Next Article in Journal
An Evaluation of Pig Type Regarding the Quality of Xuanwei Ham
Previous Article in Journal
Discovery and Characterization of a Novel Bacteriocin That Strongly Inhibits Staphylococcus aureus
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Fermentation
Volume 10
Issue 7
10.3390/fermentation10070356
fermentation-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Communication

Evaluating the Antagonistic Activity of Lactic Acid Bacteria in Cadaverine Production by Vibrio Strains during Co-Culture

by
Jae Hee Jeong
1,†,
Sunhyun Park
1,2,†,
Mi Jang
1,* and
Keun-sung Kim
3,*
1
Food Standard Research Center, Korea Food Research Institute, 245 Nongsaengmyeong-ro, Wanju 55365, Republic of Korea
2
Department of Food Science and Technology, Chungnam National University, 99 Daehak-ro, Yuseong-gu, Daejeon 34134, Republic of Korea
3
Department of Food Science & Biotechnology, Chung-Ang University, 4726 Seodong-daero, Daedeok-myeon, Ansung-si 17546, Republic of Korea
*
Authors to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Fermentation 2024, 10(7), 356; https://doi.org/10.3390/fermentation10070356
Submission received: 20 May 2024 / Revised: 10 July 2024 / Accepted: 12 July 2024 / Published: 15 July 2024
(This article belongs to the Section Probiotic Strains and Fermentation)
Browse Figures
Review Reports Versions Notes

Abstract

:
Vibrio cholerae and Vibrio parahaemolyticus are common pathogens linked to human gastroenteritis, particularly in seafood like shrimp. This study investigated the impact of lactic acid bacteria on V. cholerae and V. parahaemolyticus regarding the production of cadaverine, a concerning compound. V. cholerae NCCP 13589 and V. parahaemolyticus ATCC 27969 were significant producers of amines in experiments conducted using white-leg shrimp (Litopenaeus vannamei) and lysine decarboxylase broth. Notably, the Lactiplantibacillus plantarum NCIMB 6105 and Leuconostoc mesenteroides ATCC 10830 lactic acid bacteria strains demonstrated a pronounced antagonistic effect on the production of biogenic amines by these food-borne pathogenic bacteria. The presence of lactic acid bacteria led to a substantial reduction in cadaverine production in the lysine decarboxylase broth and shrimp extract. The co-culture of two lactobacilli species reduced the cadaverine production in V. cholerae and V. parahaemolyticus by approximately 77 and 80%, respectively. Consequently, the favorable influence of lactic acid bacteria in curbing cadaverine production by food-borne pathogens presents clear advantages for the food industry. Thus, effectively managing these pathogens could prove pivotal in controlling the biogenic amine levels in shrimp.

1. Introduction

Biogenic amines (BAs) are a group of low-molecular-weight organic bases produced and broken down as components of cellular metabolic activity in microorganisms, plants, and animals [1]. They are associated with diverse cellular processes, including cell growth, differentiation, and receptor function [2]. The significance of biogenic amines is particularly notable owing to their possible toxicity when accumulated at high concentrations, particularly during histamine consumption in fish and related seafood products [3].
Most biogenic amines (including cadaverine) are characterized by an unpleasant odor, toxicity, and carcinogenic properties. Exposure to these compounds can lead to a range of adverse health effects, including dizziness, fainting, headache, heart palpitations, mucosal burns, and eye irritation. Although putrescine and cadaverine are far less toxic, their interactions with amine oxidases may slow down metabolism and increase histamine toxicity [4]. Putrescine and cadaverine, which are commonly found in decomposed fish and shellfish, may generate introsopyrrolidine and nitrosopiperidine N-nitroso compounds, respectively [5]. Putrescine and cadaverine are commonly found in various shrimp products, whereas the histamine levels tend to be lower than those in shellfish products [4].
Vibrio cholerae and Vibrio parahaemolyticus are halophilic, rod-shaped, Gram-negative bacteria that are ubiquitously found in marine environments. They are globally recognized as the primary triggers of foodborne disease outbreaks associated with seafood consumption [6]. These bacteria are commonly found in aquaculture [7]. Vibrio species such as V. cholerae and V. parahaemolyticus are significant contributors to acute gastroenteritis outbreaks in humans worldwide, often linked to the ingestion of raw or inadequately cooked seafood, such as shrimp. An increased demand for such products is particularly prevalent in Asian countries and the United States [8,9].
Pathogenic microorganisms such as Vibrio spp. cause one of the diseases that frequently affect shrimp (especially Litopenaeus vannamei) aquaculture [10]. Vibrio sp. is one of the most common bacteria in the aquaculture industry, where it can cause widespread mortality in shrimp aquaculture ponds [11]. This presents a potential public health hazard and underscores the necessity for measures to reduce the bacterial presence in shrimp [12]. The Vibrio and Flavobacterium genera isolated from fish can produce cadaverine and putrescine [13]. Bacteria capable of amine formation, identified in fish and shrimp, were categorized as putrescine- and cadaverine-forming, with no detection of histamine-forming bacteria [13]. An analysis of the genome sequences of several Vibrio strains revealed genes encoding carboxyspermedine decarboxylase, diaminopimelate decarboxylase, ornithine decarboxylase, and lysine decarboxylase [14].
Probiotics were initially studied as a countermeasure against antibiotic resistance [15]. They can curb the growth of V. parahaemolyticus in in vitro co-cultures [16] and in vivo mouse models [17]. Lpb. plantarum strains isolated from shrimp intestines exhibit inhibitory effects against a wide range of Gram-positive and Gram-negative pathogenic bacteria, including Vibrio harveyi and Aeromonas hydrophila [18]. Leuconostoc mesenteroides is a lactic acid bacterium isolated from the intestines of tilapia fish and inhibits the pathogenic bacteria V. harveyi and Mycobacterium marinum [19]. These examples illustrate the main potential of lactic acid bacteria in counteracting pathogens before categorizing them as probiotics or beneficial organisms.
Current studies lack clarity on how lactic acid bacteria interact with foodborne pathogenic bacteria, specifically in terms of cadaverine and other amines’ production in living organisms. It is crucial to investigate specific strains relevant to the food industry given that biogenic amine formation seems to vary depending on the bacterial strain rather than on the species. Thus, this study aimed to elucidate the effects of lactic acid bacteria on cadaverine production by foodborne pathogenic bacteria.

2. Materials and Methods

2.1. Strains and Growth Conditions

Seven lactic acid bacteria strains were selected to screen for activity against cadaverine-producing Vibrio strains: Lpb. plantarum NCIMB 6105, Le. mesenteroides ATCC 10830, Bacillus cereus ATCC 13061 (used as a negative control), V. parahaemolyticus ATCC 27969, Lactobacillus brevis ATCC 8287, Lactobacillus curvatus ATCC 25601, Lactobacillus sakei subsp. sakei ATCC 15521, Lactococcus lactis subsp. lactis ATCC 19435, and Weissella confusa ATCC 10881. V. cholerae NCCP 13589 was acquired from the National Culture Collection for Pathogens (Cheongju, Republic of Korea). Lpb. plantarum NCIMB 6105 was purchased from the National Collection of Industrial Food and Marine Bacteria (Aberdeen, UK). The remaining bacterial strains were obtained from the American Type Culture Collection (ATCC, Manassas, VA, USA).
For V. cholerae NCCP 13589, co-culture experiments were conducted using Lpb. plantarum NCIMB 6105 and Le. mesenteroides ATCC 10830 with the Vibrio strains. Vibrio and Bacillus strains were propagated in Luria–Bertani (LB) broth (Difco, Becton Dickinson Co., Sparks, MD, USA) at 37 °C for 24 h. Lactic acid bacteria were cultured in de Man–Rogosa–Sharpe (MRS) broth (Difco) under identical conditions. Glycerol (80%) was used to prepare stock cultures, which were subsequently stored at −20 °C.

2.2. Cultivation of Vibrio Strains

White-leg shrimp (Litopenaeus vannamei) were procured from a local supermarket in Ansung, Republic of Korea. A 100 g portion of shrimp was mixed with 500 mL of sterile water and ground into a paste. The shrimp paste was filtered two to three times using a cotton cloth to eliminate impurities and was further clarified by centrifugation (5000× g for 5 min at 4 °C). The resulting supernatant was filtered using a 0.22 μm MCE membrane filter (Millipore, Billerica, MA, USA).
In a separate process, lactic acid bacteria and Vibrio strains were individually propagated in their respective broths and incubated at 37 °C for 24 h. Then, 1 mL of each culture was centrifuged at 5000× g for 10 min at 4 °C to collect the cell pellets. The collected cells were washed twice with phosphate buffer (PB, pH 7.2) and subsequently resuspended in 1 mL of prepared shrimp extract (ShE). These suspensions were stored at −20 °C until further use.

2.3. Screening of Lactic Acid Bacteria against Cadaverine-Producing Vibrio Strains

The antimicrobial activity of lactic acid bacteria was screened using a modified colony overlay method based on the protocol outlined in [20]. Briefly, 5 µL of an overnight lactic acid bacteria culture was spotted onto a fresh MRS agar plate and incubated at 37 °C for 24 h. Subsequently, the Petri plates (diameter of 90 mm) were overlaid with 5 mL of thiosulfate–citrate-bile salts–sucrose (Difco) soft agar (containing 0.5% agar) pre-mixed with 0.5 mL Vibrio culture. The presence of an inhibition zone (a clear circular area with a diameter of 10 mm or more, measured with a ruler), extending horizontally from the edge of the lactic acid bacteria spot after 24 h incubation at 37 °C, was regarded as an indicator of positive inhibition.

2.4. Co-Culturing of Vibrio spp. and Lactic Acid Bacteria

This study aimed to investigate the antagonistic effects of lactic acid bacteria on V. cholerae NCCP 13589 and V. parahaemolyticus ATCC 27969 using co-culture experiments. Lactic acid bacteria and Vibrio strains were cultured separately in broth media and incubated at 37 °C for 24 h. One mL of each incubated culture was centrifuged at 5000× g for 10 min at 4 °C to collect the cell pellets. The cells were washed twice with PB and re-suspended in 1 mL of decarboxylase medium. Each resuspended culture was inoculated into 20 mL of lysine decarboxylase broth media individually and in co-culture and incubated at 37 °C under anaerobic conditions for 48 h. The pH of the medium was adjusted to 6.5, and anaerobic conditions were maintained using an anaerobic chamber.
The culture conditions were based on the optimal growth temperature and time according to the handling information provided by the NCCP and ATCC for the individual strains. Additionally, to create conditions that maximized the cadaverine production by the Vibrio strains, the pH of the medium was adjusted to 6.5.
One mL aliquots of monoculture and co-culture suspensions were promptly collected to analyze the cadaverine production and assess the cell growth of the Vibrio strains after 4, 12, 24, and 48 h of the decarboxylation reaction period. These collected suspensions were centrifuged at 5000× g for 10 min at 4 °C. The resulting supernatant and cell pellet were used for subsequent experiments.

2.5. Quantitative Analysis of Cadaverine Using High-Performance Liquid Chromatography (HPLC)

The quantification of cadaverine by HPLC involved the centrifugation of samples of broth culture media at 26,000× g for 8 min at 4 °C, followed by filtration through a membrane (regenerated cellulose, 0.45 μm pore size) and derivatization with O-phthaldialdehyde. Samples were injected into an HPLC system equipped with a Waters 600s controller (Waters, Milford, MA, USA), Waters 474 scanning fluorescence detector (Waters, Milford, MA, USA), and Clarity Lite (Petrzilkova, Prague, Czech Republic). Fluorescence was detected at excitation and emission wavelengths of 330 and 440 nm, respectively. The molecules were separated by gradient elution using Solvent A (100 mM acetate buffer, pH 5.8) and Solvent B (100% acetonitrile) on a Nova-Pak C18 column (Waters, Milford, MA, USA) (4 μm, 3.9 mm × 150 mm). The gradient elution was as follows: 0–10 min, 40% B (isocratic); 10–11 min, 40–60% B (linear gradient); and 11–22 min, 60–65% B linear gradient. The flow rate was set at 1 mL/min, and the column temperature was maintained at 35 °C. The retention time of cadaverine was 17 min.

2.6. Quantification of Bacterial Cell Growth by Quantitative Real-Time Polymerase Chain Reaction (RT-qPCR)

The quantification of cadaverine-producing Vibrio strains and lactic acid bacteria cells was performed using RT-qPCR. After the decarboxylation reaction, the liquid cultures were subjected to centrifugation at 5000× g for 10 min at 4 °C. Subsequently, DNA was extracted from the harvested cells using a Qiagen DNeasy Blood & Tissue Kit (Qiagen, Valencia, CA, USA), following the manufacturer’s guidelines. The extracted DNA samples were used as templates for RT-qPCR analysis using an Applied Biosystems StepOnePlus Real-Time PCR System and the obtained data were analyzed using the StepOnePlus Software v2.0 (Applied Biosystems, Foster City, CA, USA). For the qPCR reaction, a reaction mixture of 20 μL was prepared, consisting of 10 μL BIOFACT™ 2X Real-Time PCR Master Mix (for SYBR Green I; BIOFACT, Daejeon, Republic of Korea), 1 μL of 10 pmol/μL of each primer, 3 μL of DNA template, and 5 μL of PCR-grade distilled water. The thermal cycling conditions included a polymerase pre-activation step at 95 °C for 15 min, followed by 40 cycles of denaturation at 95 °C for 15 s, annealing at 60 °C for 20 s, and extension at 72 °C for 30 s. Melting curve analysis was performed to verify the specificity of the qPCR products. The Ct values were automatically determined using this instrument. No template controls were included for the target genes in the PCR runs to account for potential contamination. All samples were analyzed in triplicate.
Standard curves were established for each strain based on the cycle threshold (Ct) values of serial dilutions of a 24 h enrichment culture. Briefly, DNA was extracted using a Qiagen DNeasy Blood & Tissue Kit (Qiagen, Valencia, CA, USA). Subsequently, the Ct values were plotted against the logarithms of the cell numbers to generate standard curves. Viable cell counts were determined by plating 0.1 mL of a 10−7 dilution of each culture onto LB agar for Vibrio strains and MRS agar for lactic acid bacteria strains in triplicate. The resulting colonies were counted after incubation at 37 °C for 24 h [21,22].
Standard curves were constructed to quantify the growth of V. cholerae NCCP 13589, V. parahaemolyticus ATCC 27969, Lpb. plantarum NCIMB 6105, and Le. mesenteroides ATCC 10830 using species-specific primers. For cadaverine-producing V. cholerae, a primer pair (Vc_lys_F and Vc_lys_R) was designed to amplify a 180 bp region of its ldc gene, which served as the amplification target. For V. parahaemolyticus ATCC 27969, a specific primer pair (irgB_F and irgB_R) was used to amplify a 369 bp region of the iron-regulated virulence regulatory gene [23]. For Lpb. plantarum NCIMB 6105, a species-specific primer pair (LplF and LplR) was used to amplify a 313 bp region of the cadmium–manganese transport ATPase gene (AF136521) [24]. Similarly, for Le. mesenteroides ATCC 10830, a specific primer pair (LmeF and LmeR) was used to amplify a 358 bp region of the alcohol acetaldehyde dehydrogenase gene (AY804189) [24]. The primer sequences used for RT-qPCR analysis are listed in Table 1.

3. Results and Discussion

3.1. Screening of Lactic Acid Bacteria against Cadaverine-Producing Vibrio Strains

The principle of competitive exclusion, whereby beneficial probiotic strains overpower and replace harmful pathogens, is a crucial and beneficial phenomenon that has been widely recorded across various vertebrate groups, including humans, poultry, and pigs [25]. The antimicrobial activity of the lactic acid bacteria against Vibrio strains was screened using a colony overlay method (Table 2). All seven lactic acid bacteria strains tested were active against the cadaverine-producing Vibrio strains, except for Lc. lactis subsp. lactis ATCC 19435 and W. confusa ATCC 10881, which showed no consistent activity. Seven of the tested lactic acid bacteria strains produced antimicrobial substances that were active against at least one Vibrio strain. Five lactic acid bacteria strains (Lb. brevis ATCC 8287, Lb. curvatus ATCC 25601, Lpb. plantarum NCIMB 6105, Lb. sakei subsp. sakei ATCC 15521, and Le. mesenteroides ATCC 10830) were active against both Vibrio strains. Among the seven lactic acid bacteria strains tested, Lpb. plantarum NCIMB 6105 and Le. mesenteroides ATCC 10830 showed high antibacterial activity against V. cholerae NCCP 13589 and V. parahaemolyticus ATCC 27969. Lpb. plantarum NCIMB 6105 strongly inhibited V. parahaemolyticus ATCC 27969 compared with V. cholerae NCCP 13589. Le. mesenteroides ATCC 10830 strongly inhibited V. cholerae NCCP 13589 compared with V. parahaemolyticus ATCC 27969. Lpb. plantarum NCIMB 6105 and Le. mesenteroides ATCC 10830 were selected for their strong antimicrobial effects against V. cholerae NCCP 13589 and V. parahaemolyticus ATCC 27969 and were tested in co-culture experiments with cadaverine-producing-Vibrio strains.

3.2. Cadaverine Production and Bacterial Cell Growth in Lysine Decarboxylase Broth

The effects of the lactic acid bacteria and Vibrio strains on cadaverine production when co-cultured in lysine decarboxylase broth (LDB) are shown in Figure 1a,b. After 24 h of incubation, V. cholerae NCCP 13589 and V. parahaemolyticus ATCC 27969 individually produced cadaverine amounts of 569.27 ± 28.67 and 570.33 ± 4.53 μg/spent culture mL, respectively.
Interestingly, the cadaverine production decreased to 42.37 ± 2.62 (92.98%) and 25.24 ± 15.93 μg/spent culture mL (95.61%) when V. cholerae was co-cultured with Lpb. plantarum NCIMB 6105 and Le. mesenteroides ATCC 10830, respectively. Similarly, the cadaverine production levels fell to 116.21 ± 3.32 (79.65%) and 132.11 ± 7.97 μg/spent culture mL (76.84%) when V. parahaemolyticus ATCC 27969 was co-cultured with Lpb. plantarum NCIMB 6105 and Le. mesenteroides ATCC 10830, respectively. There was a significant decrease in cadaverine production by Vibrio strains capable of producing this compound in the presence of lactic acid bacteria.
V. cholerae NCCP 13589 and V. parahaemolyticus ATCC 27969 growth significantly decreased (p < 0.05) when co-cultured with lactic acid bacterial strains compared to monocultures.
The initial bacterial cell counts for the different lactic acid bacteria strains ranged from 4.55 to 4.48 log CFU/mL, with V. cholerae NCCP 13589 having the highest cell count. After 24 h, the lactic acid bacteria strains showed a cell growth range of 5.64 to 5.90 log CFU/mL. Co-culture with Lpb. plantarum NCIMB 6105 and Le. mesenteroides ATCC 10830 significantly reduced the growth of V. cholerae NCCP 13589 and V. parahaemolyticus ATCC 27969. V. cholerae NCCP 13589 exhibited cell growth reductions of 2.13 and 2.93 log CFU/mL, respectively, while V. parahaemolyticus ATCC 27969 exhibited cell growth reductions of 1.36 and 0.86 log CFU/mL, respectively. These findings demonstrate the inhibitory effect of these lactic acid bacteria strains against pathogens (Figure 2a,b).
Various types of microorganisms or strains generate distinct amino acid decarboxylases that subsequently result in the production of different BA [26]. There was a significant reduction in V. parahaemolyticus growth (5.9 log CFU/g) following treatment with 150 mg/mL lactic acid and 300 mg/mL citric acid. These findings highlight the efficacy of lactic acid in combination V. parahaemolyticus [27].
The interaction between pathogenic bacteria and lactic acid bacteria in a co-culture involves nutrients and the production of inhibitory substances. These interactions can significantly influence the growth conditions for both groups of microorganisms, especially int the context of pH variations. Under favorable conditions for pathogenic bacteria, such as those with a neutral to slightly alkaline pH, the activity of constitutive decarboxylases like LdcC in Escherichia coli is optimal. LdcC, which has an optimum pH of 7.6, can continuously produce biogenic amines like cadaverine, contributing to the pathogenicity and survival of the bacteria in such environments [28]. Under these conditions, the inhibitory effects of lactic acid bacteria are diminished as the production of organic acids by lactic acid bacteria is not sufficient to significantly lower the pH to levels that would inhibit the pathogens. Additionally, neutral pH conditions do not favor the production of acidic compounds like bacteriocins and other organic acids that are crucial for lactic acid bacteria’s antagonistic activity [29]. Consequently, pathogenic bacteria can thrive and potentially cause spoilage or disease.
Conversely, when the conditions favor the growth of lactic acid bacteria, such as in environments where the pH is acidic, the production of organic acids like lactic acid significantly lowers the pH, creating a hostile environment for pathogenic bacteria. Lactic acid bacteria can produce a range of inhibitory substances, including bacteriocins, hydrogen peroxide, and enzymes that contribute to the inhibition of competing microorganisms [29]. The decrease in pH due to organic acid production can permeate bacterial membranes, leading to their damage and inhibiting a broad range of pathogens [30].
However, the relationship between the pH and decarboxylase activity introduces an additional layer of complexity: while a lower pH inhibits the activity of constitutive decarboxylases, it can induce the production of inducible decarboxylase like CadA, which is active at an optimum pH of 5.5 [28]. This inducible enzyme allows pathogenic bacteria to counteract the acidic conditions by producing biogenic amines that neutralize the pH to some extent. Nevertheless, the overall inhibitory environment created by lactic acid bacteria often outweighs the defense mechanisms of pathogens, leading to the reduced growth and viability of pathogenic microorganisms [31].

3.3. Cadaverine Production and Bacterial Cell Growth in Shrimp Extract Broth (ShE)

After 24 h of incubation, the monocultures of V. cholerae NCCP 13589 and V. parahaemolyticus ATCC 27969 yielded cadaverine levels of 30.02 ± 1.50 and 28.99 ± 0.24 μg/spent culture mL, respectively, in ShE broth (Figure 1c,d). However, the co-culture of V. cholerae NCCP 13589 with Lpb. plantarum NCIMB 6105 or Le. mesenteroides ATCC 10830 resulted in a significant decrease in cadaverine production, with levels measuring 7.12 ± 0.37 (76.67%) and 11.71 ± 0.3124 μg/spent culture mL (63.33%), respectively. Similarly, the co-cultivation of V. parahaemolyticus ATCC 27969 with Lpb. plantarum NCIMB 6105 or Le. mesenteroides ATCC 10830 resulted in a decrease in cadaverine production, with levels measuring 13.32 ± 0.59 (54.05%) and 15.11 ± 1.71 μg/spent culture mL (47.89%), respectively.
The co-culture of lactic acid bacterial strains with Vibrio strains resulted in a significant (p < 0.05) decrease in the growth of V. cholerae NCCP 13589 and V. parahaemolyticus ATCC 27969 compared with their growth in the monoculture. After 24 h of incubation, V. cholerae NCCP 13589 exhibited cell growth of 3.37 log CFU/mL in the monoculture. However, its cell growth decreased to 1.11 and 0.74 log CFU/mL when co-cultured with Lpb. plantarum NCIMB 6105 or Le. mesenteroides ATCC 10830, respectively. Similarly, V. parahaemolyticus ATCC 27969 showed cell growth of 2.33 log CFU/mL in the monoculture (Figure 2c,d). However, its growth was reduced to 0.46 and 0.23 log CFU/mL when co-cultured with Lpb. plantarum NCIMB 6105 or Le. mesenteroides ATCC 10830, respectively. This demonstrates that these lactic acid bacterial strains significantly inhibited the growth of V. cholerae NCCP 13589 and V. parahaemolyticus ATCC 27969 in a co-culture environment. The biogenic amine content demonstrated considerable variability across various shrimp paste samples, which could be attributed to the diverse microbial compositions of each sample [32]. Various microorganisms or strains generate distinct amino acid decarboxylases that produce different BAs [27]. Additionally, they indicate that the use of lactic acid wash solutions could provide a cost-effective, natural, and efficient method to manage V. parahaemolyticus in the oyster industry, particularly in sterilized shucked oysters [26].

4. Conclusions

This study compared cadaverine-producing Vibrio strains under two different conditions (LDB and ShE media) using lactic acid bacteria and co-cultures. Certain lactic acid bacteria strains possess beneficial properties that positively affect vertebrates and invertebrates. However, the competitive interactions between probiotics and pathogens in shrimp remain largely unexplored. In this study, we demonstrated that Lpb. plantarum and Le. mesenteroides competitively reduced the amount of cadaverine produced by V. cholerae and V. parahaemolyticus in LDB and ShE under co-culture conditions. We also confirmed the decrease in the number of Vibrio strains when co-cultured with lactic acid bacteria in LDB and ShE media, confirming the inhibitory effect of the lactic acid bacteria strains on the growth of V. cholerae and V. parahaemolyticus. The utilization of lactic acid bacteria strains in shrimp presents an interesting approach to address the challenges associated with eliminating V. cholerae and V. parahaemolyticus from shrimp prior to commercialization. Moreover, the combination of beneficial shrimp extracts and lactic acid bacteria provides a natural and attractive solution for the industry, potentially offering additional protection against the growth of V. cholerae and V. parahaemolyticus in shrimp fermentation and processed products. Further studies are needed to determine the optimal conditions for lactic acid bacteria inoculation in processed shrimp products.

Author Contributions

Conceptualization, J.H.J., S.P. and K.-s.K.; Methodology, J.H.J.; Validation, J.H.J. and K.-s.K.; formal analysis, J.H.J.; investigation, S.P.; data curation, S.P. and K.-s.K.; writing—original draft preparation, J.H.J. and S.P.; writing—review and editing, S.P., M.J. and K.-s.K.; visualization, J.H.J. and S.P.; supervision, M.J. and K.-s.K.; project administration, M.J.; funding acquisition, M.J. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Korea Food Research Institute funded by the Ministry of Science and ICT, Republic of Korea (grant number: E0211400-04) and the National Research Foundation of Korea grant funded by the Korea government (MSIT) (grant number 2018R1D1A1B07051318).

Data Availability Statement

Data are contained within the article.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Abril, A.G.; Calo-Mata, P.; Villa, T.G.; Böhme, K.; Barros-Velázquez, J.; Sánchez-Pérez, Á.; Pazos, M.; Carrera, M. High-resolution comparative and quantitative proteomics of biogenic-amine-producing bacteria and virulence factors present in seafood. J. Agric. Food Chem. 2024, 72, 4448–4463. [Google Scholar] [CrossRef] [PubMed]
  2. Baron, K.; Stasolla, C. The role of polyamines during in vivo and in vitro development. In Vitro Cell. Dev. Biol. Plant 2008, 44, 384–395. [Google Scholar] [CrossRef]
  3. Arulkumar, A.; Paramithiotis, S.; Paramasivam, S. Biogenic amines in fresh fish and fishery products and emerging control. Aquac. Fish. 2023, 8, 431–450. [Google Scholar] [CrossRef]
  4. Li, X.; Zhang, Y.; Ma, X.; Zhang, G.; Hou, H. Effects of a novel starter culture on quality improvement and putrescine, cadaverine, and histamine inhibition of fermented shrimp paste. Foods 2023, 12, 2833. [Google Scholar] [CrossRef] [PubMed]
  5. Altissimi, S.; Mercuri, M.L.; Framboas, M.; Tommasino, M.; Pelli, S.; Benedetti, F.; Bella, S.D.; Haouet, N. Indicators of protein spoilage in fresh and defrosted crustaceans and cephalopods stored in domestic condition. Ital. J. Food Saf. 2017, 6, 6921. [Google Scholar] [CrossRef] [PubMed]
  6. Correia, M.A.M. Implementation of a Presumptive Detection Method of Enteropathogenic Vibrio spp. Detection of Vibrio parahaemolyticus, Vibrio cholerae and Vibrio vulnificus. Method Audit According to ISO 21872-1. 2021. Available online: https://hdl.handle.net/10216/137773 (accessed on 19 May 2024).
  7. Vaiyapuri, M.; Pailla, S.; Rao Badireddy, M.; Pillai, D.; Chandragiri Nagarajarao, R.; Prasad Mothadaka, M. Antimicrobial resistance in Vibrios of shrimp aquaculture: Incidence, identification schemes, drivers and mitigation measures. Aquac. Res. 2021, 52, 2923–2941. [Google Scholar] [CrossRef]
  8. Wan Norhana, M.N.W.; Poole, S.E.; Deeth, H.C.; Dykes, G.A. Prevalence, persistence and control of Salmonella and Listeria in shrimp and shrimp products: A review. Food Control. 2010, 21, 343–361. [Google Scholar] [CrossRef]
  9. Chen, L.; Sun, L.; Zhang, R.; Liao, N.; Qi, X.; Chen, J. Surveillance for foodborne disease outbreaks in Zhejiang Province, China, 2015–2020. BMC Public Health 2022, 22, 135. [Google Scholar] [CrossRef] [PubMed]
  10. Supono; Harpeni, E.; Khotimah, A.H.; Ningtyas, A. Identification of Vibrio sp. as cause of white feces diseases in white shrimp Penaeus vannamei and handling with herbal ingredients in East Lampung Regency, Indonesia. AACL Bioflux. 2019, 12, 417–425. [Google Scholar]
  11. Asni, A.; Rahim, R.; Saleh, R.; Landu, A.; Muliadi, M. Correlation between water quality parameters and Vibrio sp. bacteria content in traditional Vannamei shrimp (Lithopenaeus vannamei) culture. J. Agric. 2023, 2, 121–130. [Google Scholar] [CrossRef]
  12. Cabanillas-Beltrán, H.; LLausás-Magaña, E.; Romero, R.; Espinoza, A.; García-Gasca, A.; Nishibuchi, M.; Ishibashi, M.; Gomez-Gil, B. Outbreak of gastroenteritis caused by the pandemic Vibrio parahaemolyticus O3: K6 in Mexico. FEMS Microbiol. Lett. 2006, 265, 76–80. [Google Scholar] [CrossRef] [PubMed]
  13. Lakshmanan, R.; Jeya Shakila, R.; Jeyasekaran, G. Survival of amine-forming bacteria during the ice storage of fish and shrimp. Food Microbiol. 2002, 19, 617–625. [Google Scholar] [CrossRef]
  14. Han, L.; Yuan, J.; Ao, X.; Lin, S.; Han, X.; Ye, H. Biochemical characterization and phylogenetic analysis of the virulence factor lysine decarboxylase from Vibrio vulnificus. Front. Microbiol. 2018, 9, 3082. [Google Scholar] [CrossRef] [PubMed]
  15. Özogul, F.; Hamed, I. The importance of lactic acid bacteria for the prevention of bacterial growth and their biogenic amines formation: A review. Crit. Rev. Food Sci. Nutr. 2018, 58, 1660–1670. [Google Scholar] [CrossRef]
  16. Contente, D.; Díaz-Formoso, L.; Feito, J.; Gómez-Sala, B.; Costas, D.; Hernández, P.E.; Muñoz-Atienza, E.; Borrero, J.; Poeta, P.; Cintas, L.M. Antimicrobial activity, genetic relatedness, and safety assessment of potential probiotic lactic acid bacteria isolated from a rearing tank of rotifers (Brachionus plicatilis) used as live feed in fish larviculture. Animals 2024, 14, 1415. [Google Scholar] [CrossRef]
  17. Yuan, X.; Lv, Z.; Zhang, Z.; Han, Y.; Liu, Z.; Zhang, H. A review of antibiotics, antibiotic resistant bacteria, and resistance genes in aquaculture: Occurrence, contamination, and transmission. Toxics 2023, 11, 420. [Google Scholar] [CrossRef] [PubMed]
  18. Girija, V.; Malaikozhundan, B.; Vaseeharan, B.; Vijayakumar, S.; Gobi, N.; Del Valle Herrera, M.; Chen, J.C.; Santhanam, P. In vitro antagonistic activity and the protective effect of probiotic Bacillus licheniformis Dahb1 in zebrafish challenged with GFP tagged Vibrio parahaemolyticus Dahv2. Microb. Pathog. 2018, 114, 274–280. [Google Scholar] [CrossRef] [PubMed]
  19. Wang, R.; Deng, Y.; Zhang, Y.; Li, X.; Sun, L.; Deng, Q.; Liu, Y.; Gooneratne, R.; Li, J. Modulation of intestinal barrier, inflammatory response, and gut microbiota by Pediococcus pentosaceus zy-B alleviates Vibrio parahaemolyticus infection in C57BL/6J mice. J. Agric. Food Chem. 2022, 70, 1865–1877. [Google Scholar] [CrossRef] [PubMed]
  20. Vieira, G.; Soares, M.; Bolívar Ramírez, N.; Dias Schleder, D.; Silva, B.; Mouriño, J.L.; Andreatta, E.; do Nascimento Vieira, F. Lactic acid bacteria used as preservative in fresh feed for marine shrimp maturation. Pesqui. Agropecu. Bras. 2016, 51, 1799–1805. [Google Scholar] [CrossRef]
  21. Aydin, F.; Çek, Ş. Effect of probiotics on reproductive performance of fish. Nat. Eng. Sci. 2019, 4, 153–162. [Google Scholar] [CrossRef]
  22. Dubois-Dauphin, R.; Sabrina, V.; Isabelle, D.; Christopher, M.; André, T.; Philippe, T. Biotechnology, in vitro antagonistic activity evaluation of lactic acid bacteria (LAB) combined with cellulase enzyme against Campylobacter jejuni growth in co-culture. J. Microbiol. Biotechnol. 2011, 21, 62–70. [Google Scholar] [CrossRef] [PubMed]
  23. Yu, S.; Chen, W.; Wang, D.; He, X.; Zhu, X.; Shi, X. Species-specific PCR detection of the food-borne pathogen Vibrio parahaemolyticus using the irgB gene identified by comparative genomic analysis. FEMS Microbiol. Lett. 2010, 307, 65–71. [Google Scholar] [CrossRef] [PubMed]
  24. Cho, K.M.; Math, R.K.; Islam, S.M.; Lim, W.J.; Hong, S.Y.; Kim, J.M.; Yun, M.G.; Cho, J.J.; Yun, H.D. Novel multiplex PCR for the detection of lactic acid bacteria during kimchi fermentation. Mol. Cell. Probes 2009, 23, 90–94. [Google Scholar] [CrossRef] [PubMed]
  25. Huang, J.Y.; Lee, S.M.; Mazmanian, S.K. The human commensal Bacteroides fragilis binds intestinal mucin. Anaerobe 2011, 17, 137–141. [Google Scholar] [CrossRef] [PubMed]
  26. Hao, Y.; Sun, B. Analysis of bacterial diversity and biogenic amines content during fermentation of farmhouse sauce from Northeast China. Food Control 2020, 108, 106861. [Google Scholar] [CrossRef]
  27. Nguyen Thi Truc, L.; Trinh Ngoc, A.; Tran Thi Hong, T.; Nguyen Thanh, T.; Huynh Kim, H.; Pham Kim, L.; Huynh Truong, G.; Truong Quoc, P.; Nguyen Thi Ngoc, T. Selection of Lactic Acid Bacteria (LAB) Antagonizing Vibrio parahaemolyticus: The Pathogen of Acute Hepatopancreatic Necrosis Disease (AHPND) in Whiteleg Shrimp (Penaeus vannamei). Biology 2019, 8, 91. [Google Scholar] [CrossRef] [PubMed]
  28. Liu, F.; Xu, W.; Du, L.; Wang, D.; Zhu, Y.; Geng, Z.; Zhang, M.; Xu, W. Heterologous expression and characterization of tyrosine decarboxylase from Enterococcus faecalis R612Z1 and Enterococcus faecium R615Z1. J. Food Prot. 2014, 77, 592–598. [Google Scholar] [CrossRef]
  29. Castellano, P.; Aristoy, M.C.; Sentandreu, M.A.; Vignolo, G.; Toldrá, F. Lactobacillus sakei CRL1862 improves safety and protein hydrolysis in meat systems. J. Appl. Microbiol. 2012, 113, 1407–1416. [Google Scholar] [CrossRef]
  30. Jarboe, L.R.; Royce, L.A.; Liu, P. Understanding biocatalyst inhibition by carboxylic acids. Front. Microbiol. 2013, 4, 272. [Google Scholar] [CrossRef]
  31. Wunderlichová, L.; Buňková, L.; Koutný, M.; Valenta, T.; Buňka, F. Novel touchdown-PCR method for the detection of putrescine producing Gram-negative bacteria in food products. Food Microbiol. 2013, 34, 268–276. [Google Scholar] [CrossRef]
  32. Sang, X.; Ma, X.; Hao, H.; Bi, J.; Zhang, G.; Hou, H. Evaluation of biogenic amines and microbial composition in the Chinese traditional fermented food grasshopper sub shrimp paste. LWT 2020, 134, 109979. [Google Scholar] [CrossRef]
Disclaimer/Publisher’s Note: The statements, opinions, and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.
Fermentation 10 00356 g001
Figure 1. Cadaverine production (μg/spent culture mL) by V. cholerae NCCP 13589 and V. parahaemolyticus ATCC 27969 in monoculture and co-culture with Lpb. plantarum NCIMB 6105 or Le. mesenteroides ATCC 10830. (a,b) Monoculture and co-culture in lysine decarboxylase broth. (c,d) Monoculture and co-culture in shrimp extract broth. Values are expressed as the mean ± SD (n = 3). VC, V. cholerae; VP, V. parahaemolyticus; LP, Lpb. plantarum; LM, Le. mesenteroides.
Figure 1. Cadaverine production (μg/spent culture mL) by V. cholerae NCCP 13589 and V. parahaemolyticus ATCC 27969 in monoculture and co-culture with Lpb. plantarum NCIMB 6105 or Le. mesenteroides ATCC 10830. (a,b) Monoculture and co-culture in lysine decarboxylase broth. (c,d) Monoculture and co-culture in shrimp extract broth. Values are expressed as the mean ± SD (n = 3). VC, V. cholerae; VP, V. parahaemolyticus; LP, Lpb. plantarum; LM, Le. mesenteroides.
Fermentation 10 00356 g001
Fermentation 10 00356 g002
Figure 2. The cell counts of V. cholerae NCCP 13589 and V. parahaemolyticus ATCC 27969 in monoculture and co-culture with Lpb. plantarum NCIMB 6105 and Le. mesenteroides ATCC 10830. (a,b) Monoculture and co-culture in lysine decarboxylase broth. (c,d) Monoculture and co-culture in shrimp extract broth. Values are expressed as the mean ± SD (n = 3). VC, V. cholerae; VP, V. parahaemolyticus; LP, Lpb. plantarum; LM, Le. mesenteroides.
Figure 2. The cell counts of V. cholerae NCCP 13589 and V. parahaemolyticus ATCC 27969 in monoculture and co-culture with Lpb. plantarum NCIMB 6105 and Le. mesenteroides ATCC 10830. (a,b) Monoculture and co-culture in lysine decarboxylase broth. (c,d) Monoculture and co-culture in shrimp extract broth. Values are expressed as the mean ± SD (n = 3). VC, V. cholerae; VP, V. parahaemolyticus; LP, Lpb. plantarum; LM, Le. mesenteroides.
Fermentation 10 00356 g002
Table 1. Quantitative real-time PCR (RT-qPCR) target genes and primers.
Table 1. Quantitative real-time PCR (RT-qPCR) target genes and primers.
SpeciesTarget GenePrimer NameOligonucleotide Sequence (5′→3′)Amplicon (bp)Melting Temperature (°C)Reference
V. choleraeLysine decarboxylaseVc_lys_FGCTTGACGGAGTTCAAACGC18080This study
Vc_lys_RGATGTACAAAGCGTTCGATG
V. parahaemolyticusIron-regulated virulence protein irgB_FCGATACACACCACGATCCAG36984[23]
irgB_RATACGGCCGGGGTGATGTTTCT
Lpb. plantarumCadmium–manganese transport ATPaseLplFAAGGCCGTAGTCAGTCGTCTATGG31378[24]
LplRTCAACCACACGAATATCAGCCGG
Le. mesenteroidesAlcohol-acetaldehyde dehydrogenaseLmeFGAGCCGTTATTCAAGCACCAATC35885[24]
LmeRCCTGCGCCTTGATAGTTTAACAAG
Table 2. Antimicrobial activity of lactic acid bacteria selected against Vibrio strains.
Table 2. Antimicrobial activity of lactic acid bacteria selected against Vibrio strains.
Tested BacteriaV. cholerae NCCP 13589V. parahaemolyticus ATCC 27969
Lactic acid bacteriaLb. brevis ATCC 8287++
Lb. curvatus ATCC 25601++
Lpb. plantarum NCIMB 6105+++++
Lb. sakei subsp. sakei ATCC 15521++
Lc. lactis subsp. lactis ATCC 19435+-
Le. mesenteroides ATCC 10830+++++
W. confusa ATCC 10881-+
The different scores reflect different degrees of growth inhibition: -, no inhibition; +, 10–12 mm inhibition zone; ++, 13–15 mm inhibition zone; +++, 16–18 mm inhibition zone. All experiments were performed at least twice.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Jeong, J.H.; Park, S.; Jang, M.; Kim, K.-s. Evaluating the Antagonistic Activity of Lactic Acid Bacteria in Cadaverine Production by Vibrio Strains during Co-Culture. Fermentation 2024, 10, 356. https://doi.org/10.3390/fermentation10070356

AMA Style

Jeong JH, Park S, Jang M, Kim K-s. Evaluating the Antagonistic Activity of Lactic Acid Bacteria in Cadaverine Production by Vibrio Strains during Co-Culture. Fermentation. 2024; 10(7):356. https://doi.org/10.3390/fermentation10070356

Chicago/Turabian Style

Jeong, Jae Hee, Sunhyun Park, Mi Jang, and Keun-sung Kim. 2024. "Evaluating the Antagonistic Activity of Lactic Acid Bacteria in Cadaverine Production by Vibrio Strains during Co-Culture" Fermentation 10, no. 7: 356. https://doi.org/10.3390/fermentation10070356

APA Style

Jeong, J. H., Park, S., Jang, M., & Kim, K. -s. (2024). Evaluating the Antagonistic Activity of Lactic Acid Bacteria in Cadaverine Production by Vibrio Strains during Co-Culture. Fermentation, 10(7), 356. https://doi.org/10.3390/fermentation10070356

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop