Next Article in Journal
Optimizing the Brewing Process, Metabolomics Analysis, and Antioxidant Activity Analysis of Complexed Hongqu Rice Wine with Kiwiberry
Previous Article in Journal
The Effects of Substrates and Sonication Methods on the Antioxidant Activity of Kefir Postbiotics
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Ameliorative Effects of Camel Milk and Fermented Camel Milk on Acute Alcoholic Liver Injury

Animal Science Department, College of Agriculture and Animal Husbandry, Qinghai University, Ningda Road 251, Xining 810016, China
*
Author to whom correspondence should be addressed.
Fermentation 2024, 10(10), 493; https://doi.org/10.3390/fermentation10100493
Submission received: 19 July 2024 / Revised: 29 August 2024 / Accepted: 19 September 2024 / Published: 24 September 2024
(This article belongs to the Section Probiotic Strains and Fermentation)

Abstract

Probiotics, which are prevalent in camel milk (CM) and naturally fermented camel milk (FCM), can regulate the intestinal ecological structure to alleviate alcoholic liver disease (ALD) through the “gut–liver” axis. The protective effects and mechanisms of CM and FCM interventions on alcohol-induced acute liver injury were investigated by combining the behavior observed in rats following alcohol exposure. The results revealed that CM and FCM effectively controlled the increased levels of alcohol-induced ALT, AST, TG, MDA, and proinflammatory cytokines. Alcohol-induced oxidative depletion of hepatic CAT, GPX, GSH, and ALDH was reversed, diminishing lipid accumulation, ameliorating severe pathological damage, increasing antioxidant capabilities, and postponing oxidative stress. Additionally, the abundance of the phylum Bacteroidota (which reduces the F/B ratio); the family Prevotellaceae; the genera Clostridia_vadinBB60_group, parabacteroides, Alloprevotella, and Prevotellaceae_UC_G001; the gastrointestinal barrier; and the microbiological environment was increased. The steroid hormone biosynthesis pathway was altered to reduce alcohol-induced predominant steroid metabolites such as 17-hydroxyprogesterone, cortisol, and dehydroepiandrosterone, preventing alcoholic liver impairment. Taken together, CM could be a therapeutic dietary supplement for preventing alcoholic liver injury by ameliorating the intestinal ecology and hepatic metabolism.

1. Introduction

Alcoholic liver disease (ALD) is categorized as either acute or chronic; acute ALD is defined as hepatic lipid peroxidation, hepatotoxicity, the inflammatory response, and intestinal flora dysbiosis caused by short-term alcohol consumption [1]. According to Ayares et al. [2], alcohol-induced liver impairment constitutes primary liver-derived mortality. Binge alcohol feeding destroys intestinal tight junctions and increases intestinal permeability, which elevates endotoxin (LPS) absorption, and Kupffer cells become activated and reactive oxygen species (ROS) levels increase significantly to scavenge LPSs, leading to oxidative stress and inflammation in the liver [3]. Furthermore, as the number of pathogenic bacteria increases, ethanol-caused variations in the intestinal flora yield metabolites toxic to the body, such as LPS, long-chain fatty acids (LCFAs), and lower intestinal tight junction proteins, resulting in cell leakage [4]. Alcohol-related liver diseases are prevalent worldwide, and common remedies for ALD are medication and alcohol cessation [5]. Alcohol restriction has little effect and negative side effects are generated by long-term pharmaceuticals. Multiple studies have shown that diet-based healing represents a nontoxic and safer option.
An essential target in chronic disease, gut microbes are disrupted in the gut flora, resulting in the generation of toxic metabolites and molecules that negatively impact the body [6]. Owing to the disturbance of intestinal tight junctions caused by excessive alcohol, the intestinal barrier is weakened, and microbial metabolites called lipopolysaccharides (LPSs) are released from the intestinal lumen into the body, causing inflammation and endotoxemia [7]. In recent years, the “gut-liver” axis has gained popularity for the treatment of alcoholic liver injury, and nutritional therapy over conventional medications has led to a shift toward controlling gut microorganisms [8]. Probiotics, known as “living microorganisms”, enter the gastrointestinal system to increase survival, impacting alterations in the intestinal flora [9,10]. Probiotics can dramatically increase the dynamic balance of intestinal microorganisms and up-regulate the abundance of beneficial bacteria in rats with ALD [11,12,13]. Probiotics bred in fermented dairy products can modulate the dysregulation of gut ecology in rats with ethanol-induced hepatic injury, enhance intestinal tight junctions, and ameliorate barrier dysfunction, thereby ameliorating alcohol-induced hepatic injury through the gut-liver axis in rats [14,15]. Gut ecological changes may be associated with molecular changes in hepatic metabolism, and the mechanism underlying alcohol-induced liver injury in rats is better understood when considering the combined investigation of gut ecology alterations and molecular changes in hepatic metabolism.
According to Ayyash et al. [16], probiotics survive well from probiotic-fermented camel milk compared with cow milk. Fresh, naturally fermented camel milk is bacteria- and fungi-rich with numerous probiotic lactic acid bacteria contributing remarkably to pathways such as glycolipid and amino acid metabolism [17]. Camel milk has been confirmed to alleviate colitis in rats by regulating intestinal microorganisms and protein expression, inhibiting colonic cell necrosis, and overexpressing inflammatory markers [18]. Additionally, it has been elucidated to regulate diabetes, hypertension, and autism in adults and children [19]. In particular, the protective effect on diabetes has been verified [20,21,22,23]. In alcohol-dependent rats with liver trauma, camel milk has a superior ameliorative effect on alcoholic liver destruction and regulates the intestinal environment, glucose–lipid metabolism level, and inflammation-related genes to a certain degree [24,25,26,27]. Few studies have investigated the mechanism behind the effects of fresh camel milk and its fermented products on alcohol-induced liver injury in combination with behavioral changes in rats. This study examined the effects of CM and FCM from Qinghai plateau on the duration of the incubation period, including drunkenness, liver function, hepatic oxidative stress, lipid peroxidation, and liver pathology, in mice with alcoholic liver damage. Gut microbiome and nontarget metabolome analyses were conducted to explore the underlying mechanisms involved. This research aims to explore the potential health benefits of camel milk and its fermented products for human consumption.

2. Materials and Methods

2.1. Reagents and Materials

Delingha delivers camel milk and naturally fermented camel milk. Naturally fermented camel milk is provided by Qinghai Jinbao camel dairy Co., Ltd. (Haixi State, China) via the traditional natural fermentation method, which is a naturally formed acidic drink without the addition of any strains of bacteria. Aseptic bottles were sent to the laboratory and frozen at −40 °C to verify the bacterial activity, and the HaiWangJinZun oral mixture was purchased from the J.D. flagship store. Before feeding, the CM and FCM were homogenized and treated in a water bath at 60 °C. The positive control drugs were dissolved in water and homogenized. Ordinary pellet meal was purchased from Jiangsu Xietong Biological Co., Ltd., Nanjing, China.

2.2. Animals and Experimental Design

SPF grade C57BL/6 J rats weighing between 18 and 25 g (n = 20), were purchased from Jiangsu Province Ji Cui Yao Kang Biotechnology Co., Ltd. (Nanjing, China) and were housed at the Medical College of Qinghai University with a 12 h light-dark cycle (22–24 °C at 25–27% relative humidity). All the animal experiments were performed according to the Chinese laws and regulations of Experimental Animal Administration, and all the procedures were approved by the Qinghai University Ethics Review Committee (Approval Number: SL-2021019), on 18 September 2023.
The rats were ultimately acclimatized for one week in the laboratory. The rats were allowed free access to granular food and water. They were then allocated at random into five groups (n = 4): control (N), model (M), positive drug (Y), camel milk (CM), and naturally fermented camel milk (FCM). The alcoholic liver injury model was established on day 1 after acclimatization according to the different groups. The mice were fed regular chow throughout the modeling period, and the water and chow were renewed every 2 days. The rats were weighed and recorded at 9:00 a.m. From days 1 to 7, the mice were acclimatized to alcohol by gavage with 0.05 mL 43% alcohol/10 g of BW. This was accomplished via the gavage of HaiWangJinZun oral mixture purchased form the J.D. flagship store (Xian, China), camel milk, and naturally fermented camel milk at a dose of 0.05 mL/10 g BW to groups Y, CM, and FCM, respectively, at 9:00 a.m. every day, whereas distilled water was gavaged to the control and M groups at the equivalent dose. Two hours later, all groups except the control group were gavaged with 0.05 mL 43% alcohol/10 g BW in turn. The dose was increased to 0.1 mL 43% alcohol/10 g BW on days 7–14, and the specifications corresponded to those described above. Following the last gavage, the rats were fasted for 9 h, blood was collected instantly from the eyeballs after ether anesthesia, the cervical vertebrae were dislocated and sacrificed, and the liver and colon contents were dissected, collected, and immediately frozen in liquid nitrogen at −80 °C for subsequent experimental analysis.

3. Methodologies

3.1. Liver Tissue and Serum Biochemical Analyses

Serum samples from each group were centrifuged (2–8 °C, 3000 rpm, 15 min), and liver tissue homogenates were generated. The serum levels of alanine aminotransferase (ALT), aspartate aminotransferase (AST), triglyceride (TG), hepatic glutathione peroxidase (GPX), catalase (CAT), glutathione (GSH), malondialdehyde (MDA), and acetaldehyde dehydrogenase (ALDH) were detected in accordance with the assay instructions for the corresponding kits.

3.2. Detection of Hepatic Cytokines via Real-Time Quantitative PCR

Total RNA was extracted from liver samples (200 mg) with Steadypure Universal RNA Extraction Kit (Accurate Biology, Changsha, China). In addition, ≤500 ng of each RNA sample was reverse transcribed into cDNA with Evo M-MLV RT Premix and then assayed with a SYBR Green Premix Pro Taq HS qPCR Kit (Accurate Biology, Changsha, China), with parallel reactions for each sample. The sequences of primers used are shown in Table 1.

3.3. Histopathologic Analysis

Liver samples were obtained and preserved in 4% paraformaldehyde for hematoxylin and eosin (H&E) staining. After being preserved in good condition, the samples underwent a set of procedures, including trimming, dehydration, embedding, sectioning, staining, sealing, and microscopic examination, to assess their histopathological quality. The tissue sections were examined in depth at 400× and 200× magnification under a microscope.

3.4. Sequencing and Analysis of Fecal Bacterial 16S rRNA Genes

3.4.1. DNA Extraction and PCR Amplification

For 16S rDNA gene sequencing, three samples from each of the five experimental groups were used. In accordance with the instructions of the MagPure Soil DNA LQ Kit (Magan), total DNA was extracted from the rat colon contents. The DNA mass was determined via agarose gel electrophoresis, while the viscosity of the DNA was determined via a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA). After that, the DNA was extracted and refrigerated at −20 °C. In a 25 µL reaction, the highly variable region V3–V4 of the bacterial 16S rRNA gene was subjected to PCR via universal primers (343F: 5′-TACGGRAGGCAGCAG-3′; 798R: 5′-AGGGTATCTAATCCT-3′). PCR-amplified products were detected by agarose gel electrophoresis and purified with AMPure XP beads for purification. On an Illumina NovaSeq 6000 sequencing platform, 250 bp paired-end reads were generated after the sequencing process was completed. Shanghai Ouyi Biotechnology Co. (Shanghai, China) employed the sequencing technologies.

3.4.2. Bioinformatics Analysis

FASTQ format was used for the raw data. To create representative sequences and SAV abundance tables, downstream data were quality filtered and spliced, noise was minimized, and chimeras were eliminated. The alpha-multisample character was evaluated with indices including the Chao1 index and the Shannon index. β-diversity was assessed via unweighted UniFrac principal coordinate analysis (PCoA) via the unweighted UniFrac distance matrix calculated by R. ANOVA/Kruskler analysis was used to assess the samples. For the analysis of variance, the Kruskal–Wallis, ANOVA, t test, and Wilcoxon statistical methods were employed. With LEfSe, species abundance spectra were examined for variations.

3.5. Metabolomic Analysis

The liver samples were weighed and extracted by adding mixed organic solvent (75% (9:1 methanol/chloroform):25% H2O), sonicated for at room temperature for 30 min, and then incubated for 30 min on ice. The samples were centrifuged at 12,000 rpm for 10 min at 4 °C, and all the supernatants were concentrated and dried in centrifugal tubes at 37 °C under a gentle stream of nitrogen gas. The dehydrated sample was redissolved in a 2-chloro-L-phenylalanine solution prepared in 50% acetonitrile, and the filtrate was added to the detection vial for LC-MS detection. An ACQUITY UPLC® HSS T3 (Waters, Milford, MA, USA) column (2.1 × 100 nm, 1.8 µm) was used for the separation of liver metabolites via UPLC, employing a Thermo Q Exactive Focus electrospray ionization MS (Thermo Fisher Scientific, Waltham, MA, USA). The R package Ropls 3.6.1 (July 2019) was utilized to execute principal component analysis (PCA), partial least squares discriminant analysis (PLS-DA), and orthogonal partial least squares discriminant analysis (OPLS-DA) downscaling, after which the liver metabolites with significant differences (VIP value > 1.0, p < 0.05) between the model group and the CM and FCM groups were selected. The MetaboAnalyst software package 4.0 was used to perform functional pathway enrichment and topological analysis of the screened differentially abundant metabolites.

3.6. Analyzing Statistics

The outcomes are presented as the mean ± standard deviations (SD). For all the statistical assessments, one-way statistical analysis of variability, or ANOVA, was performed. Significant difference analysis was conducted via SPSS 26, and all data results with p < 0.05 demonstrated statistically significant differences.

4. Results

4.1. Behavioral Aspects of the Gavage Dose in Mice

Noninvasive examinations were performed to analyze the state of intoxication in mice, which is not only economical but also does not negatively affect the mice. As shown in Table 2, the rats in the M group presented signs of intoxication and impaired movement after alcohol gavage, and took longer to sober. In contrast, after King Drink, CM, and FCM intervention, the duration of latency of loss of the righting reflex was significantly shorter and the sobriety effects of both CM and FCM were greater. It can be hypothesized that CM combined with FCM may reduce alcohol-induced hypomania by increasing alcohol-consuming enzyme activity and that CM intervention has greater efficacy.

4.2. CM and FCM Ameliorate Alcohol-Induced Oxidative Damage

The liver indices of the rats were minimally affected by alcohol, with no significant differences across all the groups except the CM group. The primary markers reflecting liver damage, ALT and AST, were notably influenced by alcohol consumption, leading to significant increases in the serum ALT and AST levels, elevated TG content, and hepatic fat accumulation (p < 0.05). Conversely, CM and FCM significantly reversed these effects, decreasing the TG content and serum ALT levels by 18.81% and 17.94% and 23.92% and 41.18%, respectively, while yielding no significant effect on AST. Additionally, positive drugs exhibited a weaker protective effect against alcoholic liver injury than CM and FCM did (Figure 1b–d). Alcohol-induced liver injury primarily manifests as inflammatory responses, oxidative stress, and disturbances in the dynamic balance of the intestinal microorganisms. Alcohol stimulates the generation of reactive oxygen species (ROS) in the body, depleting various antioxidant substances. GPX serves as a crucial antioxidant enzyme that scavenges ROS, whereas MDA is a significant biomarker for oxidative stress resulting from lipid peroxidation [28]. As shown in Figure 1, ALD mice presented a remarkable decrease in GPX activity, CAT activity, and GSH but a notable increase in MDA and ALDH levels, while CM and FCM interventions noticeably enhanced the antioxidant extent of these rats. Compared with group M, the complete GSH content and CAT activity of the CM and FCM groups increased by 28.76% and 30.05% and 25.69% and 27.77%, respectively (p < 0.05). These measures significantly weakened the degree of alcoholic hepatocyte damage in mice due to oxidative overload, the impacts of CM and FCM were comparable, and both outperformed the King Drink treatment.
Alcohol damages the intestinal barrier and leaks through pipes, LPS is secreted and then triggers the TLR4/NF-kB signaling pathway, and inflammatory mediators are produced. The elevated levels of IL-6 and IL-1β were significantly reduced by CM and FCM, which also attenuated the hepatic inflammatory response, especially in the CM group (Figure 2). Consistent with their ability to increase hepatic antioxidant capacity, CM and FCM significantly suppressed the overexpression of hepatic pro-inflammatory factors (IL-6, IL-1β) and activated PPAR-α expression (p < 0.05). Taken together, CM and FCM effectively increased hepatic antioxidant levels and ameliorated alcohol-induced inflammation in the liver.

4.3. Effects of CM and FCM on Liver Histopathology in Mice with Alcohol-Induced Liver Injury

Compared with control rats, alcohol-induced ALD mice showed obvious hepatocyte fat vacuoles, hepatic cord disarray, cellular incompleteness, and inflammatory cell infiltration, whereas CM and FCM treatments ameliorated the above states to some extent, with radial scattering of hepatic cords, well-arranged hepatocytes, and intact cellular edges. Among them, FCM interventions were similar to the positive control drug in terms of ameliorating hepatic pathology (Figure 3).

4.4. Results of CM and FCM on the Microbiota of the Intestines of Mice Subjected to Alcohol-Induced Liver Dysfunction

ALD manifests alcohol-induced disruption of the gut microbiota balance. At the OUT level, the gut microbiota diversity was analyzed with 97% sequence similarity, as shown in Figure 4a. The CM group presented the most OUTs among the five experimental groups, totaling 763 OUTs, while the FCM group acquired the fewest, totaling 635 OUTs. There were significant differences in each group’s OUTs (p < 0.05). According to the α-diversity results, ALD rats had significantly greater ACE and Chao1 indices than did the control group (p < 0.05). This finding suggested that the abundance of microorganisms increased in the alcohol-treated rats. However, following CM and FCM treatments, the gut flora was downregulated and eventually converged to the control level (Figure 4b,c). The Shannon and Simpson indices are two main indicators of microbial diversity, and as demonstrated in Figure 4d,e, alcohol decreased intestinal microbial diversity. In contrast, the positive control drug caused a significant increase in microbial diversity, and the diversity of the intestinal flora in the experimental group tended to normalize (p < 0.05).
To further elucidate microflora variability between and within groups, β-diversity analysis was performed. PCA revealed that Baijiu altered the intestinal flora of the rats, allowing the model group to be distinguished from the control and experimental groups. Compared with those in the control group, the microbiomes in the CM and FCM groups were more uniform, with denser samples. These groups were also completely isolated from group M, indicating that camel milk and fermented camel milk substantially altered the structure of the alcohol-induced flora. The probiotic bacteria inherent in CM and its fermented products may affect the biodiversity of the gut flora communities. CM and FCM may have controlled ethanol-induced intestinal flora diversity in rats.
Second, differences in microbial composition among the rats in each group were examined at different levels. Intestinal microorganisms were identified and analyzed via 16S rRNA V3-V4 sequencing, and Firmicutes, Bacteroidota, Proteobacteria, Campilobacterota, and Desulfobacterota were the predominant intestinal bacterial phyla in all the samples. (Figure 5a). Firmicutes did not differ substantially across groups and greatly decreased after FCM treatment (106.44%) (p < 0.05). Furthermore, when the M group was compared with the control group, the abundances of Bacteroidota and Proteobacteria decreased and increased, respectively. In contrast, the abundance of Bacteroidota increased in Y, CM, and FCM, whereas the abundance of Proteobacteria significantly decreased, and the abundance of Bacteroidota was significantly increased (31.13%) (p < 0.05). The CM and FCM treatments dropped the F/B value, with FCM demonstrating superior efficacy. Alcohol-induced alterations in the gut microbiota of the rats boosted the abundance of the phylum Proteobacteria, which was effectively reversed by CM and FCM.
The dominant intestinal microbial genera included Parasutterella, Clostridia_UCG-014, Bacteroides, Alloprevotella, Helicobacter, Lachnospiraceae_NK4A136_group, Muribaculaceae, Prevotellaceae_UCG-001, and others at the genus level (Figure 5). Notably, Lactobacillus (61.99%) exhibited the highest abundance in the FCM group and lower abundance in the M group. Lactobacillus metabolites, which potentially represent probiotics, enhance intestinal barrier function [29]. By augmenting beneficial bacteria, FCM can mitigate liver damage caused by alcohol-induced disruption of the intestinal barrier.
By comparing the distinctive flora of each group at different taxonomic levels, LEfSe analysis can further reveal the impacts of various treatments on the gastrointestinal bacteria of rats and accurately pinpoint statistically distinct rat intestinal microbial indicators under all treatments. The intestinal differential flora of each group were analyzed with LDA > 3 as the threshold. The abundance of the Desulfovibrionaceae family and Faecalibacterium genus was considerably greater in the M group than in the control group, as shown in Figure 6. Compared with the M treatment, the CM and FCM treatments notably increased the presence of the genera Clostridia-vadinBB60-group, Eubacterium-fissicatena-group, Erysipelatoclostridium, and prevotellaceae-UCG-001. In comparison to the M group, CM also decreased the relative abundance of the genera Parasutterella and Dubosiella and increased the abundance of the genera Parabacteroides, Faecalitalea, Alloprevotella, and Lactobacillus. In rats with alcoholic liver impairment, CM and FCM therapies may successfully modulate the construction of the intestinal flora.
The critically relevant metabolic pathways associated with microorganisms in rats can also be identified via KEGG function prediction analysis of rat gut bacteria. The bacterial communities in the intestines of the CM group were enriched mostly in pathways connected with apoptosis-fly, P13K-Akt, IL-17, estrogen, progesterone-mediated oocyte maturation, antigen processing and presentation, and other related pathways, as illustrated in Figure 6d,e. The FCM group was enriched in other glycan degradation, lysosom, glycosphingolipid biosynthesis/globo and isoglobo series, various types of n-glycan biosynthesis, and other pathways. Additionally, a substantial positive correlation existed between group M and pathways involved in bacterial chemotaxis and flagellar assembly.

4.5. Effects of CM and FCM on Liver Metabolites in Mice

Metabolomics has become one of the more popular research methods in recent years and can aid in our understanding of the metabolic pathways and pathological processes of metabolites associated with various diseases. The major intestinal flora enrichment pathways and hepatic metabolites in ALD rats can be further identified by non-target metabolic analysis, which can also provide insight into the reversible benefits of CM and FCM on alcohol-addicted liver damage. Liver tissues from different groups were subjected to off-target metabolic analyses. After CM and FCM interventions, metabolite changes were observed via PCA and OPLS-DA models. Substantial changes were observed in the model group compared with the other groups.
Alcohol dramatically elevated the concentrations of various metabolites, including 17-hydroxyprogesterone, dihydrothymine, (-)-epigallocatechin, acetylphosphate, etc. (Figure 7c). Alcohol-induced low levels of differentially abundant metabolites, such as phenolphthaldehyde, 8-amino-7-oxononanoate, cortisol, stearidonic acid, and palmitic acid, were significantly increased in the CM intervention group compared with those in the M group, whereas the downregulated metabolites included dehydroepiandrosterone, decanoyl-L-carnitine, lanosterin, and ophthalmate. (Figure 7d). Vitexin, L-phenylalanine, ophthalmate, and niacinamide were downregulated in the FCM group, while acetyl-L-phenylalanine, palmitic acid, L-glutamic acid, 8-amino-7-oxononanoate, and anabasine were dramatically upregulated in abundance (Figure 7e). The greatest difference in metabolism was observed between FCM and M. Alcohol-induced alterations in hepatic differentially abundant metabolites were successfully reversed by CM and FCM therapies, and FCM was more successful in this regard.
KEGG enrichment was used to analyze the metabolic pathways of the discriminatory metabolites to explore further the effects of CM and FCM interventions on hepatic metabolites in rats. In the three alcohol-administered groups, after CM and FCM interventions, glycine, serine and threonine metabolism; valine, leucine, and isoleucine biosynthesis; alodsterone-regulated sodium reabsorption; the prolactin signaling pathway; and other metabolic pathways were significantly altered (Figure 7f).

5. Discussion

Most dietary ingredients consumed are decomposed through the intestinal tract and digested mainly in the liver. When consumed, alcohol is transformed into acetaldehyde by ethanol dehydrogenase, which is then converted into water and carbon dioxide by acetaldehyde dehydrogenase [30]. Severe alcohol consumption results in deficiencies in ethanol dehydrogenase and acetaldehyde dehydrogenase, leading to the accumulation of toxic metabolites. This further compromises the integrity of the intestinal barrier and increases intestinal permeability. Additionally, the liver is exposed to antigens, pathogenic intestinal microorganisms, and metabolites, which exacerbate hepatic inflammation. One of the essential applications for monitoring alcoholic liver disease, which is commonly characterized by interruption of the “gut-liver” axis and deterioration of the intestinal barrier, is the gut microbiota [31]. Dietary targeted interventions in the intestinal environment to inhibit the development of ALD are reliable and effective options. For instance, protein and amino acid supplements (tryptophan and threonine) may reduce hepatocellular apoptosis and protect against ALD [32]. By relieving oxidative stress in the liver and altering the intestinal ecosystem, ALD may also be prevented with fruit and vegetable extracts [33,34]. Camel milk and its fermented products possess various functional activities, including antimicrobial, antioxidant (ABTS, DPPH), anti-obesity, anti-hypertension (ACE enzyme inhibitory properties), antidiabetic (α-amylase, α-glucosidase inhibitory properties), and anti-inflammatory [35,36,37]. According to related research, probiotics in FCM can prevent fat accumulation by regulating lipid metabolism, switching white fat to beige, modifying the intestinal microflora, and suppressing inflammation [38]. The increase in gut microbial homeostasis caused by camel milk could contribute to liver disease. However, characterized by low production and challenging refrigeration, these methods are limited to the application of camel milk and fermented camel milk, while naturally fermented camel milk has poor gel properties and acidification issues [39]. The quality of fermented camel milk can be improved to some extent by screening strains and adding exogenous substances, but shortcomings remain [40]. Currently, studies on the ameliorative effects and underlying mechanisms of camel milk and naturally fermented camel milk on ALD are limited. A preliminary study on the microbial diversity of plateau fermentation products revealed a substantial diversity of microorganisms in barley lees, camel milk, and naturally fermented camel milk. The predominant bacteria among which are Lactobacillus and Lactococcus, and the microorganisms in camel milk possess good antimicrobial properties [41]. Camel milk is naturally fermented at 37–40 °C without commercial fermentation strains; acid is formed and flavor changes occur to form kefir. In this study, we found that CM and FCM could ameliorate pathological changes by modulating lipid metabolism disorders, the intestinal microbial structure, the altering oxidative stress status, and the hepatic levels of beneficial metabolites in ALD rats.
ALT and AST are key indicators of the severity of alcoholic liver injury [42]. Elevated levels of ALT and AST due to excessive alcohol consumption were normalized progressively following therapies with CM and FCM. The administration of CM and FCM resulted in a considerable reduction in alcohol-induced elevated TG levels, indicating the potential of these products to regulate hepatic triglyceride levels by addressing hepatic lipid metabolism disorders. The dismutation of superoxide to hydrogen peroxide is catalyzed by SOD, which is then further decomposed to oxygen and water by CAT and GSH. Hydroperoxides are then reduced by GPX-catalyzed GSH [43]. Higher CAT, GSH, and GPX activities in vivo are beneficial for scavenging excess free radicals caused by alcohol and halting the pathological progression of alcoholic liver injury. Consistent with the findings of H.X. Li et al., CM and FCM interventions increased alcohol-induced low levels of antioxidant enzymes such as CAT, GSH, SOD, and GPX; slowed the degree of oxidation; and lowered the level of MDA, thus enhancing the antioxidant system of the mice to avoid further aggravation of liver injury. An indirect indicator of liver damage, the level of the oxidized product malondialdehyde (MDA) is strongly negatively correlated with antioxidant enzyme activity. High antioxidant enzyme activity levels are correlated with low MDA levels and oxidation [44]. Two enzymes crucial in alcohol metabolism are ADH and ALDH. Acetic acid and acetate formed from acetate oxidation in the liver are recycled to nearby tissues, where acetyl coenzyme A, a vital enzyme, is activated. This molecule enters the tricarboxylic acid cycle and is ultimately converted into water and carbon dioxide for excretion from the body [45]. ADH and ALDH are limited to the liver, and excessive alcohol accumulates in the liver, causing liver injury. CM and FCM intervention significantly increased hepatic ALDH. In conclusion, CM and FCM enhanced the antioxidant level and mitigated oxidative damage to the liver by strengthening the activity of antioxidant enzymes and decreasing the accumulation of lipid oxidation products. Alcohol elevates the overexpression of hepatic inflammatory factors, triggering severe hepatitis, and CM and FCM interventions prevent this increase, while peroxisome proliferator-activated receptor (PPAR-α) expression levels rose; therefore, alcoholic liver injury is ameliorated.
Research has confirmed that probiotics can modify the gut microbial composition and raise the probability of beneficial bacteria being present, leading to a defensive effect on alcoholic liver-injured rats. Probiotics can also effectively scavenge ROS and degrade the oxidative stress state of ethanol-induced liver injury in rats with antioxidant capacity [46,47]. In this study, the relative abundances of the order Rhodospirillales, family prevotellaceae, and genera Enterorhabdus, Clostridia_vadinBB60_group, Parabacteroides, Staphylococcus, Prevotellaceae_UC_G001, and other genera were upregulated by CM treatment in comparison with the M group. In comparison with those in the M group, the abundances of the genera Clostridia_vadinBB60_group, Staphylococcus, and Prevotellaceae_UC_G001 in the FCM group, and the phyla Bacteroidota and families Prevotellaceae and Lactobacillus were significantly increased. Prevotellaceae_UCG-001 is a relatively common bacterium in the intestine that produces various enzymes that can degrade cellulose and xylan [48]. Furthermore, research has shown that Prevotellaceae_UCG-001 incorporates the AMPK signaling pathway to manipulate the microbiota in the gastrointestinal tract and lipid metabolism [49]. The CM and FCM interventions were associated with a noteworthy increase in the prevalence of genera such as Alloprevotella and Prevotellaceae_UCG-001, along with an apparent similarity in the overall framework of intestinal microorganisms in mice with alcoholic liver injury. Consistent with the findings of Xinling Song et al. [50], alcohol diminished the proportions of Muribaculaceae, Alistipes, Bacteroides, and Odoribacter in the gastrointestinal tract of mice. Furthermore, these bacterial groups correspond to Alloprevotella, considering that they are the predominant bacterial groups in the intestine. Zeng et al. [51] reported that Alloprevotella, through the generation of short-chain fatty acids (SCFAs), strengthens the barrier integrity of the endomucosal layer against pro-inflammatory stimuli and safeguards the colonic epithelium. SCFAs maintain intestinal health, ameliorate hepatic steatosis and inflammation, and consequently facilitate ALD [52]. The finding that Lactobacillus spp. was the most prevalent intestinal microorganisms in the CM group is noteworthy. This finding implies that substantial levels of Lactobacillus spp. in CM and FCM can effectively regulate changes in the intestinal flora caused by alcohol and, to some extent, the abundance of beneficial bacteria to be unregulated, potentially delivering therapeutic efficacy for alcoholic liver injury.
The primary system responsible for the metabolism of alcohol is the liver. For a deeper comprehension of how CM and FCM can ameliorate alcohol-induced liver deterioration, further investigation of their effects on hepatic metabolites and metabolic pathways can be crucial. Dihydrothymine, 4-(glutamylamino) butanoate, dehydroepiandrosterone, decanoyl-L-carnitine, 17-hydroxyprogesterone, cortisol, diosgenin, d-Glucuronic acid, (-)-epigallocatechin and other differentially abundant metabolites were significantly upregulated in the M group compared with those in the control group. The CM and FCM groups presented significant positive correlations with phenylacetaldehyde, 1-arachidonoyl glycerol, N-acetyl-L-phenylalanine, 8-amino-7-oxononanoate, stearidonic acid, and palmitic acid. However, the levels of cortisol, 4-hydroxycinnamic acid, 3-ketosphingosine, ophthalmate, decanoyl-L-carnitine, and alpha-ketoisovaleric acid were significantly negatively correlated (Figure 7). Rats exposed to alcohol present elevated estrogen levels and unconventional estrogen metabolism [53]. Alcohol triggers a dramatic increase in dehydroepiandrosterone, 17-hydroxyprogesterone, and cortisol in rats, which exacerbates alcoholic liver damage. As an anticipated metabolite connected with liver metabolism and function, cortisol diligently facilitates a tsunami of IL-1β, a pro-inflammatory cytokine [54]. In contrast, CM and FCM effectively suppressed alcohol-induced liver inflammation and normalized the increased levels of the hepatic metabolite cortisol in rats, which was consistent with the down-regulation of IL-1β. According to an analysis of the significantly distinct metabolite enrichment pathways, CM and FCM regulated mainly valine, leucine, and isoleucine biosynthesis; glycine, serine, and threonine metabolism; cysteine and methionine metabolism; and steroid hormone biosynthesis. Glycine and isoleucine biosynthesis; glycine, serine, and threonine metabolism; cysteine and methionine metabolism; steroid hormone biosynthesis; and other related metabolic pathways are involved in alcohol-induced liver injury. Steroid hormone biosynthesis may be the predominant pathway through which alcohol acts on the liver by up-regulating 17-hydroxyprogesterone, cortisol, and dehydroepiandrosterone.
CM and FCM first ameliorate alcohol-induced hepatic inflammation and pathological damage by regulating peroxidation, liver function impairment, and inflammation caused by the overexpression of inflammatory factors after acute heavy feeding. In addition, they effectively control the homeostasis of intestinal microorganisms and liver metabolites to alleviate ALD. The target pathways and molecules of CM and FCM to protect against ALD in this work need to be further investigated. To investigate the underlying mechanisms of CM and FCM and pinpoint the key strains contributing to FCM, we intend to conduct correlation analyses that target the digestive tract.

6. Conclusions

In conclusion, camel milk and naturally fermented camel milk can lower blood ALT activity and TG levels, preserve liver function, lower the levels of the oxidized product MDA, enhance the activities of antioxidant enzymes such as GSH, GPX, and CAT, improve the liver’s antioxidant capacity, and prevent the inflammatory response. The alcohol-induced decline in liver function and oxidative damage significantly improved. Furthermore, beneficial intestinal bacterial groups, including the Clostridia_vadinBB60_group, Alloprevotella, and Prevotellaceae_UCG-001 genera, were upregulated and the number of intestinal microorganisms improved. A suspected potential probiotic, Lactobacillus, enhances the intestinal epidermal tight junctions found in CM, which improves intestinal barrier function. The results of a metabolomics investigation revealed that CM and FCM primarily regulate hepatic metabolites through valine, leucine, and isoleucine biosynthesis; glycine, serine, and threonine metabolism; and other related metabolic pathways. Furthermore, targeting the metabolic pathway of steroid hormone production, both the CM and FCM groups worked together to downregulate elevated levels of alcohol-induced hepatic metabolites, including 17-hydroxyprogesterone, cortisol, and dehydroepiandrosterone, to protect against acute alcoholic liver injury.

Author Contributions

C.Z.: Writing—original draft preparation, Investigation, Methodology, Software. W.S.: Writing—review and editing, Methodology, Supervision, Funding acquisition. Y.L.: Methodology, Investigation, Supervision, Funding acquisition. All authors have read and agreed to the published version of the manuscript.

Funding

This work was funded by the Science and technology leading talents of Kunlun elite from department of science and technology in Qinghai (2024).

Institutional Review Board Statement

All the procedures were conducted in accordance with Chinese laws and regulations and were approved by the Qinghai University Ethics Review Committee on 18 September 2023 (Approval Number. SL-2021019).

Informed Consent Statement

Not applicable.

Data Availability Statement

Data are contained within the article.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Subramaniyan, V.; Chakravarthi, S.; Jegasothy, R.; Seng, W.Y.; Fuloria, N.K.; Fuloria, S.; Hazarika, I.; Das, A. Alcohol-Associated Liver Disease: A Review on Its Pathophysiology, Diagnosis and Drug Therapy. Toxicol. Rep. 2021, 8, 376–385. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  2. Ayares, G.; Idalsoaga, F.; Arnold, J.; Fuentes-López, E.; Arab, J.P.; Díaz, L.A. Public Health Measures and Prevention of Alcohol-Associated Liver Disease. J. Clin. Exp. Hepatol. 2022, 12, 1480–1491. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  3. Fan, J.; Wang, Y.; You, Y.; Ai, Z.; Dai, W.; Piao, C.; Liu, J.; Wang, Y. Fermented Ginseng Improved Alcohol Liver Injury in Association with Changes in the Gut Microbiota of Mice. Food Funct. 2019, 10, 5566–5573. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  4. Rao, P.-L.; Shen, Y.-H.; Song, Y.-J.; Xu, Y.; Xu, H.-X.; Prunella Vulgaris, L. Attenuates Gut Dysbiosis and Endotoxin Leakage against Alcoholic Liver Disease. J. Ethnopharmacol. 2024, 319, 117237. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  5. Wu, L.; Li, W.; Chen, G.; Yang, Z.; Lv, X.; Zheng, L.; Sun, J.; Ai, L.; Sun, B.; Ni, L. Ameliorative Effects of Monascin from Red Mold Rice on Alcoholic Liver Injury and Intestinal Microbiota Dysbiosis in Mice. Food Biosci. 2022, 50, 102079. [Google Scholar] [CrossRef] [Scilit]
  6. De Vos, W.M.; Tilg, H.; Van Hul, M.; Cani, P.D. Gut Microbiome and Health: Mechanistic Insights. Gut 2022, 71, 1020–1032. [Google Scholar] [CrossRef] [Scilit]
  7. Meena, A.S.; Shukla, P.K.; Bell, B.; Giorgianni, F.; Caires, R.; Fernández-Peña, C.; Beranova, S.; Aihara, E.; Montrose, M.H.; Chaib, M.; et al. TRPV6 Channel Mediates Alcohol-Induced Gut Barrier Dysfunction and Systemic Response. Cell Rep. 2022, 39, 110937. [Google Scholar] [CrossRef] [Scilit]
  8. Liu, H.; Kang, X.; Yang, X.; Yang, H.; Kuang, X.; Ren, P.; Yan, H.; Shen, X.; Kang, Y.; Li, L.; et al. Compound Probiotic Ameliorates Acute Alcoholic Liver Disease in Mice by Modulating Gut Microbiota and Maintaining Intestinal Barrier. Probiotics Antimicrob. Proteins 2023, 15, 185–201. [Google Scholar] [CrossRef] [Scilit]
  9. Sang, T.; Guo, C.; Guo, D.; Wu, J.; Wang, Y.; Wang, Y.; Chen, J.; Chen, C.; Wu, K.; Na, K.; et al. Suppression of Obesity and Inflammation by Polysaccharide from Sporoderm-Broken Spore of Ganoderma Lucidum via Gut Microbiota Regulation. Carbohydr. Polym. 2021, 256, 117594. [Google Scholar] [CrossRef] [Scilit]
  10. Sun, X.; Shi, J.; Kong, L.; Shen, Q.; Zeng, X.; Wu, Z.; Guo, Y.; Pan, D. Recent Insights into the Hepatoprotective Effects of Lactic Acid Bacteria in Alcoholic Liver Disease. Trends Food Sci. Technol. 2022, 125, 91–99. [Google Scholar] [CrossRef] [Scilit]
  11. Cao, H.; Zhou, T.; Tang, H.; Feng, P.; Ali, G.; Liu, P.; Li, X. Genetically Encoded Probiotic EcN 1917 Alleviates Alcohol-Induced Acute Liver Injury and Restore Gut Microbiota Homeostasis. J. Funct. Foods 2021, 85, 104661. [Google Scholar] [CrossRef] [Scilit]
  12. Tian, X.; Li, R.; Jiang, Y.; Zhao, F.; Yu, Z.; Wang, Y.; Dong, Z.; Liu, P.; Li, X. Bifidobacterium breve ATCC15700 Pretreatment Prevents Alcoholic Liver Disease through Modulating Gut Microbiota in Mice Exposed to Chronic Alcohol Intake. J. Funct. Foods 2020, 72, 104045. [Google Scholar] [CrossRef] [Scilit]
  13. Xiong, S.-Y.; Wu, G.-S.; Li, C.; Ma, W.; Luo, H.-R. Clinical Efficacy of Probiotics in the Treatment of Alcoholic Liver Disease: A Systematic Review and Meta-Analysis. Front. Cell. Infect. Microbiol. 2024, 14, 1358063. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  14. Kim, J.-H.; Woo, D.; Nam, Y.; Baek, J.; Lee, J.-Y.; Kim, W. Probiotic Cheese Improves Alcohol Metabolism and Alleviates Alcohol-Induced Liver Injury via the SIRT1/AMPK Signaling Pathway. J. Funct. Foods 2023, 108, 105736. [Google Scholar] [CrossRef] [Scilit]
  15. Nam, Y.; Kim, J.-H.; Konkit, M.; Kim, W. Hepatoprotective Effects of Lactococcus Chungangensis CAU 1447 in Alcoholic Liver Disease. J. Dairy Sci. 2019, 102, 10737–10747. [Google Scholar] [CrossRef] [Scilit]
  16. Ayyash, M.; Abdalla, A.; Alhammadi, A.; Senaka Ranadheera, C.; Affan Baig, M.; Al-Ramadi, B.; Chen, G.; Kamal-Eldin, A.; Huppertz, T. Probiotic Survival, Biological Functionality and Untargeted Metabolomics of the Bioaccessible Compounds in Fermented Camel and Bovine Milk after in Vitro Digestion. Food Chem. 2021, 363, 130243. [Google Scholar] [CrossRef] [Scilit]
  17. Bao, W.; He, Y.; Yu, J.; Yang, X.; Liu, M.; Ji, R. Diversity Analysis and Gene Function Prediction of Bacteria and Fungi of Bactrian Camel Milk and Naturally Fermented Camel Milk from Alxa in Inner Mongolia. LWT 2022, 169, 114001. [Google Scholar] [CrossRef] [Scilit]
  18. He, J.; Guo, K.; Chen, Q.; Wang, Y. Jirimutu Camel Milk Modulates the Gut Microbiota and Has Anti-Inflammatory Effects in a Mouse Model of Colitis. J. Dairy Sci. 2022, 105, 3782–3793. [Google Scholar] [CrossRef] [Scilit]
  19. Al-Anazi, M.S.; El-Zahar, K.M.; Rabie, N.A.-H. Nutritional and Therapeutic Properties of Fermented Camel Milk Fortified with Red Chenopodium Quinoa Flour on Hypercholesterolemia Rats. Molecules 2022, 27, 7695. [Google Scholar] [CrossRef] [Scilit]
  20. Ayoub, M.A.; Palakkott, A.R.; Ashraf, A.; Iratni, R. The Molecular Basis of the Anti-Diabetic Properties of Camel Milk. Diabetes Res. Clin. Pract. 2018, 146, 305–312. [Google Scholar] [CrossRef] [Scilit]
  21. Han, B.; Zhang, L.; Hou, Y.; Zhong, J.; Hettinga, K.; Zhou, P. Phosphoproteomics Reveals That Camel and Goat Milk Improve Glucose Homeostasis in HDF/STZ-Induced Diabetic Rats through Activation of Hepatic AMPK and GSK3-GYS Axis. Food Res. Int. 2022, 157, 111254. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  22. Korish, A.A.; Abdel Gader, A.G.M.; Alhaider, A.A. Comparison of the Hypoglycemic and Antithrombotic (Anticoagulant) Actions of Whole Bovine and Camel Milk in Streptozotocin-Induced Diabetes Mellitus in Rats. J. Dairy Sci. 2020, 103, 30–41. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  23. Zhang, Y.; Wang, J.; Ge, W.; Song, Y.; He, R.; Wang, Z.; Zhao, L. Camel Milk Peptides Alleviate Hyperglycemia by Regulating Gut Microbiota and Metabolites in Type 2 Diabetic Mice. Food Res. Int. 2023, 173, 113278. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  24. Darwish, H.A.; Abd Raboh, N.R.; Mahdy, A. Camel’s Milk Alleviates Alcohol-Induced Liver Injury in Rats. Food Chem. Toxicol. 2012, 50, 1377–1383. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  25. Ming, L.; Qiao, X.; Yi, L.; Siren, D.; He, J.; Hai, L.; Guo, F.; Xiao, Y.; Ji, R. Camel Milk Modulates Ethanol-Induced Changes in the Gut Microbiome and Transcriptome in a Mouse Model of Acute Alcoholic Liver Disease. J. Dairy Sci. 2020, 103, 3937–3949. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  26. Ming, L.; Qi, B.; Hao, S.; Ji, R. Camel milk ameliorates inflammatory mechanisms in an alcohol-induced liver injury mouse model. Sci. Rep. 2021, 11, 22811. [Google Scholar] [CrossRef] [Scilit]
  27. Qi, B.; Ji Ri, M.; Ming, L. The intervention of camel milk on acute alcoholic liver injury in mice. J. Chin. Inst. Food Sci. Technol. 2023, 23, 147–158. [Google Scholar] [CrossRef]
  28. Liu, M.; Liu, M.; Yang, S.; Shen, C.; Wang, X.; Liu, W.; Guo, Y. Fermented Milk of Cheese-Derived Lactobacillus Delbrueckii Subsp. Bulgaricus Displays Potentials in Alleviating Alcohol-Induced Hepatic Injury and Gut Dysbiosis in Mice. Food Res. Int. 2022, 157, 111283. [Google Scholar] [CrossRef] [Scilit]
  29. Han, X.; Liu, J.; Bai, Y.; Hang, A.; Lu, T.; Mao, C. An Iridoid Glycoside from Cornus Officinalis Balances Intestinal Microbiome Disorder and Alleviates Alcohol-Induced Liver Injury. J. Funct. Foods 2021, 82, 104488. [Google Scholar] [CrossRef] [Scilit]
  30. Ma, T.; Li, Y.; Zhu, Y.; Jiang, S.; Cheng, C.; Peng, Z.; Xu, L. Differential Metabolic Pathways and Metabolites in a C57BL/6J Mouse Model of Alcoholic Liver Disease. Med. Sci. Monit. 2020, 26, e924602. [Google Scholar] [CrossRef] [Scilit]
  31. Fairfield, B. Gut Dysbiosis as a Driver in Alcohol-Induced Liver Injury. Jhep Rep. 2021, 3, 100220. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  32. Lyu, S.; Cai, Z.; Yang, Q.; Liu, J.; Yu, Y.; Pan, F.; Zhang, T. Soybean Meal Peptide Gly-Thr-Tyr-Trp Could Protect Mice from Acute Alcoholic Liver Damage: A Study of Protein-Protein Interaction and Proteomic Analysis. Food Chem. 2024, 451, 139337. [Google Scholar] [CrossRef] [Scilit]
  33. Chen, Y.; Ma, H.; Liang, J.; Sun, C.; Wang, D.; Chen, K.; Zhao, J.; Ji, S.; Ma, C.; Ye, X.; et al. Hepatoprotective Potential of Four Fruit Extracts Rich in Different Structural Flavonoids against Alcohol-Induced Liver Injury via Gut Microbiota-Liver Axis. Food Chem. 2024, 460, 140460. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  34. Wang, X.; Sun, Z.; Wang, X.; Li, M.; Zhou, B.; Zhang, X. Solanum nigrum L. Berries Extract Ameliorated the Alcoholic Liver Injury by Regulating Gut Microbiota, Lipid Metabolism, Inflammation, and Oxidative Stress. Food Res. Int. 2024, 188, 114489. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  35. Ayyash, M.; Al-Nuaimi, A.K.; Al-Mahadin, S.; Liu, S.-Q. In Vitro Investigation of Anticancer and ACE-Inhibiting Activity, α-Amylase and α-Glucosidase Inhibition, and Antioxidant Activity of Camel Milk Fermented with Camel Milk Probiotic: A Comparative Study with Fermented Bovine Milk. Food Chem. 2018, 239, 588–597. [Google Scholar] [CrossRef] [Scilit]
  36. Ayyash, M.; Al-Dhaheri, A.S.; Al Mahadin, S.; Kizhakkayil, J.; Abushelaibi, A. In Vitro Investigation of Anticancer, Antihypertensive, Antidiabetic, and Antioxidant Activities of Camel Milk Fermented with Camel Milk Probiotic: A Comparative Study with Fermented Bovine Milk. J. Dairy Sci. 2018, 101, 900–911. [Google Scholar] [CrossRef] [Scilit]
  37. Khakhariya, R.; Sakure, A.A.; Maurya, R.; Bishnoi, M.; Kondepudi, K.K.; Padhi, S.; Rai, A.K.; Liu, Z.; Patil, G.B.; Mankad, M.; et al. A Comparative Study of Fermented Buffalo and Camel Milk with Anti-Inflammatory, ACE-Inhibitory and Anti-Diabetic Properties and Release of Bio Active Peptides with Molecular Interactions: In Vitro, in Silico and Molecular Study. Food Biosci. 2023, 52, 102373. [Google Scholar] [CrossRef] [Scilit]
  38. Aljutaily, T.; Rehan, M.; Moustafa, M.M.A.; Barakat, H. Effect of Intermittent Fasting, Probiotic-Fermented Camel Milk, and Probiotic-Fermented Camel Milk Incorporating Sukkari Date on Diet-Induced Obesity in Rats. Fermentation 2022, 8, 619. [Google Scholar] [CrossRef] [Scilit]
  39. Berhe, T.; Ipsen, R.; Seifu, E.; Kurtu, M.Y.; Eshetu, M.; Hansen, E.B. Comparison of the Acidification Activities of Commercial Starter Cultures in Camel and Bovine Milk. LWT 2018, 89, 123–127. [Google Scholar] [CrossRef] [Scilit]
  40. Atwaa, E.S.H.; Shahein, M.R.; Raya-Alvarez, E.; Abd El-Sattar, E.S.; Hassan, M.A.A.; Hashim, M.A.; Dahran, N.; El-Khadragy, M.F.; Agil, A.; Elmahallawy, E.K. Assessment of the Physicochemical and Sensory Characteristics of Fermented Camel Milk Fortified with Cordia Myxa and Its Biological Effects against Oxidative Stress and Hyperlipidemia in Rats. Front. Nutr. 2023, 10, 1130224. [Google Scholar] [CrossRef] [Scilit]
  41. Abushelaibi, A.; Al-Mahadin, S.; El-Tarabily, K.; Shah, N.P.; Ayyash, M. Characterization of Potential Probiotic Lactic Acid Bacteria Isolated from Camel Milk. LWT—Food Sci. Technol. 2017, 79, 316–325. [Google Scholar] [CrossRef] [Scilit]
  42. Lai, W.; Zhou, S.; Bai, Y.; Che, Q.; Cao, H.; Guo, J.; Su, Z. Glucosamine Attenuates Alcohol-Induced Acute Liver Injury via Inhibiting Oxidative Stress and Inflammation. Curr. Res. Food Sci. 2024, 8, 100699. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  43. Huang, W.; Liu, W.; Chen, L.; Ni, L.; Zou, X.; Ye, M.; Zhang, Z.; Zou, S. Flavonoid and Chromone-Rich Extract from Euscaphis Konishii Hayata Leaf Attenuated Alcoholic Liver Injury in Mice. J. Ethnopharmacol. 2022, 295, 115455. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  44. Ren, J.; Li, S.; Song, C.; Sun, X.; Liu, X. Black Soybean-Derived Peptides Exerted Protective Effect against Alcohol-Induced Liver Injury in Mice. J. Funct. Foods 2021, 87, 104828. [Google Scholar] [CrossRef] [Scilit]
  45. Wu, K.; Li, J.; Zhou, X.; Zhou, F.; Tang, S.; Yi, L.; Wu, Y.; Tian, S. NADH and NRH as Potential Dietary Supplements or Pharmacological Agents for Early Liver Injury Caused by Acute Alcohol Exposure. J. Funct. Foods 2021, 87, 104852. [Google Scholar] [CrossRef] [Scilit]
  46. Ding, Q.; Cao, F.; Lai, S.; Zhuge, H.; Chang, K.; Valencak, T.G.; Liu, J.; Li, S.; Ren, D. Lactobacillus Plantarum ZY08 Relieves Chronic Alcohol-Induced Hepatic Steatosis and Liver Injury in Mice via Restoring Intestinal Flora Homeostasis. Food Res. Int. 2022, 157, 111259. [Google Scholar] [CrossRef] [Scilit]
  47. Shu, X.; Wang, J.; Zhao, L.; Wang, J.; Wang, P.; Zhang, F.; Wang, R. Bifidobacterium Lactis TY-S01 Protects against Alcoholic Liver Injury in Mice by Regulating Intestinal Barrier Function and Gut Microbiota. Heliyon 2023, 9, e17878. [Google Scholar] [CrossRef] [Scilit]
  48. Guo, W.-L.; Cao, Y.-J.; You, S.-Z.; Wu, Q.; Zhang, F.; Han, J.-Z.; Lv, X.-C.; Rao, P.-F.; Ai, L.-Z.; Ni, L. Ganoderic Acids-Rich Ethanol Extract from Ganoderma Lucidum Protects against Alcoholic Liver Injury and Modulates Intestinal Microbiota in Mice with Excessive Alcohol Intake. Curr. Res. Food Sci. 2022, 5, 515–530. [Google Scholar] [CrossRef] [Scilit]
  49. Wang, W.; Yang, S.; Song, S.; Zhang, J.; Jia, F. Flammulina Velutipes Mycorrhizae Dietary Fiber Improves Lipid Metabolism Disorders in Obese Mice through Activating AMPK Signaling Pathway Mediated by Gut Microbiota. Food Biosci. 2021, 43, 101246. [Google Scholar] [CrossRef] [Scilit]
  50. Song, X.; Cui, W.; Meng, F.; Xia, Q.; Li, X.; Hou, M.; Jia, L.; Zhang, J. Glucopyranose from Pleurotus geesteranus Prevent Alcoholic Liver Diseases by Regulating Nrf2/HO-1-TLR4/NF-κB Signalling Pathways and Gut Microbiota. Food Funct. 2022, 13, 2441–2455. [Google Scholar] [CrossRef] [Scilit]
  51. Zeng, S.; Cao, J.; Wei, C.; Chen, Y.; Liu, Q.; Li, C.; Zhang, Y.; Zhu, K.; Wu, G.; Tan, L. Polysaccharides from Artocarpus Heterophyllus Lam. (Jackfruit) Pulp Alleviate Obesity by Modulating Gut Microbiota in High Fat Diet-Induced Rats. Food Hydrocoll. 2023, 139, 108521. [Google Scholar] [CrossRef] [Scilit]
  52. Tao, K.; Peng, H.; Bi, X.; Wang, X.; Tian, Y.; Zhang, H.; Sun, Y. Effect of Tetrastigma Hemsleyanum Leaves and Extract Supplementation on Liver Metabolomics and the Gut Microbiota in Alcohol-Induced Liver Injury. Food Biosci. 2024, 58, 103617. [Google Scholar] [CrossRef] [Scilit]
  53. Baweja, S.; Mittal, A.; Thangariyal, S.; Subudhi, P.D.; Gautam, S.; Kaul, R. Unveiling the Effect of Estrogen Receptors in Alcoholic Liver Disease: A Novel Outlook. Liver Res. 2023, 7, 333–341. [Google Scholar] [CrossRef] [Scilit]
  54. He, Q.; Yang, C.; Kang, X.; Chen, Y.; Zhang, T.; Zhang, H.; Kwok, L.-Y. Intake of Bifidobacterium Lactis Probio-M8 Fermented Milk Protects against Alcoholic Liver Disease. J. Dairy Sci. 2022, 105, 2908–2921. [Google Scholar] [CrossRef] [Scilit]
Figure 1. Effects of CM and FCM on the biochemical parameters of the rats. (a) Liver-to-body-weight ratio. (b) Serum ALT levels. (c) Serum AST levels. (d) Serum TG levels. (e) Liver ALDH. (f) Liver GPX. (g) Liver GSH. (h) Liver MDA. (i) Liver CAT activity. The results are expressed as means ± SD. (‘a’ and ‘b’ in the figure represent significant distinctions. p < 0.05).
Figure 1. Effects of CM and FCM on the biochemical parameters of the rats. (a) Liver-to-body-weight ratio. (b) Serum ALT levels. (c) Serum AST levels. (d) Serum TG levels. (e) Liver ALDH. (f) Liver GPX. (g) Liver GSH. (h) Liver MDA. (i) Liver CAT activity. The results are expressed as means ± SD. (‘a’ and ‘b’ in the figure represent significant distinctions. p < 0.05).
Fermentation 10 00493 g001
Figure 2. Effects of CM and FCM on the relative expression of IL-6, IL-1β, and PPAR-α in the liver. (a) Relative expression of IL-1β; (b) Relative expression of IL-6; (c) Relative expression of PPAR-α. The results are expressed as means ± SD. (‘a’ and ‘b’ in the figure represent significant distinctions. p < 0.05).
Figure 2. Effects of CM and FCM on the relative expression of IL-6, IL-1β, and PPAR-α in the liver. (a) Relative expression of IL-1β; (b) Relative expression of IL-6; (c) Relative expression of PPAR-α. The results are expressed as means ± SD. (‘a’ and ‘b’ in the figure represent significant distinctions. p < 0.05).
Fermentation 10 00493 g002
Figure 3. Effects of CM and FCM on histopathological changes in rat liver tissue (ae).
Figure 3. Effects of CM and FCM on histopathological changes in rat liver tissue (ae).
Fermentation 10 00493 g003
Figure 4. Effects of CM and FCM on the intestinal microbiota in rats. (a) Species petalograms of the microbiome in each group. The ACE index is (b). (c) Chao1 index. The Shannon index is (d). Simpson index (e).
Figure 4. Effects of CM and FCM on the intestinal microbiota in rats. (a) Species petalograms of the microbiome in each group. The ACE index is (b). (c) Chao1 index. The Shannon index is (d). Simpson index (e).
Fermentation 10 00493 g004
Figure 5. Outcomes of CM and FCM on the intestinal microbiota in rats. Rat intestinal flora relative abundance at the phylum and genus levels (a,b) within each group. (c) Relative abundance of Firmicutes. (d) Relative abundance of Bacteroidetes. (e) F/B values. (f) Relative abundance of Bacteroides. The results are expressed as means ± SDs. (Species of the top 30 in terms of abundance ranking. Different letters in the figure represent significant distinctions. p < 0.05.)
Figure 5. Outcomes of CM and FCM on the intestinal microbiota in rats. Rat intestinal flora relative abundance at the phylum and genus levels (a,b) within each group. (c) Relative abundance of Firmicutes. (d) Relative abundance of Bacteroidetes. (e) F/B values. (f) Relative abundance of Bacteroides. The results are expressed as means ± SDs. (Species of the top 30 in terms of abundance ranking. Different letters in the figure represent significant distinctions. p < 0.05.)
Fermentation 10 00493 g005
Figure 6. Differential species LEfSe maps and KEGG functional prediction analysis. (a) M vs. control differential species. (b) CM vs. M differential species. (c) FCM vs. M differential species. (d) CM vs. M differential metabolism (DMT). (e) FCM vs. M differential metabolism (DMT).
Figure 6. Differential species LEfSe maps and KEGG functional prediction analysis. (a) M vs. control differential species. (b) CM vs. M differential species. (c) FCM vs. M differential species. (d) CM vs. M differential metabolism (DMT). (e) FCM vs. M differential metabolism (DMT).
Fermentation 10 00493 g006
Figure 7. Effects of CM and FCM on liver metabolites in rats. (a) Principal component analysis (PCA) of rat liver metabolites. (b) Orthogonal partial least squares discriminant analysis (OPLS-DA) based on rat liver metabolites. (Heatmap of metabolites in mice. (c) Control vs. M. (d) M vs. CM. (e) M vs. FCM. The redder the color is, the greater the abundance of metabolites; the bluer the color, the lower the metabolites). (f) KEGG enrichment bubble plot.
Figure 7. Effects of CM and FCM on liver metabolites in rats. (a) Principal component analysis (PCA) of rat liver metabolites. (b) Orthogonal partial least squares discriminant analysis (OPLS-DA) based on rat liver metabolites. (Heatmap of metabolites in mice. (c) Control vs. M. (d) M vs. CM. (e) M vs. FCM. The redder the color is, the greater the abundance of metabolites; the bluer the color, the lower the metabolites). (f) KEGG enrichment bubble plot.
Fermentation 10 00493 g007
Table 1. Sequences of the primers used for RT-PCR.
Table 1. Sequences of the primers used for RT-PCR.
GeneForward PrimerReverse Primer
IL-6TTCTCTGGGAAATCGTGGAAATGCAAGTGCATCATCGTTGT
IL-1βGCAACTGTTCCTGAACTCAACTATCTTTTGGGGTCCGTCAACT
PPAR-αCCTGGAAAGTCCCTTATCTGCCCTTACAGCCTTCACAT
Table 2. Total time required by the drunk rats in righting reaction. (a) and (b) in the table represent significant differences. p < 0.05.
Table 2. Total time required by the drunk rats in righting reaction. (a) and (b) in the table represent significant differences. p < 0.05.
GroupMYCMFCM
Gavage time14:50–14:5615:48–15:5212:07–12:1611:58–12:02
Sober time15:27–16:1016:10–18:0013:45–12:2912:13–12:37
Mean time (min)73.50 ± 21.96 b38.00 ± 8.49 a16.25 ± 2.65 a27.00 ± 4.51 a
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Zhu, C.; Sun, W.; Luo, Y. Ameliorative Effects of Camel Milk and Fermented Camel Milk on Acute Alcoholic Liver Injury. Fermentation 2024, 10, 493. https://doi.org/10.3390/fermentation10100493

AMA Style

Zhu C, Sun W, Luo Y. Ameliorative Effects of Camel Milk and Fermented Camel Milk on Acute Alcoholic Liver Injury. Fermentation. 2024; 10(10):493. https://doi.org/10.3390/fermentation10100493

Chicago/Turabian Style

Zhu, Chunxia, Wancheng Sun, and Yihao Luo. 2024. "Ameliorative Effects of Camel Milk and Fermented Camel Milk on Acute Alcoholic Liver Injury" Fermentation 10, no. 10: 493. https://doi.org/10.3390/fermentation10100493

APA Style

Zhu, C., Sun, W., & Luo, Y. (2024). Ameliorative Effects of Camel Milk and Fermented Camel Milk on Acute Alcoholic Liver Injury. Fermentation, 10(10), 493. https://doi.org/10.3390/fermentation10100493

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop