Efficient Biosynthesis of Ectoine in Recombinant Escherichia coli by Biobrick Method

Abstract

Ectoine is a compatible solute naturally produced in some halophilic bacteria as a protective agent for survival in salty environments. It has gained special interest as a therapeutic agent in the pharmaceutical and healthcare sectors for the treatment of different diseases. Ectoine mainly produced by bacterial milking, chemical, and fed-batch fermentation methods under a high-salt medium. Unfortunately, the ectoine yield through these methods is still too low to meet high industrial demand, causing salinity issues. The biobrick method was potentially utilized for efficient ectoine biosynthesis under a low-salt medium with different conditions in E. coli BL21(DE3) harboring the pET-22bNS-EctA-EctB-EctC plasmid. Firstly, three genes, L-2,4-diamino-butyric acid acetyltransferase (ectA), L-2,4-diaminobutyric acid transaminase (ectB), and ectoine synthase (ectC) from Bacillus pseudofirmus OF4, were precisely assembled and expressed into E. coli BL21(DE3). After optimizing the reaction conditions in a whole-cell catalytic reaction [50 mM of the sodium phosphate buffer (pH~7.5) containing 300 mM L-aspartic acid, 100 mM glycerol, 1/20 g/mL cell pellets], the amount of ectoine in the plasmid pET-22bNS-A_LacB_TacC_Tac reached the maximum level of 167.2 mg/mL/d (6.97 mg/mL/h). Moreover, Western blot analysis revealed that high expression levels of EctA and EctC had a significant effect on ectoine biosynthesis, indicating that both proteins might be the key enzymes in ectoine production. We conclude that a high amount of ectoine achieved through the biobrick method and efficiently used for different industrial applications.

1. Introduction

Ectoine is a compatible solute produced naturally in some halophilic bacteria for maintaining the osmotic balance across the cell membrane [1]. Besides the function of osmotic counterweight, ectoine also protects the cell membrane, DNA, and proteins from high osmolarity and extreme temperature. It also prevents the denaturation of cells caused by chemical agents and heating [2]. It has gained special interest in different industrial sectors due to its wide range of applications. In pharmaceutical industries, it is used for potential lung cancers, Alzheimer’s disorders, allergic rhinitis, and respiratory infections [3,4]. It is utilized as a stabilizer in the enzyme industry to accelerate the catalytic activity of lipase, thus promoting biodiesel production [5]. Its annual demand has reached about USD 1000 kg⁻¹ in the global market and is gradually increasing with high enabled efficacy [6].

Ectoine as the compatible solute was first isolated in Ectothiorhodospira halochloris [7]. Subsequently, some moderate halotolerant bacteria, such as Halomonas elongate, are capable of producing an adequate amount of ectoine for survival in saline environments [8]. The biosynthetic pathway of ectoine comprising different metabolic routes predominantly initiated through the activation of L-aspartate-phosphate, which is potentiallyconverted into L-aspartate-beta-semialdehyde by the action of Ask and Asd. Three important enzymes such as EctA, EctB, and EctC catalyze the subsequent reactions of ectoine biosynthesis. EctA and EctB mainly catalyze their effective conversion to the formation of L-2,4-diaminobutyric acid and N-γ-acetyldiaminobutyric acid. EctC then precisely degrades them into ectoine through a cyclization reaction. The potential genes for the biosynthetic pathway of ectoine are organized together into an operon unit (ectABC), and their expression is usually induced under high osmolarity or extreme temperature [9,10].

Ectoine can be produced through chemical, bacterial milking, and fed-batch fermentation methods [11]. Through the chemical method, ectoine is produced by directly heating the mixture of N-Acetyl diaminobutyric acid and n-butanol at 37 °C for 48 h and produces only 50% yield of ectoine [12]. The chemical synthesis produces a low yield due to the poor insolubility of N-Acetyl diaminobutyric acid [13]. Through the bacterial milking method, an ectoine amount of 7.4 mg/mL/d was produced by the halophilic eubacterium H. elongate DSM142 under a high concentration (2.57 M) of NaCl medium [14]. Another study by Sauer et al. [15] reported that through the bacterial milking method, the engineered H. salina BCRC17875 strain had produced 7.61 mg/mL/d of ectoine in the presence of a high concentration (2.47 M) of NaCl salt medium. The bacterial milking method has some disadvantages, such as salinity issues and a complicated operational design [15]. Fed-batch fermentation is another method used for ectoine production. Chen et al. [16] demonstrated that through fed-batch fermentation, a low amount of ectoine of about 1.5 mg/mL/d was produced from Halomonas elongata BK-AG25 [16]. Overall, these methods causing the salinity issues eventually produce a low yield of ectoine due to the complicated operational design and cannot be efficiently developed for precise large-scale of the bioproduction [17]. A reliable method is immediately needed in biological high needs of ectoine production under a low-salinity medium.

The biobrick method is one of the simple, reliable, and efficient approaches that emerged for the synthesis of different bioproducts [18]. Through this method, various gene clusters are particularly digested by specific isocaudomers (NdeI, XhoI, NotI, SpeI, etc.), generating shorter DNA fragments that could be easily assembled into a suitable expression vector [19]. Biobrick has several advantages over conventional methods. For instance, in contrast to the bacterial milking method, the utilization of a low concentration of salt in the biobrick method could conquer the salinity issues that remain unresolved through the bacterial milking method. Through the biobrick method, different combinations of recombinant vectors are easily constructed and assembled into the bacterial expression system with high yield, which is not possible through the chemical or bacterial milking method [20]. The biobrick method efficiently allows the amplification of genetic assembly only once rather than multiple times, which can decrease the risk of PCR-derived mutations, while additional molecular cloning is required in fed-batch fermentation methods, which can increase the risk of PCR-derived mutations [21]. Comprehensively, these emerging features of the biobrick approach could contribute an excellent opportunity to reveal high ectoine production.

In this study, the biobrick method was employed for ectoine biosynthesis in E. coli BL21(DE3) containing plasmid with ectA, ectB, and ectC genes from B. pseudofirmus OF4. The optimization process in the whole-cell catalysis was smoothly and precisely carried out under different reaction conditions. The synthetic efficiency among various recombinant strains was potentially examined by substituting the T7 promoter with the distinct promoters P_Trc, P_Tac, and P_Lac. Moreover, the interrelation between the gene expression level and promoter nature was precisely evaluated through Western blot analysis.

2. Materials and Methods

2.1. Bacterial Strains and Plasmids

E. coli DH12S and BL21(DE3) strains were employed for the analysis of molecular cloning. Different plasmids pUC57-Trc, pUC57-Tac, and pUC57-Lac containing the P_Trc, P_Tac, and P_Lac promoters were synthesized by the Sangon-Biotech company (Shanghai, China). The potential expression vectors pET-22b(+) and pGEX-4T-1 were utilized for the protein expression and were obtained from the Novagen company (Darmstadt, Germany). The pET-22bNS vector with NheI and SpeI recognition sites was efficiently constructed by our lab protocols. The restriction enzymes (NheI, BglII, NdeI, XhoI, NotI, SpeI) were obtained from the Takara company (Dalian, China). Ectoine was purchased from Sigma-Aldrich (St. Louis, MO, USA). Ampicillin, IPTG, and L-Aspartic acid were bought from the Sangon Biotech Company (Shanghai, China). Moreover, all other biochemical reagents were potentially employed in this study with analytical grades.

2.2. Construction of the Expression Plasmids

Three genes, ectA_OF4, ectB_OF4, and ectC_OF4, were initially extracted from B. pseudofirmus OF4 according to their nucleotide sequences (GenBank IDs: ADC50208.1, ADC50207.1, ADC50206.1) and amplified through PCR reaction with primer combinations as shown in

Table 1. Shows various types of primer designs in this study.

Primers.	Target Sequence (5′→3′)	Description
EctA F01 EctA R01 EctB-F01 EctB-R01 EctC-F01 EctC-R01	GCATATGTGGGAATTAGTTAATC CCTCGAGCCTTAATGGTCCAATTC GCATATGAA ACA AACTGA TATG AGAGCTCGTTAGCAACAGGCTCAG GCATATGAA AGT AGTAGCTCT ACTCGAGTTCGTCATCAACTACTG	ectA gene cloning ectB gene cloning ectC gene cloning

The underlined nucleotide sequences are targeted sites for NdeI, XhoI, and SacⅠ restriction endonucleases.

. Their cloning into the plasmid pET-22bNS was carried out utilizing the restriction sites of NdeI, XhoI, and SacI for construction of the potential plasmids pET-22bNS-EctA, pET-22bNS-EctB, and pET-22bNS-EctC. Then, enzymatic digestion of the plasmid pET-22bNS-EctB was potentially screened and performed by the restriction enzymes BglII and SpeI and further cloned into the BglII and NheI (Isocaudomer of SpeI) recognition sites of the plasmid pET-22bNS-EctA for construction of plasmid pET-22bNS-EctA-EctB. Moreover, BglII and SpeI restriction enzymes were efficiently utilized for the potential digestion of the new plasmid pET-22bNS-EctC and further cloned into the cloning targeted sites of BglII and NheI of the plasmid pET-22bNS-EctA-EctB. As a result of this subsequent digestion and process, pET-22bNS-EctA-EctB-EctC was constructed through the biobrick approach as shown in Figure 1A,B).

Then, three plasmids pUC57-Trc, pUC57-Tac, and pUC57-Lac were enzymatically digested by BglII and XhoI. Then, plasmid pET-22bNS with P_T7 promoter was substituted with distinct promoters (P_Trc, P_Tac, and P_Lac) for construction of the three expression vectors pET-22bNS_Trc, pET-22bNS_Tac, and pET-22bNS_Lac. Finally, the cloning of three genes, ectA_OF4, ectB_OF4, and ectC_OF4 were subsequently inserted into the vectors pET-22bNS_Trc, pET-22bNS_Tac, and pET-22bNS_Lac. As a result, different co-expression plasmids were potentially made and constructed.

2.3. Heterogeneous Protein Purification

The recombinant plasmids pET-22bNS-EctA, pET-22bNS-EctB, pET-22bNS-EctC, and pET-22bNS-EctA-EctB-EctC were constructed through the biobrick approach and successfully introduced into E. coli BL21 (DE3). The recombinant strains were grown into the 100 mL solution of the precise LB medium with 100 mg/mL solution of ampicillin at 37 °C and cultured at 180 rpm in the rotary shaker (Zhicheng Inc., Shanghai, China) until the optical density value (OD₆₀₀) of around 0.5–0.6 was approached. Then, 1.0 mM of IPTG solution was precisely added to the culture media to induce the expression, and cells were continuously grown at 28 °C for 12 h. The induced cells were centrifuged at 8000 rpm for 10 min and agitated by disruption through into 10 mL lysis buffer containing 50 mM of NaH₂PO₄ (pH~8.0). The undergoing sonicated cells were centrifuged at 10,000 rpm for 15 min and the precipitate was discarded. Finally, the His₆ or GST-tagged recombinant proteins were collected and purified by affinity chromatography by the manufacturer’s instructions (ThermoFisher Scientific, Waltham, MA, USA).

The dialysis and desalting of the purified proteins OF4EctA, OF4EctB, and OF4EctC were performed into the phosphate buffer (20 mM, pH 8.0) containing 0.5 mM of EDTA, 0.01% of 2-mercaptoethanol at 4 °C. The protein purity was finally evaluated through SDS-PAGE analysis.

2.4. Protein Expression Analysis

The protein expression was evaluated through Western blotting analysis. The experiment was performed on fifteen male mice comprising the three groups, with five mice placed in each group. Then, different doses of peritoneal injections (50 μg, 100 μg, 150 μg, and 200 μg) with a combination of recombinant proteins, OF4EctA, OF4EctB, and OF4EctC, were given four times to each group for immunization. The serum was obtained and subjected to centrifugation at 2000 rpm for 20 min. The expression levels of OF4EctA, OF4EctB, and OF4EctC proteins were evaluated through Western blotting analysis with a high-sensitivity chemiluminescence kit (CoWin Biosciences Inc., Beijing, China).

2.5. Ectoine Detection

Ectoine content was detected through HPLC analysis by following a method previously described with slight modifications [15]. The reaction mixture was precisely filtered through a 0.22 μm membrane and determined with HPLC analyzer (Shimadzu LC-2040C, Kyoto, Japan) using a WondaSil C18-WR column (4.6 mm × 250 mm, 5.0 μm) with acetonitrile/water (80:20 v/v) as a mobile phase with a flow rate of 1.0 mL/min. The ectoine product was detected with UV-detector at wavelength of 210 nm, and its retention time was determined by using the commercial product from Sigma-Aldrich.

2.6. Optimizing Conditions for Ectoine Biosynthesis

2.6.1. Optimization of pH

For optimization of pH value, the reaction mixture with 20 mL solution [50 mM phosphate buffer at different values (6.0, 6.5, 7.0, 7.5, and 8.0) containing 100 mM of L-aspartic acid, 100 mM of KCl, 100 mM of glycerol] was resuspended into 1.0 g of the induced cells. The resultant mixture was incubated at 30 °C with agitation at 200 rpm for 24 h. Finally, the optimal pH of the reaction was determined by determining the ectoine amount of the final reaction solution.

2.6.2. Reaction Temperature

For optimization of reaction temperature, the reaction mixture containing the 20 mL of PBS (50 mM, pH~7.5) with 100 mM of L-aspartic acid, 100 mM of KCl, 100 mM of glycerol] was resuspended into 1.0 g of the induced cells. The resultant mixture was agitated at different temperatures (25 °C, 30 °C, 35 °C, 40 °C, 45 °C, 50 °C, 55 °C) with 200 rpm rotation for 24 h. The optimal reaction temperature was determined.

2.6.3. L-aspartic Acid Concentration

For optimization of L-aspartic concentration, the reaction mixture containing the 20 mL of reaction solution [50 mM phosphate buffer: pH~7.5), 100 mM of KCl, 100 mM of glycerol], and different concentrations of substrate (L-aspartic acid: 0 mM, 50 mM, 100 mM, 150 mM, 200 mM, 250 mM] was resuspended into 1.0 g of the induced cells. The resultant mixture was agitated at 40 °C with 200 rpm rotation for 24 h. Finally, the optimal concentration of L-aspartic acid was potentially evaluated.

2.6.4. Optimization of KCl

For optimization of KCl concentration, the reaction mixture containing the 20 mL phosphate buffer (50 mM, pH~7.5) with 150 mM of L-aspartic acid and 100 mM of glycerol, and different concentrations of KCl (0 mM, 50 mM, 100 mM, 150 mM, 200 mM, 250mM) was resuspended into 1.0 g of the induced cells. The resultant reaction mixture at 200 rpm was better rotated for 24 h at 40 °C incubator (Zhicheng Inc., Shanghai, China). Subsequently, the optimal concentration of KCl was precisely evaluated.

2.6.5. Mass-to-Volume Ratio of Cell Pellets

The harvested cells with different ratios (1/20, 1/40, 1/60, 1/80, 1/100 g/mL) were separately resuspended into 20 mL phosphate buffer (50 mM pH~7.5) containing 150 mM of L-aspartic acid and 100 mM glycerol, and the resultant reaction mixture was performed at 40 °C with 200 rpm rotation for 24 h. Finally, the optimal mass-to-volume ratio was precisely screened out.

2.6.6. Reaction Time

For optimization of reaction time, the reaction mixture [20 mL phosphate buffer (50 mM pH 7.5) containing 150 mM of L-aspartic acid and 100 mM of glycerol] was incubated at 40 °C with shaking at 200 rpm for different reaction times (3.0, 6.0, 9.0, 12.0, 15.0, 18.0, 21.0, 24.0, 27.0, 39.0, 48.0, and 63.0 h) and was precisely resuspended into 1.0 g of the induced cells. The optimal reaction time was precisely confirmed by quantifying the amount of ectoine.

2.6.7. Protein Induction

E. coli BL21 (DE3) with pET-22bNS-EctA-EctB-EctC plasmid was cultured into 100 mL of LB medium with 100 mg/mL solution of ampicillin at 37 °C in the rotary shaker at 180 rpm. The recombinant proteins were precisely induced under various conditions:

Concentration of inducer: When the optical density value (OD₆₀₀) with 0.5–0.6 was potentially approached, varying IPTG (0, 0.25, 0.50, 0.75, 1.0, and 1.25 mM) were added to the fine culture and undergoing incubated at 28 °C for 15 h for the protein expression.

Induction temperature: When OD₆₀₀ value around 0.5-0.6 was precisely approached, the recombinant protein induction was carried out by 0.5 mM IPTG under different temperatures (20, 25, 28, 30, 37 °C) for 15.0 h.

Induction time: When the optical density value (OD₆₀₀) with 0.5-0.6 was approached, the recombinant protein induction was performed at 28 °C with 0.5 mM IPTG addition at different intervals (3.0, 6.0, 9.0, 12.0, 15.0, 18.0, 21.0 h).

After induction, the 20 mL of reaction mixture solution [50 mM phosphate buffer (pH~7.5), 150 mM L-aspartic acid, and 100 mM glycerol] was resuspended in 1.0 g of the induced cells and incubated at 40 °C for 3 h with 200 rpm rotation. Finally, the optimal concentration of IPTG, induction temperature, and induction time were potentially estimated.

2.6.8. Effect of Promoter

The pre-cultured bacterial strain carrying all tandem co-expression plasmids containing the different types of promoter’s combinations (pET-22bNS-EctA-EctB-EctC and pET-22bNS-EctA_Trc/Tac/Lac-EctB_Trc/Tac/Lac-EctC_Trc/Tac/Lac) were efficiently induced at 28 °C for 15 h with the addition of 0.5 mM IPTG, respectively. Following centrifugation, 1.0 g of harvested pellets were resuspended into 20 mL of reaction solution at 40 °C for 3 h under 200 rpm rotation. Finally, the effect of the promoter was potentially examined.

2.6.9. Bacterial Reusability

For optimization of the reusability of the cell pellets, the reaction mixture with 20 mL solution [50 mM phosphate buffer (pH~7.5), 300 mM of L-aspartic acid, and 100 mM of glycerol] was resuspended into 1.0 g of the induced cells, and the resultant reaction mixture was separately incubated at 40 and 60 °C at 200 rpm for 3.0 h. After centrifugation, 1.0 g of collected bacterial pellets were resuspended into 20 mM of fresh reaction solution as the catalysts for the next round of ectoine synthesis. The bacterial reusability of bacterial pellets was determined.

2.7. Stress Resistance Effects

2.7.1. Salt Tolerance

To evaluate the behavior towards stress resistance under salt medium, E. coli BL21(DE3) with pET-22bNS-EctA-EctB-EctC plasmid was incubated into the LB medium containing the ampicillin with shaking at 37 °C until the OD₆₀₀ value was approached around 0.5 value. Then, 0.1 mM of IPTG and different concentrations of NaCl solution (4%, 6%, 8%, 10%) were added to the reaction mixture, and the growth of the bacteria (OD₆₀₀) was continuously monitored at an interval of 5 h. The plasmid pET-22bNS was used in this experiment as a negative control, and salt tolerance results were expressed in percentage.

2.7.2. pH Tolerance

The pre-cultured bacteria with pET-22bNS-EctA-EctB-EctC were incubated in LB medium by addition of 0.1 mM of IPTG and at different pHs (adjusted to 8.9, 9.5, and 10.0 with addition of 2 M NaOH). The changing growth trend of bacteria (OD₆₀₀) was monitored with a spectrophotometer at an interval of 5 h. The plasmid pET-22bNS was employed as a negative control, and pH tolerance results were recorded with changing trend to the incubation time.

2.8. Sequencing Analysis

The nucleotide sequences with different gene combinations were determined with an Illumina NovaSeq 6000 platform (Illumina, San Diego, CA, USA). Moreover, the protein sequences of OF4EctA, OF4EctB, and OF4EctC were accessed through the information to the GenBank with distinguished accession numbers of ADC50208.1, ADC50207.1, ADC50206.1.

3. Results

3.1. Construction of Co-Expression Vectors

Three genes, ectA_OF4, ectB_OF4, and ectC_OF4, were amplified and then cloned into a pET-22bNS vector for the construction of recombinant plasmids pET-22bNS-EctA, pET-22bNS-EctB, pET-22bNS-EctC, and pGEX-4T-EctC. Through the biobrick approach, pET-22bNS-EctA-EctB-EctC and all three-gene co-expression plasmids with different promoter (P_Lac, P_Tac, and P_Trc) combinations were successfully constructed, as shown in Figure 1A,B. The successful gene expression of screened recombinant plasmids ensured the high synthetic efficiencies of ectoine.

3.2. Purification Analysis of EctA, EctB, and EctC Recombinant Proteins

The purified proteins EctA, EctB, and EctC were subjected to SDS-PAGE analysis for protein purification. The detected molecular masses of individual purified proteins were about 17.0, 48.0, and 41.0 kDa (Figure 2), which corresponded to the predicted molecular masses of around 17.3 (EctA with His₆-tag), 47.8 (EctB with His₆-tag), and 40.8 kDa (EctC with GST-tag). It was finely observed that the expression level of purified proteins EctB and EctA were higher than protein EctC.

3.3. Optimizing Conditions for First Screening with T7 Promoter

The reaction mixture sample was obtained through the optimization process and subjected to HPLC analysis for biological precise ectoine detection (Supplementary file data: Figure S1). The amount of ectoine was measured. The retention time of the ectoine standard substance was 2.10 min, and the ectoine product was detected at a wavelength of 210 nm.

The amount of ectoine was efficiently detected in the reaction mixture. The maximum amount of ectoine of about 1.4 mg/mL was potentially achieved with 7.5 as the optimal pH in 24 h (1.4 mg/mL/d) (Figure 3A). The effect of temperature was investigated, and the results indicated that the amount of ectoine reached about 0.9-1.4 mg/mL within the temperature range of 25-35 °C in 24 h (0.9-1.4 mg/mL/d) (Figure 3B). The production was relatively stable at a temperature of 40 °C, achieving the maximum amount of about 2.20 mg/mL/d, and further increasing of the temperature might inhibit the reaction due to enzyme denaturation and ultimately slow down the production. Therefore, the reaction was optimized at 40 °C for subsequent experiments to achieve the maximum amount of ectoine.

Different concentrations of L-aspartic acid were precisely added to the reaction mixture to evaluate their impact on ectoine production. The maximum amount of ectoine of about 5.1 mg/mL was achieved with 150 mM utilization of L-aspartic acid in 24 h (5.1 mg/mL/d) (Figure 3C). However, further increasing the concentration of L-aspartic acid to 250 mM might interfere with the reaction, and the ectoine amount was decreased to 4.0 mg/mL/d. Therefore, the reaction was optimized at 150 mM of L-aspartic acid for subsequent experiments to achieve the maximum amount of ectoine. High ectoine production was achieved at a low concentration of KCl, and utilization of elevated concentrations of KCl might inhibit the production of ectoine and ultimately increase the experimental costs (Figure 3D). Therefore, there is no need for their addition to the optimization process due to the perspective of experimental costs. The concentration of cell pellets was also optimized for accelerating ectoine production. The maximum production of about 6.7 mg/mL was approached with 1/20 g/mL utilization of cell pellets in 24 h (6.7 mg/mL/d) (Figure 3E). The maximum amount of ectoine of about 7.3 mg/mL/d was achieved within the 3 h reaction time. However, the concentration of ectoine gradually decreased to 3.6 mg/mL with the further increase in reaction time to 63.0 h (Figure 3F). Therefore, the optimal reaction time was set as 3.0 h to achieve high production.

Ectoine production was also optimized by following the IPTG concentrations, induction temperature, and induction time. The maximum amount of ectoine of about 3.4 mg/mL was achieved with a 0.5 mM concentration of IPTG, and further increased IPTG concentrations led to a decrease in the production of ectoine (Figure 4A). The maximum amount of ectoine was potentially reached at around 4.0 mg/mL under an induction temperature of 28 °C (Figure 4B). The maximum amount of ectoine of about 9.8 mg/mL was achieved within 15 h of induction time and rapidly decreased to 6.0 mg/mL when further increasing the induction time to 21 h (Figure 4C). Therefore, 15 h was selected as the optimal induction time for attaining high ectoine production.

3.4. Effect of Promoter

Different recombinant strains were potentially screened out according to the optimal reaction conditions of the strain harboring plasmid pET-22bNS-EctA-EctB-EctC, as shown in Figure 5A. The concentration of ectoine synthesized by each recombinant strain was efficiently detected through HPLC analysis. The novel recombinant strain containing plasmid pET-22bNS-EctA-EctB-EctC (No. 22: pET-A_T7B_T7C_T7) produced the maximum amount of about 3.9 mg/mL of ectoine. However, in comparison to all other strains, only two recombinant strains, pET-A_LacB_TacC_Tac (No. 13) and pET-A_TrcB_LacC_Trc (No. 18), produced high amounts of ectoine, 3.3 mg/mL and 4.0 mg/mL, that were close to the strain containing plasmid pET-A_T7B_T7C_T7. Therefore, according to the results of the preliminary screening, the recombinant plasmids pET-A_LacB_TacC_Tac (No. 13) and pET-A_TrcB_LacC_Trc (No. 18) with high producers of ectoine were potentially selected for further verification and optimization.

3.4.1. Optimization Conditions for Second Screening under Different Promoters

In the second screening, after the T7 promoter was replaced with different Ptrc, Ptac, and Plac promoters, an optimization process was carried out under different reaction conditions. With increasing reaction temperature, ectoine production was also increased at a certain level; the amount of ectoine was achieved at about 4.1 mg/mL (No. 13) and 5.4 mg/mL (No. 18) at 40 °C and further increased to 8.6 mg/mL (No. 13) and 8.0 mg/mL (No. 18) at 60 °C (Supplementary file: Figures S2A and S3A). Although increasing the reaction temperature might increase the amount of ectoine, the reaction could be inhibited at high temperatures due to enzyme denaturation. To verify the effect of high temperature on ectoine synthesis, two reaction temperatures of 40 °C and 60 °C were selected for further verification. The concentration of L-aspartic was optimized under different temperatures. At 40 °C, the reaction was optimized with 300 mM substrate concentration, and an amount of ectoine of about 17.2 mg/mL was achieved for strain (No. 13) and 5.9 mg/mL for strain (No. 18) (Suppl file: Figures S2B and S3B). At 60 °C, the reaction was optimized with 300 mM substrate concentration, and the amount of ectoine reached about 17.0 mg/mL in strain (No. 13) and 14.8 mg/mL for strain (No. 18) (Suppl file: Figures S2C and S3C). Although production could be increased under higher concentrations of substrate, a high concentration of L-aspartic acid could increase the cost of the experiment and reduce the pH value of the reaction solution, leading to suppression of the reaction. Therefore, the reaction was optimized at 300 mM substrate concentration.

The ectoine production was relatively stable at 40 °C, and bacterial reusability time was high during the optimization process (Suppl file: Figures S2D and S3D). At 60 °C, the bacterial reusability time was low, and a maximum amount of ectoine of about 20.9 mg/mL was achieved for strain (No. 13) and 19.6 mg/mL for strain (No. 18) under low bacterial reutilization because high temperature caused the denaturation of the enzyme or proteins (Suppl file: Figures S2E and S3E).

3.4.2. Comparison of Ectoine Production among Different Recombinant Strains

At 40 °C, the recombinant strain with plasmid pET-A_LacB_TacC_Tac (No. 13) and pET-A_TrcB_LacC_Trc (No. 18) produced an amount of ectoine approximately 5.1 mg/mL and 7.8 mg/mL with synthesis efficiencies (62.4 mg/mL/d and 40.8 mg/mL/d). However, a low amount of ectoine about 3.9 mg/mL was produced with the No. 22 strain (Figure 5B). At 60 °C, the recombinant strain with plasmid No. 13 and No. 18 produced a much higher amount of ectoine of about 20.9 mg/mL and 19.6 mg/mL with synthesis efficiencies (167.2 mg/mL/d and 157.6 mg/mL/d) (Figure 5C). While on the other hand, strain No. 22 had produced a little bit of a low amount of ectoine of 17.1 mg/mL (136.8 mg/mL/d). It was revealed that at 60 °C, the recombinant strain No. 13 could produce a high amount of ectoine due to its high synthetic efficiency, as indicated by its high expression levels illustrated in the next section, relative to No. 18 and No. 22.

3.5. Protein Expression Analysis

The purified proteins EctA, EctB, and EctC were used as positive controls and set as 100%, respectively. Western blot analysis revealed that the recombinant strain with plasmid No. 13 (pET-22bNS-A_LacB_TacC_Tac) has relatively higher expression levels of EctA (154.3%), EctB (391.8%), and EctC (1482.1%) compared with strain No. 22 (EctA, 53.0%; EctB, 54.1%; EctC, 594.2%) and plasmid No. 18 (EctA, 95.5%; EctB, 14.4%; EctC, 1916.3%) (Figure 6A–C). These results confirmed that the high protein expression level observed in the recombinant strain with plasmid No. 13 revealed that a high amount of ectoine was potentially synthesized at a high reaction temperature (60 °C).

3.6. Saline Alkali Tolerance Effects

The growth trend of the bacterial strain containing plasmid pET-22bNS-EctA-EctB-EctC was much better than the strain harboring plasmid pET-22bNS at 4% and 6% concentrations of NaCl (Figure 7A). However, growth inhibition was precisely observed under high saline medium 8 and 10% NaCl (data not shown). At a pH of 8.9, excellent growth was also shown by plasmid pET-22bNS-EctA-EctB-EctC as compared to plasmid pET-22bNS (Figure 7B). However, when the pH exceeded 9.5, the growth of both strains was significantly inhibited during the first 10 h, and the growth of plasmid pET-22bNS-EctA-EctB-EctC gradually resumed compared to strain pET-22bNS. These experiments demonstrated that ectoine could protect bacterial cells from environmental stress.

4. Discussion

Ectoine is a compatible solute naturally produced in some halophilic bacteria and protects the cell membrane, DNA, and proteins from high osmolarity and extreme temperature [22]. Ectoine has gained special interest in the pharmaceutical and healthcare sectors for the treatment of different diseases, such as Alzheimer’s disorders, allergic rhinitis, and respiratory infections. Different methods are utilized for achieving the efficient production of ectoine [23]. In our findings, a high amount of ectoine was potentially achieved by the biobrick method, as shown in

Table 2. Comparison of the amount of ectoine through different methods.

Strain Type	Ectoine Amount (mg/mL/d)	Disadvantages or Features	Approach/Method	Reference
H. elongate DSM142	7.4	salinity issues, low yield	bacterial milking	[14]
H. salina BCRC17875	7.61	salinity issues, low yield	bacterial milking	[15]
E. coli BW25113	25.1	salinity issues, low yield	bacterial milking	[24]
E. coli MG1655	12.7	complicated, low yield	whole cell catalysis	[25]
E. coli W3110	31.37	complicated operational design	fed-batch process	[26]
H. salina DSM 5928T	14.86	low yield, complicated design	fed-batch process	[30]
E. coli BL21(DE3)	167.2	high yield, efficient design	biobrick approach	This study

. Through the bacterial milking method, an amount of ectoine 25.1 mg/mL/d was achieved from the E. coli BW25113 strain [24]. Through the whole cell catalysis approach, 12.7 mg/mL/d amount of ectoine was produced by the E. coli MG1655 strain [25]. Through the fed-batch microbial fermentation method, an amount of ectoine of 31.37 mg/mL/d was produced from E. coli W3110 [26]. However, the yield of ectoine through these methods is still low due to some disadvantages, such as salinity issues, a complicated operational design, and difficulty in maintaining the optimizing conditions and producing a low yield [25,27]. The biobrick method for efficiency was potentially evaluated for the biosynthesis of ectoine due to its simple design, and the optimization process under a low-salt medium offers the benefit of conquering the salinity issues and produces a high yield [28]. In our study, different recombinant plasmids with ectABC genes from B. pseudofirmus OF4 were introduced into E. coli BL21 (DE3) by the biobrick method. Upon the successful gene expression and optimizing reaction conditions at different temperatures, the two recombinant strains containing plasmids pET-22bNS-A_LacB_TacC_Tac and pET-22bNS-A_TrcB_LacC_Trc produced a high amount of ectoine of about 167.2 mg/mL/d and 157.6 mg/mL/d, which are higher than previously reported studies [24,25,29]. These results revealed that a high amount of ectoine was potentially achieved through the biobrick method.

The expression level of different proteins is another factor that influences ectoine biosynthesis [24]. The protein expression level is regulated by different promoters [31]. A study by He et al. [24] reported that expression levels of three proteins, EctA, EctB, and EctC, were observed in E. coli BL21 (DE3) with the ara promoters. We employed the E. coli BL21 (DE3) strain due to high protein expression efficiency, and all three proteins, EctA, EctB, and EctC, were biochemically expressed under the regulation of different promoters. The expression levels of EctA and EctC were higher than EctB and had a significant effect on the ectoine biosynthesis, indicating that both proteins might be the key enzymes and are consistent with the previous studies [25,31]. However, improving the expression levels of key enzymes might be an important strategy and could promote ectoine biosynthesis.

The findings were finally comparative to the optimized level. Yang et al. [30] reported that ectoine biosynthesis was efficiently carried out in the presence of aspartate by optimizing the different conditions [29]. Another study by He et al. [26] reported that aspartate with a 100 to 200 mM concentration was employed for optimization, and an amount of 2.25 mg/mL was obtained [24]. In our study, aspartate was added to optimize the process because it accelerates ectoine production through efficient conversion into aspartate-semialdehyde [32]. The aspartate family members (Asd and Ask) both act in the biosynthetic pathway of ectoine by catalyzing the conversion of aspartate into L-aspartate phosphate and aspartate-semialdehyde [33]. Then, it is efficiently converted into ectoine through a series of different transamination and cyclization reactions by EctB, EctA, and EctC [34]. Similarly, in our study, the reaction was optimized with a 300 mM substrate concentration and produced a 17.0 mg/mL amount of ectoine for strain (No. 13) and 14.8 mg/mL for strain (No. 18), which was higher than previously reported studies [32,34]. Promoter replacement experiments revealed that expression levels of EctA and EctC were higher than EctB for strains 13 and 18 (Figure 6A,C). The high expression levels of EctA and EctC might enable the catalytic reaction to utilize the 300 mM concentration of substrates in the second screening. In our study, ectoine biosynthesis was significantly increased through reactions catalyzed by aspartate family members Asd and Ask through optimizing the reaction conditions, which is in agreement with the previous studies [9,35]. The optimization reaction was further accelerated with the reusability of cell pellets. The ectoine biosynthesis was relatively stable at 40 °C, and the reusability times of the cell pellets were high (over 20 times). However, at 60 °C, the synthesis of ectoine was decreased sharply, and the reusability time of the cell pellets was low because the high temperature could increase the enzymatic activity at a certain level, but it had a great impact on ectoine production by impairing the bacterial cells or destroying the structure of the enzyme [33]. The optimization process under these conditions might accelerate ectoine production. Further studies are potentially needed for the screening of novel microbial strains through metabolic engineering with high production rates for different industrial applications.

Ectoine is naturally produced as a cell protectant in some thermophiles and protects the cell membrane, DNA, and proteins from high osmolarity and extreme temperature [33]. Ng et al. [17] reported that each microorganism could tolerate a salt concentration at a certain level and a high of salt more than 8% and 10%. Elevated pH levels of more than 8.5 to 9.5 can disrupt the functions of different cell organelles [17]. Another study by Yu et al. [36] reported that high concentrations of salt more than 6% and 8% can inhibit the growth of bacteria and can cause serious effects on the cell membrane, DNA, and cellular enzymes and disrupt the cytoplasm function [36]. Our study is consistent with the previous studies. To evaluate the behavior towards stress resistance, the E. coli BL21(DE3) strain with plasmid pET-22bNS-EctA-EctB-EctC was incubated in a medium containing different concentrations of NaCl or pH values. At 4% and 6% concentrations of NaCl, the growth of bacteria containing plasmid pET-22bNS-EctA-EctB-EctC was much better than plasmid pET-22bNS, indicating that the ectoine product has a protective effect on bacterial growth in such a salt medium. However, when the concentration of NaCl was potentially increased by more than 6%, 8 and 10%, the salinity was too high in this case, which could limit the protective effect of the ectoine. A high concentration of NaCl severely damages the growth of bacteria, as agreed with in previous studies [37]. Similarly, when pH exceeded 8.5 to 9.5, the growth of both strains was precisely inhibited during the first 10 h, and then the growth of the strain containing plasmid pET-22bNS-EctA-EctB-EctC gradually resumed compared to pET-22bNS. Our study demonstrated that strain BL21(DE3) harboring plasmid pET-22bNS-EctA-EctB-EctC showed the same environmental tolerance as extremophiles [38,39]. This provides evidence that ectoine has a protective function for cells or cell membranes from high osmolarity and extreme environments.

5. Conclusions

In this study, recombinant E. coli BL21(DE3) was utilized as a microbial cell factory, and efficient ectoine biosynthesis was carried out by the biobrick method under a low-salt medium. The optimization process was smoothly performed under whole-cell catalysis following the different reaction conditions. At 60 °C, synthetic efficiencies of two recombinant strains containing plasmids pET-22bNS-A_LacB_TacC_Tac and pET-22bNS-A_TrcB_LacC_Trc were increased to 167.2 mg/mL/d (6.97 mg/mL/h) and 157.6 mg/mL/d (6.57 mg/mL/h), which were higher than the strain with pET-22bNS-EctA-EctB-EctC or any other reports. Therefore, a high amount of ectoine achieved through the biobrick method under a low-salt medium could conquer the salinity issues and also provide a new platform for different industrial applications.