF2 gene related to plant growth and fruit development, the expression level of ARF2 was found to be significantly increased as well (Figure 5B). Our results showed that the colonization of S. indica in Tartary buckwheat promoted the growth of Tartary buckwheat plants by stimulating the biosynthesis of IAA as well as the expression of genes related to synthesis pathway.
Plant hormones have also been shown to have a regulatory effect on flavonoid biosynthesis, the content of flavonoid in Arabidopsis roots is increased by IAA as well as by ACC [48]. This study found that change fold of IAA and ACC were increased in the roots, indicating that the colonization of Tartary buckwheat by S. indica resulted to an increase in the content of IAA and ACC. Indeed, the colonization of S. indica promoted the content of total flavonoids and total phenols in the leaves and seeds of Tartary buckwheat (Figure 6), respectively. Flavonoids such as anthocyanidin are considered as active oxygen scavengers, which play an anti-inflammatory role in plant biologic and abiotic stress [49]. The biosynthesis of anthocyanin in Arabidopsis thaliana is affected by other growth regulators, such as ABA (abscisic acid), GA3 (gibberellic acid), and JA (jasmonic acid) [50]. GA has been shown to inhibit the biosynthesis of flavonoids in Arabidopsis thaliana [51]. JA has an inducing effect on anthocyanin synthesis in various plants [52]. ABA is known to be involved in numerous stress-adaptation processes, including the promotion of anthocyanin biosynthesis [53]. Studies have found that the level of JA in host roots responded differently to root colonization by S. indica [54]. In this study, the change fold of ABA and JA due to the S. indica colonization of Tartary buckwheat significantly increased, indicating that S. indica colonization promoted the synthesis of flavonoids such as anthocyanins in Tartary buckwheat roots (Figure 4). It is impossible that the accumulation of higher flavonoid in leaves may help Tartary buckwheat to withstand stress, thus promoting the growth of Tartary buckwheat.
Our research results show that colonization of S. indica can increase the chlorophyll content and promote photosynthesis in Tartary buckwheat leaves (Figure 3). Photosynthesis is the main way of material accumulation [43]. Soluble sugars are the basis of plant metabolism and an important energy source during plant growth and development. They can provide energy and metabolic intermediate for plant growth and development, promote the germination of plant seed, and promote early seedling development. As well as being an important regulator of plant growth, development and gene expression, as a small molecular organic compound, soluble sugar is major solute involved in regulating the osmotic pressure in plant cells. Plants subjected to osmotic stress will actively accumulate solutes in order to reduce osmotic potential and resist damage caused by stresses. It can regulate processes such as plant aging, leaf formation, and fruit ripening [55,56]. The colonization of S. indica into Tartary buckwheat resulted in an increase in the content of soluble sugar in the leaves (Figure 6A), enhanced the stress resistance and promoted the growth of Tartary buckwheat plants. Meanwhile, previous studies have shown that soluble sugars can enhance the rooting ability of plants [57], which is consistent with the results of our research. The colonization of S. indica in Tartary buckwheat increased the dry weight of roots (Table 2). Soluble proteins are important nutrients and osmoregulatory substances, and their accumulation can improve the water holding capacity of cells, protect the vital substances and biofilms of cells, and is often used as one of the indicators for screening resistance [58]. Plants under stress can participate in balancing the osmotic potential of pants and in reducing the harm caused by stress to the plant. Both low temperature and poor water quality may both stress the production of soluble proteins. The colonization of S. indica in Tartary buckwheat extremely significantly increased the content of soluble protein in the leaves (Figure 6B), enhancing the stress resistance of the Tartary buckwheat.
Numerous studies have been carried out on the resistance of S. indica. The S. indica colonization of Gerbera jamesonii enhances its salt tolerance by reducing oxidative damage and increasing the activity of antioxidant enzymes [20]. The colonization of onion by S. indica can elevate its antioxidant enzyme activity and induce the expression of defense-related genes to resist foliar blight disease [24]. The results of this study indicate that S. indica enhance the drought resistance of Tartary buckwheat plants in terms of overall phenotype. Under drought and normal conditions, the stomatal analysis of S. indica*colonized and non-colonized Tartary buckwheat leaves revealed that S. indica increased the number of stomata per unit area of Tartary buckwheat leaves (Figure 7F), which is beneficial for buckwheat to adjust stomatal opening and closing to cope with drought conditions.
It has been previously reported that under stress conditions, S. indica can induce increased antioxidant enzyme activity in host plants [19,59]. Due to the overall resistance of S. indica to drought (Figure 7A), we measured the antioxidant enzyme activity in the leaves of S. indica-colonized and non-colonized Tartary buckwheat plants under drought and normal conditions. In summary, the results of this study indicate that under drought stress, the colonization of S. indica in Tartary buckwheat significantly increased the GSH-Px, SOD, CAT and POD activities of Tartary buckwheat leaves (Figure 9). POD activity can used as marker and predictor of rooting performance, and the up-regulation of POD activity in S. indica-colonized Tartary buckwheat roots indicated that the fungus colonization enhanced the rooting ability [16]. Quantitative analysis of genes related to the induction of antioxidant enzyme synthesis revealed that colonization by S. indica increased gene expression and promoted antioxidant enzyme synthesis (Figure 9E).
Antioxidant enzymes can help Tartary buckwheat resist oxidative damage, so we measured several common oxidative markers. MDA is one of the indicators for measuring cytoplasmic membrane peroxidation [60]. In presence of drought stress, S. indica-colonized Tartary buckwheat reduced the MDA content of Tartary buckwheat leaves (Figure 8C). This indicates that it reduced the degree of damage to the cell membrane and protected the cell membrane from oxidative injury. Under drought stress, S. indica may protect plants by enhancing their antioxidant and free radical scavenging abilities [61]. We observed that the H2O2 content in S. indica-colonized Tartary buckwheat was significantly lower than that in the non-colonized control group (Figure 8B). The removal of H2O2 can prevent lipid peroxidation, which can explain why colonization by S. indica can reduce the MDA content of Tartary buckwheat. As we know, CAT is an H2O2 scavenger capable of catalyzing the decomposition of H2O2. Colonization by S. indica resulted in an extremely significant increase in CAT activity (Figure 9B) and elevated plant antioxidant capacity. Under drought stress, the Pro content of S. indica-colonized Tartary buckwheat extremely significantly increased (Figure 8D). As an osmotic regulator, Pro can prevent cellular dehydration and provide normal plant growth under drought conditions [62]. These results indicated that colonization by S. indica improved the drought resistance of Tartary buckwheat.
The colonization of Tartary buckwheat by S. indica reduced the content of MDA and H2O2 in the leaves of Tartary buckwheat, which in turn reduced oxidative damage (Figure 8). To prevent tarnished Tartary buckwheat from being inactivated due to drought and dehydration, the content of the osmotically regulating substance Pro has been increased (Figure 8). In addition, S. indica was found to increase the activity of antioxidant enzyme and the expression level of related genes, improved the rooting ability and antioxidant capacity of Tartary buckwheat plants, thereby promoting the growth of Tartary buckwheat (Figure 9).

5. Conclusions

Based on the results obtained in this study, we propose a preliminary model to recapitulate the growth of Tartary buckwheat colonized by S. indica (Figure 10). Firstly, S. indica can colonize Tartary buckwheat roots. Secondly, it promotes the accumulation of chlorophyll in the leaves of Tartary buckwheat, which in turn promotes its photosynthesis and increases its biomass. Thirdly, the Tartary buckwheat colonized by S. indica also regulates the plant hormone metabolic pathway, stimulates the synthesis of IAA and the ethylene precursor ACC, and promotes the growth of Tartary buckwheat. In addition, the colonization by S. indica promotes the accumulation of soluble sugars, soluble proteins, total flavonoids, and total phenols in Tartary buckwheat, thereby improving its stress resistance. At the same time, the S. indica colonization of Tartary buckwheat reduces the content of MDA and H2O2 in leaves, and increases the content of Pro and the activity of antioxidant enzymes, increasing the systemic resistance of Tartary buckwheat and ultimately promoting the growth of the entire plant.

Author Contributions

Conceptualization, Q.L. and M.Z.; methodology, M.Z.; validation, M.Z., S.Z. and W.W.; formal analysis, M.Z.; investigation, Z.T.; resources, Q.L.; data curation, M.Z.; writing—original draft preparation, M.Z.; writing—Review and Editing, Q.L.; supervision, T.B.; project administration, Q.L. All authors have read and agreed to the published version of the manuscript.

Funding

This study was funded by Natural Science Foundation of Sichuan Province (grant no. 2023NSFSC1226).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Data are contained within the article.

Acknowledgments

Thank you to Shaoshuai Liu (Beijing Academy of Agricultural and Forestry Sciences, Beijing, China) for donating the Serendipita indica strain and Chenglei Li (Sichuan Agricultural University, Sichuan, China) for providing the Tartary buckwheat seeds.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Wang, H.; Chen, R.F.; Iwashita, T.; Shen, R.F.; Ma, J.F. Physiological characterization of aluminum tolerance and accumulation in tartary and wild buckwheat. New Phytol. 2015, 205, 273–279. [Google Scholar] [CrossRef]
  2. Nishimura, M.; Ohkawara, T.; Sato, Y.; Satoh, H.; Suzuki, T.; Ishiguro, K.; Noda, T.; Morishita, T.; Nishihira, J. Effectiveness of rutin-rich Tartary buckwheat (Fagopyrum tataricum Gaertn.) ’Manten-Kirari’ in body weight reduction related to its antioxidant properties: A randomised, double-blind, placebo-controlled study. J. Funct. Foods 2016, 26, 460–469. [Google Scholar] [CrossRef]
  3. Huda, M.N.; Lu, S.; Jahan, T.; Ding, M.Q.; Jha, R.; Zhang, K.X.; Zhang, W.; Georgiev, M.I.; Park, S.U.; Zhou, M.L. Treasure from garden: Bioactive compounds of buckwheat. Food Chem. 2021, 335, 127653. [Google Scholar] [CrossRef] [PubMed]
  4. Zhu, F. Chemical composition and health effects of Tartary buckwheat. Food Chem. 2016, 203, 231–245. [Google Scholar] [CrossRef]
  5. Song, Y.J.; Jarvis, D.I.; Bai, K.Y.; Feng, J.C.; Long, C.L. Assessment of the Resilience of a Tartary Buckwheat (Fagopyrum tataricum) Cultivation System in Meigu, Southwest China. Sustainability 2020, 12, 5683. [Google Scholar] [CrossRef]
  6. Liu, X.Y.; Zhu, X.S.; Dong, Y.M.; Chen, Y.; Li, M.F.; Li, C.Y. Limited Impact of Soil Microorganisms on the Endophytic Bacteria of Tartary Buckwheat (Fagopyrum tataricum). Microorganisms 2023, 11, 2085. [Google Scholar] [CrossRef] [PubMed]
  7. Zhong, L.Y.; Niu, B.; Tang, L.; Chen, F.; Zhao, G.; Zhao, J.L. Effects of Polysaccharide Elicitors from Endophytic Fat9 on the Growth, Flavonoid Accumulation and Antioxidant Property of Sprout Cultures. Molecules 2016, 21, 1590. [Google Scholar] [CrossRef]
  8. Zhao, J.L.; Xiang, D.B.; Peng, L.X.; Zou, L.; Wang, Y.H.; Zhao, G. Enhancement of Rutin Production in Hairy Root Cultures with Its Endophytic Fungal Elicitors. Prep. Biochem. Biotech. 2014, 44, 782–794. [Google Scholar] [CrossRef]
  9. Weiss, M.; Waller, F.; Zuccaro, A.; Selosse, M.A. Sebacinales—One thousand and one interactions with land plants. New Phytol. 2016, 211, 20–40. [Google Scholar] [CrossRef]
  10. Sherameti, I.; Shahollari, B.; Venus, Y.; Altschmied, L.; Varma, A.; Oelmuller, R. The endophytic fungus Piriformospora indica stimulates the expression of nitrate reductase and the starch-degrading enzyme glucan-water dikinase in tobacco and Arabidopsis roots through a homeodomain transcription factor that binds to a conserved motif in their promoters. J. Biol. Chem. 2005, 280, 26241–26247. [Google Scholar]
  11. Franken, P. The plant strengthening root endophyte Piriformospora indica: Potential application and the biology behind. Appl. Microbiol. Biotechnol. 2012, 96, 1455–1464. [Google Scholar] [CrossRef] [PubMed]
  12. Varma, A.; Bakshi, M.; Lou, B.; Hartmann, A.; Oelmueller, R. Piriformospora indica: A Novel Plant Growth-Promoting Mycorrhizal Fungus. Agric. Res. 2012, 1, 117–131. [Google Scholar] [CrossRef]
  13. Varma, A.; Savita, V.; Sudha; Sahay, N.; Butehorn, B.; Franken, P. Piriformospora indica, a cultivable plant-growth-promoting root endophyte. Appl. Environ. Microbiol. 1999, 65, 2741–2744. [Google Scholar] [CrossRef] [PubMed]
  14. Gill, S.S.; Gill, R.; Trivedi, D.K.; Anjum, N.A.; Sharma, K.K.; Ansari, M.W.; Ansari, A.A.; Johri, A.K.; Prasad, R.; Pereira, E.; et al. Piriformospora indica: Potential and Significance in Plant Stress Tolerance. Front. Microbiol. 2016, 7, 332. [Google Scholar] [CrossRef] [PubMed]
  15. Liu, W.; Tan, M.; Qu, P.Y.; Huo, C.S.; Liang, W.J.; Li, R.L.; Jia, Y.; Fan, X.P.; Cheng, C.Z. Use of Piriformospora indica to Promote Growth of Strawberry Daughter Plants. Horticulturae 2022, 8, 370. [Google Scholar] [CrossRef]
  16. Cheng, C.Z.; Li, D.; Wang, B.; Liao, B.; Qu, P.Y.; Liu, W.; Zhang, Y.Y.; Lü, P.T. Piriformospora indica colonization promotes the root growth of Dimocarpus longan seedlings. Sci. Hortic. 2022, 301, 11137. [Google Scholar] [CrossRef]
  17. Fakhro, A.; Andrade-Linares, D.R.; von Bargen, S.; Bandte, M.; Büttner, C.; Grosch, R.; Schwarz, D.; Franken, P. Impact of Piriformospora indica on tomato growth and on interaction with fungal and viral pathogens. Mycorrhiza 2010, 20, 191–200. [Google Scholar] [CrossRef]
  18. Su, Z.Z.; Wang, T.; Shrivastava, N.; Chen, Y.Y.; Liu, X.X.; Sun, C.; Yin, Y.F.; Gao, Q.K.; Lou, B.G. Piriformospora indica promotes growth, seed yield and quality of Brassica napus L. Microbiol. Res. 2017, 199, 29–39. [Google Scholar] [CrossRef]
  19. Yan, C.J.; Rizwan, H.M.; Liang, D.D.; Reichelt, M.; Mithöfer, A.; Scholz, S.S.; Oelmüller, R.; Chen, F.X. The effect of the root-colonizing on passion fruit development: Initial defense shifts to fitness benefits and fruit. Food Chem. 2021, 359, 129671. [Google Scholar] [CrossRef]
  20. Chen, W.T.; Lin, F.Z.; Lin, K.H.; Chen, C.M.; Xia, C.S.; Liao, Q.L.; Chen, S.P.; Kuo, Y.W. Growth Promotion and Salt-Tolerance Improvement of Gerbera jamesonii by Root Colonization of Piriformospora indica. J. Plant Growth Regul. 2022, 41, 1219–1228. [Google Scholar] [CrossRef]
  21. Strehmel, N.; Monchgesang, S.; Herklotz, S.; Kruger, S.; Ziegler, J.; Scheel, D. Piriformospora indica Stimulates Root Metabolism of Arabidopsis thaliana. Int. J. Mol. Sci. 2016, 17, 1091. [Google Scholar] [CrossRef] [PubMed]
  22. Ghaffari, M.R.; Ghabooli, M.; Khatabi, B.; Hajirezaei, M.R.; Schweizer, P.; Salekdeh, G.H. Metabolic and transcriptional response of central metabolism affected by root endophytic fungus Piriformospora indica under salinity in barley. Plant Mol. Biol. 2016, 90, 699–717. [Google Scholar] [CrossRef] [PubMed]
  23. Yaghoubian, Y.; Goltapeh, E.M.; Pirdashti, H.; Esfandiari, E.; Feiziasl, V.; Dolatabadi, H.K.; Varma, A.; Hassim, M.H. Effect of Glomus mosseae and Piriformospora indica on Growth and Antioxidant Defense Responses of Wheat Plants Under Drought Stress. Agric. Res. 2014, 3, 239–245. [Google Scholar] [CrossRef]
  24. Roylawar, P.; Khandagale, K.; Randive, P.; Shinde, B.; Murumkar, C.; Ade, A.; Singh, M.; Gawande, S.; Morelli, M. Piriformospora indica Primes Onion Response against Stemphylium Leaf Blight Disease. Pathogens 2021, 10, 1085. [Google Scholar] [CrossRef] [PubMed]
  25. Khalvandi, M.; Amerian, M.; Pirdashti, H.; Keramati, S. Does co-inoculation of mycorrhiza and fungi enhance the efficiency of chlorophyll fluorescence and essential oil composition in peppermint under irrigation with saline water from the Caspian Sea? PLoS ONE 2021, 16, e0254076. [Google Scholar] [CrossRef]
  26. Rahman, S.U.; Khalid, M.; Kayani, S.I.; Tang, K. The ameliorative effects of exogenous inoculation of Piriformospora indica on molecular, biochemical and physiological parameters of Artemisia annua L. under arsenic stress condition. Ecotoxicol. Environ. Saf. 2020, 206, 111202. [Google Scholar] [CrossRef]
  27. Abdelaziz, M.E.; Abdelsattar, M.; Abdeldaym, E.A.; Atia, M.A.M.; Mahmoud, A.W.M.; Saad, M.M.; Hirt, H. Piriformospora indica alters Na+/K+ homeostasis, antioxidant enzymes and LeNHX1 expression of greenhouse tomato grown under salt stress. Sci. Hortic. 2019, 256, 108532. [Google Scholar] [CrossRef]
  28. Li, D.; Mensah, R.A.; Liu, F.; Tian, N.; Qi, Q.; Yeh, K.W.; Xu, X.H.; Cheng, C.Z.; Lai, Z.X. Effects of Piriformospora indica on rooting and growth of tissue-cultured banana (Musa acuminata cv. Tianbaojiao) seedlings. Sci. Hortic. 2019, 257, 108649. [Google Scholar] [CrossRef]
  29. Rai, M.; Acharya, D.; Singh, A.; Varma, A. Positive growth responses of the medicinal plants Spilanthes calva and Withania somnifera to inoculation by Piriformospora indica in a field trial. Mycorrhiza 2001, 11, 123–128. [Google Scholar] [CrossRef]
  30. Arnon, D.I. Copper Enzymes in Isolated Chloroplasts. Polyphenoloxidase in Beta Vulgaris. Plant Physiol. 1949, 24, 1–15. [Google Scholar] [CrossRef]
  31. Chang, C.C.; Yang, M.H.; Wen, H.M.; Chern, J.C. Estimation of total flavonoid content in propolis by two complementary colometric methods. J. Food Drug Anal. 2002, 10, 3. [Google Scholar] [CrossRef]
  32. Khalil, A.M.A.; Hassan, S.E.D.; Alsharif, S.M.; Eid, A.M.; Ewais, E.E.D.; Azab, E.; Gobouri, A.A.; Elkelish, A.; Fouda, A. Isolation and Characterization of Fungal Endophytes Isolated from Medicinal Plant as Plant Growth-Promoting. Biomolecules 2021, 11, 140. [Google Scholar] [CrossRef] [PubMed]
  33. Liu, M.C.; Chen, Y.; Chen, Y.; Shin, J.H.; Mila, I.; Audran, C.; Zouine, M.; Pirrello, J.; Bouzayen, M. The tomato Ethylene Response Factor Sl-ERF.B3 integrates ethylene and auxin signaling via direct regulation of Sl-Aux/IAA27. New Phytol. 2018, 219, 631–640. [Google Scholar] [CrossRef]
  34. Yang, F.; Zhang, X.X.; Tian, R.F.; Zhu, L.W.; Liu, F.; Chen, Q.F.; Shi, X.J.; Huo, D.A. Genome-Wide Analysis of the Auxin/Indoleacetic Acid Gene Family and Response to Indole-3-Acetic Acid Stress in Tartary Buckwheat (Fagopyrum tataricum). Int. J. Genom. 2021, 2021, 3102399. [Google Scholar] [CrossRef] [PubMed]
  35. Woodward, A.W.; Bartel, B. Auxin: Regulation, action, and interaction. Ann. Bot. 2005, 95, 707–735. [Google Scholar] [CrossRef]
  36. Korasick, D.A.; Enders, T.A.; Strader, L.C. Auxin biosynthesis and storage forms. J. Exp. Bot. 2013, 64, 2541–2555. [Google Scholar] [CrossRef]
  37. Goetz, M.; Vivian-Smith, A.; Johnson, S.D.; Koltunow, A.M. AUXIN RESPONSE FACTOR8 Is a Negative Regulator of Fruit Initiation in Arabidopsis. Plant Cell 2006, 18, 1873–1886. [Google Scholar] [CrossRef]
  38. Yang, C.; Song, L.; Wei, K.; Gao, C.; Wang, D.; Feng, M.; Zhang, M.; Wang, C.; Xiao, L.; Yang, W.; et al. Study on Hyperspectral Monitoring Model of Total Flavonoids and Total Phenols in Tartary Buckwheat Grains. Foods 2023, 12, 1354. [Google Scholar] [CrossRef]
  39. Winkel-Shirley, B. Flavonoid biosynthesis. A colorful model for genetics, biochemistry, cell biology, and biotechnology. Plant Physiol. 2001, 126, 485–493. [Google Scholar] [CrossRef]
  40. Mengistu, A.A. Endophytes: Colonization, Behaviour, and Their Role in Defense Mechanism. Int. J. Microbiol. 2020, 2020, 6927219. [Google Scholar] [CrossRef]
  41. de la Fuente Canto, C.; Simonin, M.; King, E.; Moulin, L.; Bennett, M.J.; Castrillo, G.; Laplaze, L. An extended root phenotype: The rhizosphere, its formation and impacts on plant fitness. Plant J. 2020, 103, 951–964. [Google Scholar] [CrossRef] [PubMed]
  42. Dong, S.Q.; Tian, Z.H.; Chen, P.J.; Kumar, R.S.; Shen, C.H.; Cai, D.G.; Oelmüller, R.; Yeh, K.W. The maturation zone is an important target of in Chinese cabbage roots. J. Exp. Bot. 2013, 64, 4529–4540. [Google Scholar] [CrossRef] [PubMed]
  43. Henry, R.J.; Furtado, A.; Rangan, P. Pathways of Photosynthesis in Non-Leaf Tissues. Biology 2020, 9, 438. [Google Scholar] [CrossRef] [PubMed]
  44. Tian, H.Y.; Lv, B.S.; Ding, T.T.; Bai, M.Y.; Ding, Z.J. Auxin-BR Interaction Regulates Plant Growth and Development. Front. Plant Sci. 2018, 8, 2256. [Google Scholar] [CrossRef] [PubMed]
  45. Vadassery, J.; Ritter, C.; Venus, Y.; Camehl, I.; Varma, A.; Shahollari, B.; Novak, O.; Strnad, M.; Ludwig-Müller, J.; Oelmüller, R. The role of auxins and cytokinins in the mutualistic interaction between Arabidopsis and Piriformospora indica. Mol. Plant-Microbe Interact. 2008, 21, 1371–1383. [Google Scholar] [CrossRef] [PubMed]
  46. Lin, P.C.; Lilananda, I.; Shao, K.H.; Wu, H.Y.; Wang, S.J. Role of auxin in the symbiotic relationship between Piriformospora indica and rice plants. Rhizosphere 2023, 25, 100632. [Google Scholar] [CrossRef]
  47. Sun, C.; Shao, Y.; Vahabi, K.; Sherameti, I.; Lou, B.; Yeh, K.W.; Oelmüller, R. Piriformospora indica is an efficient biocontrol agent against Verticillium dahliae wilt: Role of phytohormone signaling in the three partite interaction. Endocyt. Cell Res. 2014, 25, 9–19. [Google Scholar]
  48. Lewis, D.R.; Ramirez, M.V.; Miller, N.D.; Vallabhaneni, P.; Ray, W.K.; Helm, R.F.; Winkel, B.S.J.; Muday, G.K. Auxin and Ethylene Induce Flavonol Accumulation through Distinct Transcriptional Networks. Plant Physiol. 2011, 156, 144–164. [Google Scholar] [CrossRef]
  49. Ma, H.Y.; Yang, T.; Li, Y.; Zhang, J.; Wu, T.; Song, T.T.; Yao, Y.C.; Tian, J. The long noncoding RNA MdLNC499 bridges MdWRKY1 and MdERF109 function to regulate early-stage light-induced anthocyanin accumulation in apple fruit. Plant Cell 2021, 33, 3309–3330. [Google Scholar] [CrossRef]
  50. Loreti, E.; Povero, G.; Novi, G.; Solfanelli, C.; Alpi, A.; Perata, P. Gibberellins, jasmonate and abscisic acid modulate the sucrose-induced expression of anthocyanin biosynthetic genes in Arabidopsis. New Phytol. 2008, 179, 1004–1016. [Google Scholar] [CrossRef]
  51. Tan, H.J.; Man, C.; Xie, Y.; Yan, J.J.; Chu, J.F.; Huang, J.R. A Crucial Role of GA-Regulated Flavonol Biosynthesis in Root Growth of Arabidopsis. Mol. Plant 2019, 12, 521–537. [Google Scholar] [CrossRef] [PubMed]
  52. Shan, X.Y.; Zhang, Y.S.; Peng, W.; Wang, Z.L.; Xie, D.X. Molecular mechanism for jasmonate-induction of anthocyanin accumulation in Arabidopsis. J. Exp. Bot. 2009, 60, 3849–3860. [Google Scholar] [CrossRef] [PubMed]
  53. Naik, J.; Misra, P.; Trivedi, P.K.; Pandey, A. Molecular components associated with the regulation of flavonoid biosynthesis. Plant Sci. 2022, 317, 111196. [Google Scholar] [CrossRef]
  54. Liu, H.C.; Senthilkumar, R.; Ma, G.Y.; Zou, Q.C.; Zhu, K.Y.; Shen, X.L.; Tian, D.Q.; Hua, M.S.; Oelmüller, R.; Yeh, K.W. Piriformospora indica-induced phytohormone changes and root colonization strategies are highly host-specific. Plant Signal Behav. 2019, 14, 1632688. [Google Scholar] [CrossRef] [PubMed]
  55. Wang, H.; Gong, M.; Xin, H.; Tang, L.Z.; Dai, D.Q.; Gao, Y.; Liu, C. Effects of chilling stress on the accumulation of soluble sugars and their key enzymes in seedlings. Physiol. Mol. Biol. Plants 2018, 24, 857–865. [Google Scholar] [CrossRef]
  56. Li, W.; Meng, R.; Liu, Y.; Chen, S.; Jiang, J.; Wang, L.; Zhao, S.; Wang, Z.; Fang, W.; Chen, F.; et al. Heterografted chrysanthemums enhance salt stress tolerance by integrating reactive oxygen species, soluble sugar, and proline. Hortic. Res. 2022, 9, uhac073. [Google Scholar] [CrossRef]
  57. Zhou, W.; Qi, Z.; Chen, J.; Tan, Z.; Wang, H.; Wang, C.; Yi, Z. Rooting ability of rice seedlings increases with higher soluble sugar content from exposure to light. PLoS ONE 2020, 15, e0241060. [Google Scholar] [CrossRef]
  58. Luo, Q.; Xie, H.; Chen, Z.; Ma, Y.; Yang, H.; Yang, B.; Ma, Y. Morphology, photosynthetic physiology and biochemistry of nine herbaceous plants under water stress. Front. Plant Sci. 2023, 14, 1147208. [Google Scholar] [CrossRef]
  59. Mohd, S.; Shukla, J.; Kushwaha, A.S.; Mandrah, K.; Shankar, J.; Arjaria, N.; Saxena, P.N.; Narayan, R.; Roy, S.K.; Kumar, M. Endophytic Fungi Piriformospora indica Mediated Protection of Host from Arsenic Toxicity. Front. Microbiol. 2017, 8, 754. [Google Scholar] [CrossRef]
  60. Liu, Z.J.; Zhang, X.L.; Bai, J.G.; Suo, B.X.; Xu, P.L.; Wang, L. Exogenous paraquat changes antioxidant enzyme activities and lipid peroxidation in drought-stressed cucumber leaves. Sci. Hortic. 2009, 121, 138–143. [Google Scholar] [CrossRef]
  61. Baltruschat, H.; Fodor, J.; Harrach, B.D.; Niemczyk, E.; Barna, B.; Gullner, G.; Janeczko, A.; Kogel, K.H.; Schäfer, P.; Schwarczinger, I.; et al. Salt tolerance of barley induced by the root endophyte is associated with a strong increase in antioxidants. New Phytol. 2008, 180, 501–510. [Google Scholar] [CrossRef] [PubMed]
  62. Ozturk, M.; Unal, B.T.; García-Caparrós, P.; Khursheed, A.; Gul, A.; Hasanuzzaman, M. Osmoregulation and its actions during the drought stress in plants. Physiol. Plant. 2021, 172, 1321–1335. [Google Scholar] [CrossRef] [PubMed]
Jof 09 01114 g001
Figure 1. S. indica-colonized (A) and non-colonized (B) detection result. The red arrow represents the spores of S. indica; the yellow arrow represents the mycelium of S. indica.
Figure 1. S. indica-colonized (A) and non-colonized (B) detection result. The red arrow represents the spores of S. indica; the yellow arrow represents the mycelium of S. indica.
Jof 09 01114 g001
Jof 09 01114 g002
Figure 2. Tartary buckwheat inoculated with S. indica. (A) Control (CK) and S. indica-colonized (P+) Tartary buckwheat plants; (B) comparison of the first to seventh leaves of CK and P+ Tartary buckwheat plants.
Figure 2. Tartary buckwheat inoculated with S. indica. (A) Control (CK) and S. indica-colonized (P+) Tartary buckwheat plants; (B) comparison of the first to seventh leaves of CK and P+ Tartary buckwheat plants.
Jof 09 01114 g002
Jof 09 01114 g003
Figure 3. (A) Chlorophyll content of S. indica-colonized (P+) and non-colonized (CK) Tartary buckwheat plants; Cellular respiration parameters related to colonized (P+) and non-colonized (CK) of S. indica: (B) Transpiration rate (Tr); (C) Stomatal conductance (Gs); (D) Net photosynthetic rate (Pn); (E) Intercellular CO2 concentration (Ci). Values are presented as mean ± SD (standard deviation) of three replicates. * p < 0.05; ** p < 0.01; *** p < 0.001.
Figure 3. (A) Chlorophyll content of S. indica-colonized (P+) and non-colonized (CK) Tartary buckwheat plants; Cellular respiration parameters related to colonized (P+) and non-colonized (CK) of S. indica: (B) Transpiration rate (Tr); (C) Stomatal conductance (Gs); (D) Net photosynthetic rate (Pn); (E) Intercellular CO2 concentration (Ci). Values are presented as mean ± SD (standard deviation) of three replicates. * p < 0.05; ** p < 0.01; *** p < 0.001.
Jof 09 01114 g003
Jof 09 01114 g004
Figure 4. The change fold of plant hormone in root, stem, and leaf of Tartary buckwheat colonized and non-colonized by S. indica (The change fold refers to the multiple of hormone content in various parts of S. indica-colonized Tartary buckwheat compared to that in non-colonized Tartary buckwheat). Values are presented as mean ± SD (standard deviation) of three replicates.
Figure 4. The change fold of plant hormone in root, stem, and leaf of Tartary buckwheat colonized and non-colonized by S. indica (The change fold refers to the multiple of hormone content in various parts of S. indica-colonized Tartary buckwheat compared to that in non-colonized Tartary buckwheat). Values are presented as mean ± SD (standard deviation) of three replicates.
Jof 09 01114 g004
Jof 09 01114 g005
Figure 5. (A) Enrichment map of differential metabolite KEGG. The horizontal axis represents the Rich factor corresponding to each pathway, the vertical axis represents the pathway name, and the color of the point is p-Value. The redder points are the more significant the enrichment. The size of the point represents the number of enriched differential metabolites; (B) The expression levels of genes related to the auxin synthesis pathways in S. indica-colonized (P+) and non-colonized (CK) Tartary buckwheat. Values are presented as mean ± SD (standard deviation) of three replicates. ** p < 0.01.
Figure 5. (A) Enrichment map of differential metabolite KEGG. The horizontal axis represents the Rich factor corresponding to each pathway, the vertical axis represents the pathway name, and the color of the point is p-Value. The redder points are the more significant the enrichment. The size of the point represents the number of enriched differential metabolites; (B) The expression levels of genes related to the auxin synthesis pathways in S. indica-colonized (P+) and non-colonized (CK) Tartary buckwheat. Values are presented as mean ± SD (standard deviation) of three replicates. ** p < 0.01.
Jof 09 01114 g005
Jof 09 01114 g006
Figure 6. (A) Soluble sugar and (B) soluble protein content of S. indica-colonized (P+) and non-colonized (CK) Tartary buckwheat. The content of total phenols (C) and total flavonoids (D) in leaves and seeds of S. indica-colonized (P+) and non-colonized (CK) Tartary buckwheat. Values are presented as mean ± SD (standard deviation) of three replicates. * p < 0.05; ** p < 0.01; *** p < 0.001.
Figure 6. (A) Soluble sugar and (B) soluble protein content of S. indica-colonized (P+) and non-colonized (CK) Tartary buckwheat. The content of total phenols (C) and total flavonoids (D) in leaves and seeds of S. indica-colonized (P+) and non-colonized (CK) Tartary buckwheat. Values are presented as mean ± SD (standard deviation) of three replicates. * p < 0.05; ** p < 0.01; *** p < 0.001.
Jof 09 01114 g006
Jof 09 01114 g007
Figure 7. (A) Comparison of the overall phenotypes of S. indica-colonized (P+) and non-colonized (CK) Tartary buckwheat plants under drought stress. Under different conditions, the stomata of Tartary buckwheat leaves are: (B) without drought and S. indica-colonized; (C) no drought with S. indica-colonized; (D) drought with S. indica non-colonized; (E) drought with S. indica-colonized. (F) The stomatal densities of S. indica-colonized (P+) and non-colonized (CK) buckwheat leaves. ** p < 0.01.
Figure 7. (A) Comparison of the overall phenotypes of S. indica-colonized (P+) and non-colonized (CK) Tartary buckwheat plants under drought stress. Under different conditions, the stomata of Tartary buckwheat leaves are: (B) without drought and S. indica-colonized; (C) no drought with S. indica-colonized; (D) drought with S. indica non-colonized; (E) drought with S. indica-colonized. (F) The stomatal densities of S. indica-colonized (P+) and non-colonized (CK) buckwheat leaves. ** p < 0.01.
Jof 09 01114 g007
Jof 09 01114 g008
Figure 8. Under drought stress (drought) and normal conditions (control), the content of stress related factors in the leaves of S. indica-colonized (P+) and non-colonized (CK) Tartary buckwheat. (A) GSH content; (B) H2O2 content; (C) MDA content; (D) Pro content. Values are presented as mean ± SD (standard deviation) of three replicates. * p < 0.05; *** p < 0.001.
Figure 8. Under drought stress (drought) and normal conditions (control), the content of stress related factors in the leaves of S. indica-colonized (P+) and non-colonized (CK) Tartary buckwheat. (A) GSH content; (B) H2O2 content; (C) MDA content; (D) Pro content. Values are presented as mean ± SD (standard deviation) of three replicates. * p < 0.05; *** p < 0.001.
Jof 09 01114 g008
Jof 09 01114 g009
Figure 9. Under drought stress (D+) and normal conditions (D−), the activity of stress-related enzymes in the leaves of S. indica-colonized and non-colonized Tartary buckwheat. (A) GSH-Px activity; (B) CAT activity; (C) SOD activity; (D) POD activity. (E) Under normal conditions, the expression levels of antioxidant-related genes in the leaves of S. indica-colonized (P+) and non-colonized (CK) Tartary buckwheat. Values are presented as mean ± SD (standard deviation) of three replicates. * p < 0.05; ** p < 0.01; *** p < 0.001.
Figure 9. Under drought stress (D+) and normal conditions (D−), the activity of stress-related enzymes in the leaves of S. indica-colonized and non-colonized Tartary buckwheat. (A) GSH-Px activity; (B) CAT activity; (C) SOD activity; (D) POD activity. (E) Under normal conditions, the expression levels of antioxidant-related genes in the leaves of S. indica-colonized (P+) and non-colonized (CK) Tartary buckwheat. Values are presented as mean ± SD (standard deviation) of three replicates. * p < 0.05; ** p < 0.01; *** p < 0.001.
Jof 09 01114 g009
Jof 09 01114 g010
Figure 10. Summary diagram for the growth promoting effects of S. indica on Tartary buckwheat. Red and green arrows represent parameters induced and suppressed by S. indica colonization, respectively.
Figure 10. Summary diagram for the growth promoting effects of S. indica on Tartary buckwheat. Red and green arrows represent parameters induced and suppressed by S. indica colonization, respectively.
Jof 09 01114 g010
Table 1. Primer sequences of Tartary buckwheat-related genes.
Table 1. Primer sequences of Tartary buckwheat-related genes.
GeneSequencePrimers
FtCACSF′AAGACAGTCAGTTTCGTGCCACCTGA
R′TCCATGCGTGTTCTACCCAACTCCTT
FtAMI1F′CACGGCTTCGGCAGTTCA
R′TGGGTTTCTGGGTGTCCC
FtYUCCA10F′TTTCCCGATCACTTTCCG
R′GCCGTCGTTGTCTTAACTCT
FtNITF′CGGCCAAATCGACACTCC
R′CCACCTTTCGCTGCTTCC
FtARF2F′AGACTTGTGGCTGGTGACGCT
R′GCTAGATATGACTGACGAGGGAACT
FtCATF′GGAGGAGCAAACCACAGT
R′TTCAAGACCATCCGACCC
FtSOD1F′AAGCCGCCATTCTCACTA
R′ACAACGCCTTCAACATCG
FtSOD2F′TGAAGGCTGTAGTTGTTCTC
R′ACCCATTGGTGGTGTCCC
FtPOD1F′AACTGTGCTCCGATTATGC
R′AGCTCCTCCTGGAACCTC
FtP5CS1F′CAAGGATGTCAAGCGTAT
R′CAGCACCTGAACTCACTAAA
Table 2. Effects of S. indica on plant height, leaf length, leaf width, petiole length, aboveground part fresh and dry weight, root fresh and dry weight, and hundred-grain weight of Tartary buckwheat plants. Values marked with “*” in each row represent that the difference between samples were significant (Student’s t-test, ** p < 0.01; *** p < 0.001; n = 4).
Table 2. Effects of S. indica on plant height, leaf length, leaf width, petiole length, aboveground part fresh and dry weight, root fresh and dry weight, and hundred-grain weight of Tartary buckwheat plants. Values marked with “*” in each row represent that the difference between samples were significant (Student’s t-test, ** p < 0.01; *** p < 0.001; n = 4).
Growth ParametersControlS. indica
Plant height (cm)26.17 ± 3.4747.59 ± 3.60 ***
Leaf length (cm)2.61 ± 0.054.13 ± 0.10 ***
Leaf width (cm)2.78 ± 0.104.42 ± 0.25 ***
Petiole length (cm)2.78 ± 0.095.22 ± 0.21 ***
Aboveground part fresh weight (g)2.08 ± 0.093.06 ± 0.29 **
Aboveground part dry weight (g)0.42 ± 0.010.60 ± 0.01 ***
Root fresh weight (g)0.29 ± 0.020.57 ± 0.03 ***
Root dry weight (g)0.050.09 ± 0.01 ***
Hundred-grain weight (g)1.61 ± 0.041.77 ± 0.03 **
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Zheng, M.; Zhong, S.; Wang, W.; Tang, Z.; Bu, T.; Li, Q. Serendipita indica Promotes the Growth of Tartary Buckwheat by Stimulating Hormone Synthesis, Metabolite Production, and Increasing Systemic Resistance. J. Fungi 2023, 9, 1114. https://doi.org/10.3390/jof9111114

AMA Style

Zheng M, Zhong S, Wang W, Tang Z, Bu T, Li Q. Serendipita indica Promotes the Growth of Tartary Buckwheat by Stimulating Hormone Synthesis, Metabolite Production, and Increasing Systemic Resistance. Journal of Fungi. 2023; 9(11):1114. https://doi.org/10.3390/jof9111114

Chicago/Turabian Style

Zheng, Meijia, Shanpu Zhong, Wenjing Wang, Zizhong Tang, Tongliang Bu, and Qingfeng Li. 2023. "Serendipita indica Promotes the Growth of Tartary Buckwheat by Stimulating Hormone Synthesis, Metabolite Production, and Increasing Systemic Resistance" Journal of Fungi 9, no. 11: 1114. https://doi.org/10.3390/jof9111114

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop