A Review of Pyrene Bioremediation Using Mycobacterium Strains in a Different Matrix

Abstract

Polycyclic aromatic hydrocarbons are compounds with 2 or more benzene rings, and 16 of them have been classified as priority pollutants. Among them, pyrene has been found in higher concentrations than recommended, posing a threat to the ecosystem. Many bacterial strains have been identified as pyrene degraders. Most of them belong to Gram-positive strains such as Mycobacterium sp. and Rhodococcus sp. These strains were enriched and isolated from several sites contaminated with petroleum products, such as fuel stations. The bioremediation of pyrene via Mycobacterium strains is the main objective of this review. The scattered data on the degradation efficiency, formation of pyrene metabolites, bio-toxicity of pyrene and its metabolites, and proposed degradation pathways were collected in this work. The study revealed that most of the Mycobacterium strains were capable of degrading pyrene efficiently. The main metabolites of pyrene were 4,5-dihydroxy pyrene, phenanthrene-4,5-dicarboxylate, phthalic acid, and pyrene-4,5-dihydrodiol. Some metabolites showed positive results for the Ames mutagenicity prediction test, such as 1,2-phenanthrenedicarboxylic acid, 1-hydroxypyrene, 4,5-dihydropyrene, 4-phenanthrene-carboxylic acid, 3,4-dihydroxyphenanthrene, monohydroxy pyrene, and 9,10-phenanthrenequinone. However, 4-phenanthrol showed positive results for experimental and prediction tests. This study may contribute to enhancing the bioremediation of pyrene in a different matrix.

1. Introduction

The demand for water and energy is increasing, putting additional strain on water and environmental resources. Water scarcity has been identified as a socioeconomic and environmental problem that challenges the world in the twenty-first century, affecting approximately four billion people worldwide at least one month per year [1,2,3]. The continuous release of harmful chemicals such as persistent organic pollutants (POPs) is considered one of the most threatening environmental problems, as mentioned in the Stockholm convention, 2004, Basel convention, 1989, the Rotterdam convention, 1998, Barcelona resolution, 1995, 8 Aarhus Protocol, 1998, and the Arctic environmental protection strategy, 1991 [4]. According to the listed protocols and conventions, harmful chemicals should be eliminated, or their production decreased. POPs are a group of toxic chemicals that stay in the environment long-term and resist natural degradation. There are two major sources of POPs, (i) natural sources, including forest fires, volcanic eruptions, and biogenic sources (microbial metabolites, plants, and algae), and (ii) anthropogenic sources, including incomplete combustion (oil, wood, petroleum, and coal), synthetic fertilizers, pesticides formulations, and industrial process [5]. POPs groups include personal care products, polychlorinated compounds, dibenzo-p-dioxins and dibenzofurans, and polycyclic aromatic hydrocarbons (PAHs) [6]. The increasing discharge of POPs into the environment leads to them bioaccumulating and becoming biomagnified until they reach a specific concentration leading to bio-toxicity. POPs can cross boundaries, move freely away from their original sources, and be absorbed by soil particles; they are volatile in the atmosphere, can run off into water bodies, enter into the food chain, be uptaken by plants, or leach into groundwater. PAHs are compounds that contain two or more benzene rings. The United States Environmental Protection Agency (USEPA) classified 16 PAHs as priority pollutants due to their low solubility, non-polarity, hydrophobicity, high boiling point, high melting point, corrosion resistance, conductivity, heat resistance, light-sensitive, bioaccumulation, biomagnification, and bio-toxicity [7,8]. Many adverse effects of PAHs have been reported on human health, aquatic organisms, and wildlife, such as genetic mutation, endocrine disruption, cardiovascular disorders, hypertension, immune system suppression, and birth defects. In this work, pyrene was the main target pollutant and was detected at higher concentrations than the standard values or maximum contaminant levels [9]. According to the United States Environmental Protection Agency (USEPA), the standard values of pyrene for human health for the consumption of water and organism is 20 µg/L, while for human health for the consumption of water is only 30 µg/L [10]. Many biological, physical, and chemical treatment techniques have been used to eliminate pyrene from different mediums. The advanced oxidation process is one of the most efficient treatment methods capable of oxidizing pyrene [11]. However, advanced oxidation processes need to inject a large number of chemicals to complete mineralization, which increases the treatment costs and the discharge of chemicals into the environment [12]. Bioremediation approaches have gained attention due to their advantages, such as being cost-effective and environmentally friendly. Biological treatment is a biological process that uses target pollutants as a source of energy and carbon to degrade, mineralize, transform, and detoxify the target pollutant in a specific medium. Bioremediation can use indigenous biological agents (biostimulation) or external biological agents (bioaugmentation) and can be applied either in situ or ex situ based on many factors such as, (i) type of pollutants, (ii) cost of treatment, (iii) geological site, (iv) pollutants’ concentration, and (v) depth of pollution. The most popular treatment techniques use in situ natural attenuation, bio-slurping, bioventing, disparaging, and phytoremediation. Many ex situ techniques are used to treat many pollutants, including POPs, such as landfarming, bioreactor, windrow, and biopile windrow [13]. Quintella et al. [14] applied a strengths, weaknesses, opportunities, and threats (SWOT) analysis for the study of bioremediation technologies. They revealed that most of the studies have been conducted in the United States of America and China, and the most common biological agents used were bacteria, enzymes, fungi, algae, plants, and protozoa, with percentages of 57%, 19%, 13%, 6%, 4%, and 1%, respectively. Water, soil, and sludge were the most common degradation matrixes that were treated, with percentages of 53%, 36%, and 11%, respectively. They reported that the target pollutants that were degraded via biological agents the most were oil, metals, organic waste, polymers, food, and cellulose, and their percentages were 38%, 21%, 21%, 10%, and 5%, respectively. Recently, the degradation of pyrene via isolation of bacterial strains has increased. Mycobacterium strains and Rhodococcus strains were the most dominant bacterial species used for PAHs degradation; these strains were enriched and isolated from different sites contaminated with petroleum products, such as fuel stations [15,16]. Figure 1 represents the number of documents by year and the percentage of each type of document found using keywords (oxidation of pyrene by bacteria) through the Scopus database. In 1995, the number of studies related to the biodegradation of pyrene for each type of document was 5, while in 2021, the number of studies was 55, which means that this topic has been gaining researchers’ attention. More than 94% of these studies were articles, 2.3%, 2.0%, 0.6%, 0.5%, 0.5, and 2.0% were reviews, conference papers, notes, book chapters, short surveys, and errata, respectively. In this review, the main objective is to collect and organize the scattered information related to the studies that investigated the degradation of pyrene by Mycobacterium strains. The major topics that are investigated in this review are degradation efficiency, pyrene metabolites, bio-toxicity, and the proposed degradation pathways.

2. Degradation of Pyrene by Mycobacterium sp.

Several bacterial strains have been isolated to use pyrene as a sole carbon and energy source; most of them are Gram-positive, such as Mycobacterium and Rhodococcus [17,18]. Mycobacteria are catalase-positive, non-motile, non-spore-forming, rod-shaped bacteria (0.2–0.6 mm wide and 1.0–10 mm long). The colony morphology of Mycobacteria varies, with some species growing as rough or smooth colonies. Colony color ranges from white to orange or pink [19]. It has been reported that the first isolation of a bacterial strain to mineralize pyrene was in 1988 [20]. Mycobacterium was the most dominant strain to mineralize pyrene [21]. The successful mineralization of pyrene by Mycobacterium strains refers to their ability to produce several functional enzymes capable of metabolizing high molecular weight polycyclic aromatic hydrocarbons, such as pyrene. Dioxygenase is a complex, multi-component enzymatic system containing iron sulfur-containing terminal oxygenase, reductase, and ferredoxin [22]. It has been reported that hydroxylation is the initial biochemical step in the pyrene degradation process. It introduces a couple of oxygen atoms into aromatic pyrene rings [23]. The complete mineralization of pyrene occurs through different enzymatic reactions such as dioxygenase, dihyrogendiol, dehydrogenase, ring cleavage dioxygenase, epoxide hydrolase, alcohol dehydrogenase, acetaldehyde dehydrogenation, and decarboxylation [24]. Figure 2 illustrates the biodegradation of pyrene by Mycobacterium.

Many functional genes have been identified in the Mycobacterium strains, such as NidA, NidB, NidAB, NidA3B3, PhdA, PhdB, PdoA, PdoB, and PdoAB. Among Mycobacterium strains, the vanbaalenii PYR-1 strain has many functional genes capable of degrading pyrene and its metabolites.

Table 1. Summary of the functional genes for each Mycobacterium strain.

Strain	Functional Genes	Reference
Mycobacterium sp.	NidA, NidA3	[15]
Mycobacterium sp. 6PY1	PdoB2, PdoA1, PdoA2	[24]
Mycobacterium sp. JLS	NidB and NidA	[25]
Mycobacterium sp. MCS	NidA and NidB
Mycobacterium sp. NJS-P	PdoAB	[26]
Mycobacterium sp. S65	PdoAB
Mycobacterium fortuitum	PhdA and PhdB	[27]
Mycobacterium sp. PO1 and PO2	NidA, PhdA, and NidA3	[28]
Mycobacterium sp. AP1-PYR	NidAB and PdoA2B2	[29]
Mycobacterium sp. MHP-1	NidAB	[30]
Mycobacterium sp. RJGII-135	NahAc, BphA1, OrtolC1C2	[31]
Mycobacterium sp. KMS	PdoF	[32]
Mycobacterium vanbaalenii PYR-1	NidB, NidA, NidB2, PhdF, PhdG, NidD, PhdJ, PhtAb, PhtAc, PhtAd, PhtB, NidA3, NidB3
Mycobacterium gilvum PYR-GCK	AraC
Mycobacterium sp. gilvum PYR10	NidAB and NidA3B3	[33]
Mycobacterium sp. Pallens PYR15	NidAB and NidA3B3

includes some of the enzymes produced by different Mycobacterium strains during pyrene degradation. Miller et al. [25] identified NidB and NidA genes that are responsible for producing dioxygenase enzyme when Mycobacterium sp. JLS is used to catabolize pyrene. Zeng et al. [26] reported that the PdoAB gene is responsible for encoding a dioxygenase capable of oxidizing pyrene. Costa et al. [27] observed that PhdA and PhdB are the main genes of the dioxygenase enzyme in the Mycobacterium fortuitum strain.

In this review article, more than 40 studies related to pyrene degradation via Mycobacterium strains or consortium culture were collected. In general, Mycobacterium strains showed high degradation efficiency, most of them 80–100%. There are numerous Mycobacterium strains that can degrade pyrene. The phylogenetic tree of Mycobacterium strains is depicted in Figure 3. The Mycobacterium sequences were collected using the NCBI gene bank (Home Nucleotide—www.ncbi.nlm.nih.gov (accessed on 30 December 2021)). The sequences were assembled, aligned, and analyzed with MEGA software version 11.0

Wanapaisan et al. [28] used a consortium culture containing five bacterial strains (Mycobacterium sp. PO1, PO2, Bacillus sp. FW1, Ochrobactrum sp. PW1, and Novosphingobium pentaromativorans PY1). The result showed that 100 mg/L of pyrene was completely eliminated within 6 days of incubation. In addition, the Mycobacterium sp. NJS-1 strain was used to mineralize pyrene on metal-modified montmorillonite. This study revealed that around 93.6% of 15 mg/L of pyrene was degraded within 3 days at neutral pH conditions, and the degradation rate was first-order kinetics 0.62 k/d [34]. Additionally, Zhang et al. [35] applied a consortium of bacterial strains (Micrococcus sp. PHE9 and Mycobacterium sp. NJS-P) to decompose pyrene. About 58% of 100 mg/L of pyrene was removed after 18 days of incubation, and the degradation rate was 3.24 mg/L × day. Sun et al. [36] isolated the Mycobacterium sp. WY10 strain to oxidize 50 mg/L of pyrene in a mineral salt medium. Around $3\times {10}^8$ CFU/mL was inoculated, and the degradation was 83% after 72 h of treatment. Xiaoning Li et al. [37] examined the Mycobacterium sp. NJS-1 strain to treat and remove high molecular weight polycyclic aromatic hydrocarbons, such as pyrene. The author used a mineral medium, and around $1.6\times {10}^7$ CFU/mL was inoculated to degrade 200 mg/L of pyrene; the degradation was 90% of pyrene in the presence of humic acid, while about 10.5% was in the absence of humic acid within 7 days of incubation. The Mycobacterium gilvum CP13 strain was isolated for oxidizing pyrene in a mineral salt medium at alkaline conditions. The bacteria were inoculated at an optical density of 600 nm = 0.5, and 95% of 50 mg/L of pyrene was oxidized after 7 days of degradation treatment [38]. Furthermore, Chen et al. [39] applied biotechnology to treat agricultural and industrial soils contaminated with 16 priority polycyclic aromatic hydrocarbons, including pyrene. The Mycobacterium strain was capable of removing 85% of 100 mg/kg of pyrene during 35 days of treatment in both soils. Also, Terzaghi et al. [40] examined the Mycobacterium gilvum VM552 strain to degrade pyrene suspended on the leaf surface of holm oak (Quercus ilex). The results indicated that after 2 weeks of treatment, the removal was only 17%. Chen et al. [15] attempted to stimulate a microbial degradation approach for soil-containing pyrene. In this study, the active bacterial strains were identified; among them, Mycobacterium strains were the most dominant, and the degradation was 80% of 60 mg/kg within 35 days; the experiment was conducted at pH 8. Sarma and Pakshirajan [41] isolated the Mycobacterium frederiksbergense strain to mineralize pyrene using a batch shake flask reactor. After 200 h of incubation, the pyrene was totally eliminated at neutral pH conditions. Moreover, Peng et al. [17] reported that approximately 81% of 50 mg/kg of soil-containing pyrene was oxidized after 60 days of bioremediation under acidic conditions using the Mycobacterium strain. They pointed out that the NidA gene in Mycobacterium was responsible for generating the dioxygenase enzyme. In addition, the Mycobacterium vanbaalenii PYR-1strain was used in a phosphate-based mineral medium, and 25 µM of pyrene was completely oxidized after 24 h of treatment [18].

Table 2. Summary of the studies that used Mycobacterium strains to treat pyrene in a different medium.

Strains	Accession No./or Reference No.	Biodegradation Matrix	Degradation %	Incubation Time	pH	Temperature (°C)	Concentration of Pyrene	$\mathbf{O}{\mathbf{D}}_{600}/\mathbf{Number} \mathbf{of} \mathbf{Cells}$	References
Mycobacterium strains	*	Pyrene-containing soil	80	35 days	Around 8	25	60 mg/kg	Ranging from 8.9 × 109 to 1.9 × 1010 copies/g	[15]
Myco66F/Myco600R	FN690762 and FN690936	Pyrene-spiked soils	81	60 days	5.84	25	50 mg/kg	*	[17]
Mycobacterium vanbaalenii PYR-1	NR_074572.1	Phosphate-based minimal medium	100	24 h	*	*	25 µM	OD600 = 1.0	[18]
Mycobacterium sp. KR2	*	Mineral salts medium	60	8 days	7	20	0.5 mg/mL	OD578 = 0.5–0.6	[21]
Mycobacterium sp. PO1 and PO2	PO1 (NZ_BLTG00000000.1) PO2 (NZ_BLTH00000000.1)	Carbon-free mineral medium (CFMM) culture	100	6 days	*	30	100 mg/L	108 CFU/mL	[28]
Novosphingobium pentaromativorans PY1
3-Ochrobactrum sp. PW1
4-Bacillus sp. FW1
Mycobacterium sp. NJS-1	AB548662	Metal-modified montmorillonite	93.6	3 days	7	28	15 mg/L	1.6 × 107 CFU/mL	[34]
Micrococcus sp. PHE9	AB548663	Biofilms extracellular polymeric substances-extracted bacteria	58	18 days	*	28	100 mg/L	1.6 × 108 CFU/mL	[35]
Mycobacterium sp. NJS-P
Mycobacterium sp. WY10	NZ_CP018043.1	Mineral salts medium	83	72 h	*	28	50 mg/L	OD600 = 1.0 3 × 108 CFU/mL	[36]
Mycobacterium sp. NJS-1	AB548662.1	Mineral medium	90	7 days	Acidic condition	28	200 mg/L	1.6 × 107 CFU/mL	[37]
Mycobacterium gilvum CP13	KF378755	Mineral salts medium	95	7 days	Alkaline environment	35	50 mg/L	OD600 = 0.5	[38]
2-Mycobacterium sp. denovo930873	*	Agricultural soil	80	35 days	*	25	100 mg/kg	*	[39]
Mycobacterium gilvum VM552	ATCC 43909	Pyrene present on the leaf surface of holm oak (Quercus ilex)	17	2 weeks	*	23± 2	*	104 cells/g	[40]
Mycobacterium frederiksbergense	Taxonomy ID: 117567	Batch shake flask experiments	100	200 h	7	28	1000 mg/L	*	[41]
Mycobacterium frederiksbergense	Taxonomy ID: 117567	Slurry phase and surfactant-aided systems	100	6 days	7	28	400 mg/L	*	[42]
Mycobacterium sp. flavescens PYR-1	*	Mineral salts medium	38.8	2 weeks	Natural and 4	24	50 µg/ml	2.2 × 107 cells/mL	[43]
Mycobacterium sp. AP1	JX239754	Pyrene-mineral salts medium	Decreased from 180 to 50 µg/mL around 72	6 days	*	25	180 µg/ml	*	[44]
Mycobacterium sp. A1-PYR	X93183	PYR in liquid medium	33	7 days	*	30	10 mg/L	OD600 = 1.0	[45]
Selenastrum capricornutum	X93183	Soil extract (SE) medium	100	14 days	7	*	10 mg/L	1.0 × 107 CFU/mL	[46]
Mycobacterium sp. A1-PYR
Mycobacterium sp. A1-PYR	X93183	Pyrene-mineral salts medium	50	7 days	*	30	10 mg/L	OD600 = 1.0	[47]
Sphingomonas sp. PheB4
1-Mycobacterium monacense B9-21-178	AF107039.2	Liquid Culture	100	20 days	*	30	250 mg/L	105–106 cells/mL	[48]
2-Mycobacterium sp. KMS	AY083217
3-Mycobacterium sp. JLS	AF387804
4-Mycobacterium gilvum VM0442	AF544636.1
5-Mycobacterium gilvum VM0552	AF544635
6-Mycobacterium gilvum VM0504	AF544634
7-Mycobacterium gilvum VM0505	AF544633
8-Mycobacterium sp. PYR GCK	AY694989
9-Mycobacterium petroleiphilum	UEGS01000001.1
10-Mycobacterium chlorophenolicus PCP-1	X79094
1-Mycobacterium sp. PYR GCK	AY694989		94.3
2-Mycobacterium gilvum VM0583	AF544637.1
3-Mycobacterium gilvum VM0442	AF544636.1
4-Mycobacterium gilvum VM0552	AF544635
5-Mycobacterium gilvum iVM0504	AF544634
6-Mycobacterium gilvum VM0505	AF544633
7-Mycobacterium sp. BB1	X81891
8-Mycobacterium sp. HE5	AJ012738
9-Mycobacterium mucogenicum	AY457073.1
1-Mycobacterium sp. JLS	AF387804		95.5
2-Mycobacterium monacense B9-21-178	AF107039.2
3-Mycobacterium vaccae VM0588	AF544639.1
4-Mycobacterium vaccae VM0587	AF544638.1
5-Mycobacterium sp. KMS	AY083217
6-Mycobacterium sp. MCS	AF387803.1
7-Mycobacterium doricum DSM 44339	AF547917.1
8-Mycobacterium doricum	AF264700.1
9-Mycobacterium duvalii	NR_026073.1
10-Mycobacterium duvalii CIP 104539	AF547918.1
Mycobacterium sp. RJGII-135	AY216464.1	Minimal basal salts medium	50	4–8 h	*	*	0.5 µg/mL	*	[49]
Mycobacterium sp. MHP-1	AB180481	Carbon-free minimal medium	50	7 days	9	30	Final concentration at 0.1% [w/v]	3.9 × 109 CFU/mL	[30]
1-Mycobacterium sp. gilvum PYR10	*	Minimal media containing pyrene	95	6 days	*	*	100 mg/L	*	[33]
2-Mycobacterium sp. pallens PYR15
1-Mycobacterium	*	Bio-electrokinetic remediation	54.3	91 days	8	Room temperature	286 mg/kg	107–108 CFU/g soil	[50]
2-Aeromicrobium
3-Arenimonas
4-Bacillus
5-Hydrogenophaga
6-Azoarcus
7-Luteimonas
Mycobacterium sp.	*	Soil placed into culture dishes	54.3 ± 1.7	21 days	Soil pH 6.6	*	120.2 ± 1.76 mg/kg	*	[51]
Mycobacterium sp. B2	*	Saline alkaline soils	83.2	30 days	Soil pH 8.75	28	100 mg/L	*	[52]
Mycobacterium gilvum CP13	KF378755.1	Mineral salts medium by LBL bio-microcapsules	95	3 days	7	*	10 mg/L	OD600 = 2.0	[53]
Mycobacterium gilvum IPF	AB491971	Pyrene-basal salts medium	100	3 days	7.0–7.3	28	100 mg/L	OD600 = 0.02	[54]
Mycobacterium frederiksbergense	Taxonomy ID: 117567	Slurry phase system	100	200 h	7	28	50 mg/L	*	[55]
Mycobacterium gilvum VM552	NR_118915.1	Aqueous medium	100	20 min	5.8	23	8.4 ng/ml	OD600 = 0.019	[56]
Mycobacterium gilvum CP13	KF378755	Aqueous solution + modified peanut hull powder	98	7 days	7	30	10 mg/L	OD600 = 2.0 × 107 CFU/mL	[57]
1-Mycobacterium barrassi	*	Aqueous solution + sediments	92	25 days	7	30	50 µg/kg Pyrene + phenanthrene	*	[58]
2-Dyella ginsengisoli
3-Rhodococcus equi
4-Bacillus pumilus
5-Bacillus weihenstephanensis
6-Labrys sp.
Mycobacterium strains (NJS-1 and NJS-P)	(AB548662) for NJS-1 and (AB548663) for NJS-P	Liquid culture minimal medium	87.9 and 92 for NJS-1 and NJS-P, respectively.	2 weeks	6.5–7	30	100 mg/L	106 cells/g	[59]
1-Mycobacterium fortuitum	U92089.1	Pyrene-containing soil	96.3	70 days	7	30	962.7 mg/kg	2.0 × 108 CFU/g	[60]
2-Bacillus cereus
3-Microbacterium sp.
4-Gordonia polyisoprenivorans
5-Microbacteriaceae bacterium
Mycobacterium sp. PYR-1	*	Experimental Microcosms	74 mixture of PAHs including pyrene	6 days	*	24	916.7 µg/400 µl	4.5 × 107 cells/mL	[61]
Mycobacterium sp. S65	AF544230	Mineral salts medium	60	96 h	*	30	1 mg/L	1.0 × 107 CFU/mL	[62]
Mycobacterium sp. AP1	JX239754	Mineral medium	11.5	30 days	*	26	0.20 nmol/mL	*	[63]
Mycobacterium sp. KMS	AY083217	Microcosm system	Little to no pyrene mineralization	10 days	*	20	20 mg/155 µL	1.0 × 108 CFU/mL	[64]
Mycobacterium gilvum PYR-GCK	NCBI Taxonomy ID 350054	Fluctuating environmental conditions	70	48 h	6.5	*	1.0 M	OD545 = 2.95	[65]
Mycobacterium sp. PYR-1	ATCC 2676	Aqueous pyrene solution	50	25 h	6.6	24	120 µg/L	*	[66]
Mycobacterium sp. AP1	JX239754	Marine medium	75	60 days	*	26	200 mg/L	2.0 × 107 CFU/mL	[67]
Mycobacterium sp.	*	Mineral salts solution,	50	2 to 3 days	7	30	250 µg/mL	*	[68]
1-Sphingomonas	*	Mineral salt medium	100	14 days	7.2	20 ± 2	10 mg/L for each phenanthrene, fluoranthene, and pyrene	OD600 = 3.0	[69]
2-Mycobacterium
3-Rhodococcus
4-Paracoccus
5-Pseudomonas

[* Data unavailable].

provides a summary of the studies that used Mycobacterium strains to degrade pyrene in a different medium, pH, optical density, degradation efficiency, incubation time, and initial concentration.

3. Identification of Pyrene Metabolites Degraded by Mycobacterium sp. and Their Biotoxicity

The specific aim of the remediation is to achieve complete mineralization or convert the target pollutant into harmless products. Metabolites (by-products, also called intermediate products) are products that are partially degraded and are generated during and after the treatment process. Some metabolites could be more toxic to public health and the environment than the original pollutant. It has been illustrated that the risk of the pollutant’s metabolites is like an iceberg. The pollutants themselves are just the tip of the iceberg, while the metabolites’ products represent the majority of the iceberg, which is hidden underwater. The researchers monitor the metabolites for many reasons: (i) to examine the effectiveness of the treatment approach, (ii) to detect any ecotoxic by-products after the end of treatment operation, and (iii) to build an oxidation pathway based on detected by-products. Many metabolites have been detected during and after the remediation process. The studies that investigated the degradation of pyrene via the Mycobacterium strains detected many metabolites. For example, Seo et al. [70] pointed out that phenantharene-4,5-dicarboxylic acid and naphthalene-1,2-dicarboxylic acid were the major intermediate products when Mycobacterium aromativorans strain JS19b1 was applied for pyrene degradation. Sun et al. [36] observed many metabolites produced by Mycobacterium sp. WY10 during pyrene degradation, such as cis-pyrene dihydrodiol, cis-pyrene-4,5-dihydrodiol, dihydroxy pyrene, methylated-phenanthrene-4,5-dicarobxylic acid, 4-phenanthrene-4-carboxylic acid, phenantharene-4,5-dicarboxylic acid, and phenanthrene-4-carboxylic acid. In addition, the Mycobacterium sp. flavescens PYR-1 strain was used for pyrene degradation. The major by-products were 4,5-dihydroxy-4,5-4,5-dihydropyrene, 4-phenanthroic, phthalic acid, and 4,5-phenanthrenedioic acid [43]. Mycobacterium sp. AP1 grew with pyrene as a sole carbon and energy source. The identified metabolites were trans- or cis-4,5-dihydroxy-4,5-4,5-dihydropyrene, phenantharene-4,5-dicarboxylic acid, phenanthrene-4-carboxylic acid, and 6,6-dihydroxy-2,2-biphenyl dicarboxylic acid [44]. Additionally, Zhong et al. [45] mentioned that the by-products of pyrene were dihydroxy phenanthrene, monohydroxy pyrene, dihydroxy pyrene, 4-phenanthrene-carboxylic acid, and 4-phenanthroic when Mycobacterium sp. A1-PYR was applied. Rehmann et al. [21] used Mycobacterium sp. KR2 to remove pyrene. After 8 days of incubation, the metabolites were cis-4,5-pyrene dihydrodiol, 4,5-phenanthrene dicarboxylic acid, 1-hydroxy-2-naphthoic acid, 2-carboxybenzaldehyde, phthalic acid, and protocatechuic acid. Also, pyrene cis-4,5-dihydrodiol and dihydroxypyrene were the main metabolites produced after 24 h of incubation of Mycobacterium vanbaalenii PYR-1 [18]. Furthermore, Luo et al. [46] used synergistic microbes (Selenastrum capricornutum and Mycobacterium sp. A1-PYR) to oxidize pyrene, and the metabolites were dihydroxy pyrene, 1-hydroxypyrene, 4-phenanthrol, 4-phenanthrene-carboxylic acid, hydroxyphenyl acetic acid, phenylacetic acid, salicylic acid, and benzoic acid. Kim et al. [71] observed 1,2-dicarboxynaphthalene, phenanthrene and pyrene-diols, and cis-4-(1-hydroxynaphth-2-yl)-2-oxobut-3-enoic acid. Liang et al. [72] detected pyrene-4,5-dione, cis-4,5-pyrene-dihydrodiol, phenanthrene-4,5-dicarboxylic acid, and 4-phenanthroic acid as a metabolite when Mycobacterium sp. strain KMS was applied. Moreover, Zhong et al. [47] examined a bacterial culture (Mycobacterium sp. A1-PYR and Sphingomonas sp. PheB4) for pyrene decomposition. The metabolites in this system were monohydroxy pyrene, pyrene diol, and dihydroxy pyrene. Xiaoning Li et al. [37] used Mycobacterium sp. NJS-1 to oxidize pyrene in the presence of and without humic acid. The by-product in the absence of humic acid was phenanthrene 3,4-diol, while 1,2-dimethoxypyrene was detected in the presence of humic acid. In addition, Wu et al. [38] studied the metabolites of Mycobacterium gilvum CP13 when pyrene was used as a sole carbon and energy source. The major metabolites were 4-phenanthrenecarboxylic acid, 4-phenanthrenol, 1-naphthol, and phthalic acid. Also, phthalic acid, naphthalene-1,8-dicarboxylic acid, diphenic acid, 6,6′-dihydroxy-2,2′-biphenyl dicarboxylic acid, Z-9-carboxymethylenefluorene-1-carboxylic acid, and phenantharene-4,5-dicarboxylic acid were detected by [48]. Many metabolites were detected by [49] when the Mycobacterium sp. strain RJGII-135 was isolated to degrade pyrene. The metabolites were 4,5-phenanthrene dicarboxylic acid, 4-phenanthrene-carboxylic acid, and 4,5-pyrene-dihydrodiol. In conclusion, according to these studies, phenantharene-4,5-dicarboxylic acid, dihydroxy pyrene, phenanthrene-4-carboxylic acid, phthalic acid, and pyrene-4,5-dihydrodiol were the most frequent metabolites that were detected when Mycobacterium sp. strains were used for pyrene degradation.

Table 3. Summary of the metabolites of pyrene from many species used for pyrene oxidation.

Scheme 4040	Metabolites	References
Leclercia adecarboxylata PS4040	1,2-phenanthrenedicarboxylic acid 2-carboxybenzaldehyde Ortho-phthalic acid 1-hydroxypyrene	[73]
Fire Phoenix plant (Festuca spp.) mediated microbial	Phthalic acid dehydroxylated pyrene 1-hydroxypyrene 1-hydroxy-2-naphthoic acid Salicylic acid Benzoic acid	[74]
Coriolopsis byrsina strain APC5	Pyruvic acid Benzoic acid Benzoic acid 2-hydroxy pentyl ester Phenanthrene Pthalic acid diisopropylester 4,5-dihydroxy pyrene	[75]
Fusant bacterial strain F14 fusion between Sphingomonas sp. GY2B and Pseudomonas sp. GP3A	4,5-dihydropyrene	[76]
Hortaea sp. B15	Phthalic acid 1-Hydroxy-2-naphthoic acid	[77]
Pseudomonas sp. strain Jpyr-1	Phthalate 3,4-dihydrodiol Phthalate 1-hydroxy-2-naphthalene carboxylic acid 4-phenanthrene-carboxylic acid	[78]
Shewanella sp. ISTPL2	4,5-dihydroxypyrene 2-carboxybenzalpyruvate Phthalic acid Salicylic acid	[79]
Pseudomonas sp. ISTPY2	Pyrene 4,5-Dihydroxypyren. 1,2-dihydroxynaphthalene 2,3-dihydroxybenzoate Phthalate Catechol	[80]
Pseudomonas sp. ISTPY2	Phthalate 4,5-dioxygenase Aldehyde dehydrogenase	[81]
Pseudomonas sp. JPN2	4,5-dihydroxy-4,5-dihydropyrene 4-phenanthrol 1-hydroxy-2-naphthoic acid Phthalate	[82]
Pseudomonas putida G7.	1-hydroxypyrene Phthalic acid Benzoic acid Silylated derivatives	[83]
Candida tropicalis MTCC 184	Menthyl salicylate (methyl ester of salicyclic acid)	[84]
Pseudomonas aeruginosa strain RS1	Phenanthrene 4,5-dicarboxylate 4-oxa-Pyrene-5-one Dihydroxypyrene 4-Phenanthroic acid 4,5-Dihydroxyphthalate 2,2-Dicarboxy-6,6-dihydroxybiphenyl 4-Phenanthroic acid 3,4-Dihydroxyphenanthrene	[85]
Achromobacter xylosoxidans PY4 strain	Monohydroxy pyrene 1-methoxyl-2-H-benzo[h]chromene-2-carboxylic acid 9,10-phenanthrenequinone 1-methoxyl-trans-2′-carboxybenzalpyruvate Dibutyl-phthalate	[86]
Enterobacter sp. MM087 (KT933254)	Pyrene cis-4,5-dihydrodiol. 3,4-dihydroxyphenathrene Phthalate Pyruvic acid Acetic acid Formic acid	[87]
Pseudomonas aeruginosa RS1	Maphthalene 1-methylnaphthalen.	[88]
Acinetobacter baumannii BJ5	Benzyl benzoate Butyl octyl phthalate Phenol −2,4-bis(1,1-dimethylethyl) Phenol, 2,4-di-tert-butyl-Ethyl benzoate n-Propyl acetate	[89]
Sphingomonas sp. YT1005	4-phenanthrenol Protocatechuic acid Phthalic acid 1-hydroxy-2-naphthoic acid 2-methylnaphthalene 2-hydroxy-2-H-benzo[h]chromene-2-carboxylic acid Dihydroxyphenanthrene cis-4,5-pyrene dihydrodiol Salicylic acid trans-2′-carboxybenzalpyruvate	[90]
Earthworm Eisenia fetida	Pyrene-4,5-dione Phenanthrene-4-carboxylic acid Phenanthrene-4,5-dicarboxylic acid Phenanthrene-4-carboxylic acid Protocatechuic acid	[91]
Klebsiella sp. LZ6	4,5-dihydro-phenanthrene Dibenzo-p-dioxin 4-hydroxycinnamate acid	[92]

represents the metabolites of several organisms, such as plants, algae, earthworms, bacteria, and fungi, that have been utilized to remove pyrene from different mediums.

It should be noted that phthalic acid, 1-hydroxypyrene, 1-hydroxy-2-naphthoic acid, 4,5-dihydroxy pyrene, phenanthrene 4,5-dicarboxylate, and pyrene-4,5-dihydrodiol are the most frequent metabolites in the last table. It has been observed that the metabolites of Mycobacterium sp. strains and the species mentioned in Table 3 share 4,5-dihydroxy pyrene, phenanthrene-4,5-dicarboxylate, phthalic acid, and pyrene-4,5-dihydrodiol as the most frequent metabolites. That may be attributed to the enzymes that are shared between them, which in turn, leads to shared degradation pathways of pyrene.

The mass consumption of petroleum products and increase in their demand around the world leads to an increase in the opportunity for pyrene leakage into the environment and increases the opportunity for exposure to pyrene by organisms and humans. Frequent and long-term exposure to pyrene leads to bioaccumulation and biomagnification in the organism cell, which increases the possibility of carcinogenicity and mutagenicity. Many studies have mentioned the negative impacts of pyrene and its metabolites on animals and humans. The toxicity evaluation of pyrene metabolites is important to increase system efficiency. The toxicity assessment of pyrene and its metabolites was carried out using the United States Environmental Protection Agency’s software, called Toxicity Estimation Software Tool (TEST) version 5.1. This software is capable of applying mathematical models to predict pollutant toxicity based on Quantitative Structure-Activity Relationship (QSAR) methodology. The data were introduced by inputting the name of each by-product. The lethal concentration of 50% (LC50) (96 h) in fathead minnow and Ames mutagenicity were the considered toxicity for pyrene metabolites using Mycobacterium strain and other biological agents, represented in

Table 4. Summary of the results of LC₅₀ (96 h) fathead minnow and the Ames mutagenicity test for the main pyrene metabolites after treatment by using Mycobacterium strain and other biological agents.

Metabolites	Fathead Minnow LC50 (96 h)		Ames Mutagenicity
	Prediction Value: −log (mol/L)	Prediction Value: (mg/L)	Prediction Value: Log10 (mol/L)	Experimental Result	Prediction Result
1,2-phenanthrenedicarboxylic acid	*	*	0.86	*	Mutagenicity Positive
2-carboxybenzaldehyde	4.30	7.49	0.29	*	Mutagenicity Negative
1-hydroxypyrene	5.45	0.77	0.76	*	Mutagenicity Positive
Phthalic acid	3.69	34.15	0.14	Mutagenicity Negative	Mutagenicity Negative
Benzoic acid	3.21	75.43	−0.05	Mutagenicity Negative	Mutagenicity Negative
Salicylic acid	3.34	63.62	−0.08	*	Mutagenicity Negative
1-hydroxy-2-naphthoic acid	3.77	31.97	0.17	*	Mutagenicity Negative
Pyruvic acid	2.08	734.13	0.41	*	Mutagenicity Negative
4,5-dihydroxy pyrene	5.13	1.73	0.50	*	Mutagenicity Negative
4,5-dihydropyrene	6.33	9.50 × 10−2	0.98	*	Mutagenicity Positive
n-Propyl acetate	3.06	89.38	0.19	*	Mutagenicity Negative
4-phenanthrene-carboxylic acid	4.52	6.65	0.71	*	Mutagenicity Positive
Protocatechuic acid	3.73	28.53	0.30	*	Mutagenicity Negative
1,2-dihydroxynaphthalene	4.55	4.49	0.28	*	Mutagenicity Negative
2,3-dihydroxybenzoate	3.71	29.86	−0.04	*	Mutagenicity Negative
Dibenzo-p-dioxin	4.53	5.40	0.23	Mutagenicity Negative	Mutagenicity Negative
Catechol	3.81	17.19	0.29	Mutagenicity Negative	Mutagenicity Negative
4,5-dihydroxy-4,5-dihydropyrene	5.03	2.21	0.15	Mutagenicity Negative	Mutagenicity Negative
4-phenanthrol	5.80	0.31	0.76	Mutagenicity Positive	Mutagenicity Positive
Phenanthrene 4,5-dicarboxylate	*	*	0.22	*	Mutagenicity Negative
4-oxa-Pyrene-5-one	5.01	2.18	0.22	Mutagenicity Negative	Mutagenicity Negative
4,5-Dihydroxyphthalate	3.58	51.61	0.47	*	Mutagenicity Negative
3,4-Dihydroxyphenanthrene	6.05	0.19	0.60	*	Mutagenicity Positive
Monohydroxy pyrene	5.45	0.77	0.76	*	Mutagenicity Positive
9,10-phenanthrenequinone	4.30	10.47	0.52	Mutagenicity Negative	Mutagenicity Positive
Dibutyl-phthalate	5.30	1.40	0.18	Mutagenicity Negative	Mutagenicity Negative
Naphthalene	4.20	8.15	*	Mutagenicity Negative	*
1-methylnaphthalen	4.32	6.74	*	Mutagenicity Negative	*
Benzyl benzoate	4.86	2.92	−0.05	*	Mutagenicity Negative
Butyl octyl phthalate	4.70	6.68	0.03	*	Mutagenicity Negative
Phenanthrene-4,5-dicarboxylic acid	*	*	0.22	*	Mutagenicity Negative
Naphthalene-1,2-dicarboxylic acid	3.93	25.69	0.10	*	Mutagenicity Negative

[* Data unavailable].

. Some metabolites showed positive results for the Ames mutagenicity prediction test, such as 1,2-phenanthrenedicarboxylic acid, 1-hydroxypyrene, 4,5-dihydropyrene, 4-phenanthrene-carboxylic acid, 3,4-Dihydroxyphenanthrene, Monohydroxy pyrene, and 9,10-phenanthrenequinone. However, 4-phenanthrol showed positive results for experimental and prediction tests.

4. Proposed Biodegradation Pathways

Many bacterial strains have been applied to degrade pyrene in a different medium. Some bacterial strains share the same functional enzymes, which leads to the same degradation pathways, as shown in

Table 5. Summary of the main genes of Mycobacterium sp. strain that responsible in pyrene degradation and their functions.

Primers	Sequences	Probable Functions	References
NidA3	Forward 5′-CCTGATGCGACGACAATG-3′	Fluoranthene/pyrene ring-hydroxylating oxygenase, α subunit	[15]
	Reverse 5′-GCAACCCTAGCCGACTCTT-3′
NidA	Forward 5′-TTCCCGAGTACGAGGGATAC-3′	α Subunit pyrene dioxygenase	[17]
	Reverse 5′-TCACGTTGATGAACGACAAA-3′
NidB2	*	Pyrene/phenanthrene ring-hydroxylating oxygenase, β subunit	[18]
NidB3	Reverse 5′-GCCGAGCTCGAATTCGGATCCTTAGATCCAGAATGACAG-3′	Fluoranthene/pyrene ring-hydroxylating oxygenase,β subunit
PdoAB	Forward 5′-GTATCCATGGGCAACGCGGTCGCGGTGGAC-3′	α Subunit pyrene dioxygenase	[26]
	Reverse 5′-ACGGATCCTCATCGAGCACCGCCGCGGAACTG-3′
PdoA1	Forward 5′-GGCATATGCAAACGGAAACGACCGA-3′	α Subunit pyrene dioxygenase	[95]
	Reverse 5′-GGGATATCTCAAGCACGCCCGCCGAATG-3′
PdoA2B2	Forward 5′-GGCATATGTCTACTGTCGGTAAGAA-3′	α Subunit pyrene dioxygenase
	Reverse 5′-GGAGATCTTAGAAGAAGTTAGCCAG-3′
PdoB1	Forward 5′-GGCATATGAACGCCGTTGCCGTGGA-3′	Pyrene/phenanthrene ring-hydroxylating oxygenase, β subunit
	Reverse 5′-GGGGATCCTACAGGACTACCGACAG-3′
PdoA2B2	A2-Forward 5′-GGCATATGTCTACTGTCGGTAAGAA-3′	Catalysis of hydroxylation of HMW and LMW polyaromatic hydrocarbons including pyrene.
	B2-Reverse 5′-GGAGATCTTAGAAGAAGTTAGCCAG-3′
TolC1C2	Forward 5′-TGAATCAGACCGACACATCAC-3′	Small subunits of toluene dioxygenase	[62]
	Reverse 5′-TGTTACGGCGCAACGTATC-3′
NahAc	Forward 5′-GCCAAAAGCACCTGA-3′	Naphthalene dioxygenase
	Reverse 5′-TCTTCGTAAGTTCAGTATGCC-3′
BphA1	Forward 5′-GTGCAGGGAGCCCCTGTGAAG-3′	Large subunit of biphenyl dioxygenase
	Reverse 5′-CAGGGCTTGAGCGTGGCCCAGC-3′
PdoB2	Forward 5′-CCGCTGCGAGATGGAGAAC-3′	β Subunit dioxygenase	[63]
	Reverse 5′-CGTGAGGGCGGATCTTCTG-3
PdoF	Forward 5′-GCACCACCTTCTGACCGTAA-3′	Putative extradiol dioxygenase	[65]
	Reverse 5′-TTGGGTTTGAGGTGGGAACC-3′
PhdI	Forward 5′-TGACGAAGTGATGGGTGCTC-3′	1-Hydroxy-2-naphthoate dioxygenase
	Reverse 5′-AGTGCCGTGTATTTCGTCGT-3′
NidAB	Forward 5′-CGCGGATCCATGCTGAGCAACGAACTCCGGCAGACCCTCC-3′	α Subunit pyrene dioxygenase	[96]
	Reverse 5′-AAAACTGCAGATTCACATGATCAGGGCGAGGTTGTGTGTCATT-3′
NidB	Forward 5′-TCGTCACCAACTTCAAGTC-3′	β Subunit of arene dioxygenase
	Reverse 5′-GGTCTGATCAAGCAGCACAA-3′
AraC	Forward 5′-GGACTACCTCGGCGATATGA-3′	Transcriptional regulatory protein, AraC family
	Reverse 5′-TGTGGACGTGCTCTCCATAG-3′
PdoA2	Forward 5′-ACGCAGAACTCCACAAGCTC-3′	Phenanthrene ring-hydroxylating oxygenase, subunit	[97]
	Reverse 5′-ACTTCCATCGTGTCGTGTGA-3′
NidA3B3	Forward 5′-ACATATGGCGCCTGATGCGACGACAATG-3′	Fluoranthene/pyrene ring-hydroxylating oxygenase	[98]
	Reverse 5′-CAAGCTTTTAGATCCAGAATGACAGGTT-3′
PhtAb	Forward 5′-ATCGGATCCTTCTTACGAGTTGGGACTGTATCAAGC-3′	Oxygenase reductase component	[99]
	Reverse 5′-AGGTCGAGAAAGCTTTTACTTACTCTCCTTTAATAAAGCCAATAG-3′
PhtB	Forward 5′-TGCCCTAAGTGTTTGTCCCGGGTCCTATGAGCT-3′	Phthalate 3,4-dihydrodiol dehydrogenase
	Reverse 5′-AGGTCGAGAAAGCTTTTACTTACTCTCCTTTAATAAAGCCAATAG-3′
PhtAd	Forward 5′-ATCGGATCCTTCTTACGAGTTGGGACTGTATCAAGC-3′	Oxygenase reductase component
	Reverse 5′-AAGCTTTTACTATATAGGAGCCGGTTGACT-3′
PhtAc	Forward 5′-TCATCACCACAGCCAGGATCCGATGGGCGGAGTTATAAA-3′	Oxygenase ferredoxin component	[100]
	Reverse 5′-GCATTATGCGGCCGCAAGCTTTCATTCGTCTACGACTTC-3′
PhdJ	Forward 5′-5′-CGAGAGAGCATATGGTGCACGT-3′	trans-2-Carboxylbenzalpyruvate hydratase-aldolase	[101]
	Reverse 5′-TCCTCAGGATCCGTGGTTCGAGAC-3’
NidD	Forward 5′-ATGATCAGCAACCTGA-3′	Aldehyde dehydrogenase	[102]
PhdG	*	Hydratase-aldolase
PhdA	Forward 5′-GGGAATTCCATATGTCGGTAGTCAGCGGGGAT-3′	α and β subunits of other ring-hydroxylating dioxygenases	[103]
	Reverse 5′-CCGGAATTCGGTCGCAACTCATAAGACAGC-3′
PhdB	Forward 5′-CCGGAAT TCAAGGAGATATACATATGC TGAC TAC TG T TGACGAGAATC-3′
	Reverse 5′-CGCGGATCCAGATCTGCCTGCGGGCTAGAAG AAGAACGC-3′
MT1743	*	Catechol O-methyltransferase

[* Data unavailable].

. Some genes in the Mycobacterium sp. strain produce enzymes capable of oxidizing pyrene. There are numerous advantages to determining the degradation pathway, including the ability to control the effectiveness of remediation systems, eliminating the influence of degradation on analytical results, and knowledge of degradation pathways for specific compounds can facilitate the assessment of environmental pollution with POPs based on the presence of degradation products. In addition, identifying the degradation pathway is useful for the future development of bioremediation [93,94].

The following studies are examples of the degradation of pyrene by using the Mycobacterium sp. strain. Yuan et al. [29] proposed a detailed pyrene degradation pathway via Mycobacterium sp. strain A1-PYR. The first step of pyrene degradation was hydroxylation using NidAB and PodA3B3, leading to forming cis-4,5-dihydroxy-4,5-hydropyrene, then PhdE acting to convert cis-4,5-dihydroxy-4,5-hydropyrene into 4,5-dihydroxypyren, then phenanthrene-4,5-dicarboxylate via PhdF, further degradation leading to form phenanthrene-4-carboxylate. PodA2B2 enzyme works to produce cis-3,4-phenanthrene-dihydrodiol-4-carboxylate, then PhdE acts to generate 3,4-dihydroxy-phenanthrene. More decomposition of 3,4-dihydroxy-phenanthrene via PhdF leading to form 2-hydroxy-2H-benzo[h]chromene-2-carboxylate then cis-4-(1′-hydroxy-naphth-2′-yl)-2 oxobut-3-enoate. PhdG leading to form 1-hydroxy-2-naphthaldehyde $\to$ 1-hydroxy-2-naphthoate, further degradation of 1-hydroxy-2-naphthoate leading to produce 2-cis-2′-carboxy-benzalpyruvate. Additionally, the PhdJ enzyme converts 2-cis-2′-carboxy-benzalpyruvate into phthalate then the ring cleavage via PhtC results to form carboxylic acids compounds. The final metabolite step was that the small carboxylic acids enter the tricarboxylic acid cycle to produce energy,${\mathrm{H}}_2\mathrm{O},{ \mathrm{and} \mathrm{CO}}_2$. In addition, Krivobok et al. [95] proposed the degradation pathway of pyrene by Mycobacterium sp. Strain-6 PY1. They observed that PhdABCD, PhdE, PhdF, PhdG, PhdH, PhdI, and PhdK enzymes were detected in the Mycobacterium sp. Strain-6 PY1. The degradation of pyrene started with the hydroxylation process of C4 and C5 positions to form pyrene cis-4,5-dihydrodiol then 4,5-dihydroxypyrene, further oxidation of 4,5-dihydroxypyrene generates 4,5-phenanthrenedioic → 4-phenanthrene acid → phenanthrene-3,4-diol → phenanthrene → cis-3,4-phenanthrene-dihydrodiol → 3,4-dihydroxy-phenanthrene → 2-hydroxy-2H-1-oxa-pyrene-2-carboxylic acid → 2-Hydroxy-2H-benzo[h]chromene-2-carboxylate → 1-Hydroxy-2-naphthaldehyde → trans-2′-carboxybenzal pyruvic acid → 2-2-Carboxybenzaldehyde → O-phthalic acid → tricarboxylic acid cycle. Wu et al. [38] studied the degradation of pyrene via Mycobacterium gilvum and the proposed the degradation pathway as the following: pyrene → 4-phenanthrenecarboxylic acid → 3,4-dihydroxy-phenanthrene → 2-Hydroxy-2H-benzo[h]chromene-2-carboxylate → 1-naphthol → phthalic acid. A simple degradation pathway of pyrene through Mycobacterium sp. is shown in Figure 4. The most common transformation metabolites that have been proposed to build degradation pathways are shown in

Table 6. Summary of the most frequent transformation metabolites of pyrene.

P1	MW = 90.12${\mathrm{C}}_4{\mathrm{H}}_{10}{\mathrm{O}}_2$	P2	MW = 142.15${\mathrm{C}}_7{\mathrm{H}}_{10}{\mathrm{O}}_3$	P3	MW = 142.11${\mathrm{C}}_6{\mathrm{H}}_6{\mathrm{O}}_4$	P4	MW = 141.10${\mathrm{C}}_6{\mathrm{H}}_{15}{\mathrm{O}}_4$	P5	MW = 250.29${\mathrm{C}}_{14}{\mathrm{H}}_{18}{\mathrm{O}}_4$
P6	MW = 88.06${\mathrm{C}}_3{\mathrm{H}}_4{\mathrm{O}}_3$	P7	MW = 166.13${\mathrm{C}}_6{\mathrm{H}}_8{\mathrm{O}}_4$	P8	MW = 194.18${\mathrm{C}}_{10}{\mathrm{H}}_{10}{\mathrm{O}}_4$	P9	MW = 122.12${\mathrm{C}}_7{\mathrm{H}}_6{\mathrm{O}}_2$	P10	MW = 206.28${\mathrm{C}}_{13}{\mathrm{H}}_{18}{\mathrm{O}}_2$
P11	MW = 190.19${\mathrm{C}}_{11}{\mathrm{H}}_{10}{\mathrm{O}}_3$	P12	MW = 150.13${\mathrm{C}}_8{\mathrm{H}}_6{\mathrm{O}}_3$	P13	MW = 110.11${\mathrm{C}}_6{\mathrm{H}}_6{\mathrm{O}}_2$	P14	MW = 154.12${\mathrm{C}}_7{\mathrm{H}}_6{\mathrm{O}}_4$	P15	MW = 154.12${\mathrm{C}}_7{\mathrm{H}}_6{\mathrm{O}}_4$
P16	MW = 232.23${\mathrm{C}}_{13}{\mathrm{H}}_{12}{\mathrm{O}}_4$	P17	MW = 198.13${\mathrm{C}}_8{\mathrm{H}}_6{\mathrm{O}}_6$	P18	MW = 220.18${\mathrm{C}}_{11}{\mathrm{H}}_8{\mathrm{O}}_5$	P19	MW = 138.12${\mathrm{C}}_7{\mathrm{H}}_6{\mathrm{O}}_3$	P20	MW = 122.12${\mathrm{C}}_7{\mathrm{H}}_6{\mathrm{O}}_2$
P21	MW = 170.25${\mathrm{C}}_{13}{\mathrm{H}}_{14}$	P22	MW = 160.17${\mathrm{C}}_{10}{\mathrm{H}}_8{\mathrm{O}}_2$	P23	MW = 172.18${\mathrm{C}}_{11}{\mathrm{H}}_8{\mathrm{O}}_2$	P24	MW = 200.15${\mathrm{C}}_8{\mathrm{H}}_8{\mathrm{O}}_6$	P25	MW = 170.16${\mathrm{C}}_8{\mathrm{H}}_{10}{\mathrm{O}}_4$
P26	MW = 142.20${\mathrm{C}}_{11}{\mathrm{H}}_{10}$	P27	MW = 220.18${\mathrm{C}}_{11}{\mathrm{H}}_8{\mathrm{O}}_5$	P28	MW= 178.23${\mathrm{C}}_{11}{\mathrm{H}}_{14}{\mathrm{O}}_2$	P29	MW = 128.17${\mathrm{C}}_{10}{\mathrm{H}}_8$	P30	MW = 302.24${\mathrm{C}}_{15}{\mathrm{H}}_{10}{\mathrm{O}}_7$
P31	MW = 242.23${\mathrm{C}}_{14}{\mathrm{H}}_{10}{\mathrm{O}}_4$	P32	MW = 242.23${\mathrm{C}}_{14}{\mathrm{H}}_{10}{\mathrm{O}}_4$	P33	MW = 270.24${\mathrm{C}}_{15}{\mathrm{H}}_{10}{\mathrm{O}}_5$	P34	MW = 216.19${\mathrm{C}}_{12}{\mathrm{H}}_8{\mathrm{O}}_4$	P35	MW = 242.23${\mathrm{C}}_{14}{\mathrm{H}}_{10}{\mathrm{O}}_4$
P36	MW = 244.24${\mathrm{C}}_{14}{\mathrm{H}}_{12}{\mathrm{O}}_4$	P37	MW = 188.18${\mathrm{C}}_{11}{\mathrm{H}}_7{\mathrm{O}}_3$	P38	MW = 210.23${\mathrm{C}}_{14}{\mathrm{H}}_{10}{\mathrm{O}}_2$	P39	MW = 278.30${\mathrm{C}}_{15}{\mathrm{H}}_{18}{\mathrm{O}}_5$	P40	MW = 274.23${\mathrm{C}}_{14}{\mathrm{H}}_{10}{\mathrm{O}}_6$
P41	MW = 216.19${\mathrm{C}}_{12}{\mathrm{H}}_8{\mathrm{O}}_4$	P42	MW = 208.21${\mathrm{C}}_{14}{\mathrm{H}}_8{\mathrm{O}}_2$	P43	MW = 214.26${\mathrm{C}}_{14}{\mathrm{H}}_{14}{\mathrm{O}}_2$	P44	MW = 222.24${\mathrm{C}}_{15}{\mathrm{H}}_{10}{\mathrm{O}}_2$	P45	MW = 270.24${\mathrm{C}}_{15}{\mathrm{H}}_{10}{\mathrm{O}}_5$
P46	MW = 210.23${\mathrm{C}}_{14}{\mathrm{H}}_{10}{\mathrm{O}}_2$	P47	MW = 266.25${\mathrm{C}}_{16}{\mathrm{H}}_{10}{\mathrm{O}}_4$	P48	MW = 266.25${\mathrm{C}}_{16}{\mathrm{H}}_{10}{\mathrm{O}}_4$	P49	MW = 210.23${\mathrm{C}}_{14}{\mathrm{H}}_{10}{\mathrm{O}}_2$	P50	MW = 267.27${\mathrm{C}}_{16}{\mathrm{H}}_{11}{\mathrm{O}}_4$
P51	MW = 178.23${\mathrm{C}}_{14}{\mathrm{H}}_{10}$	P52	MW = 194.23${\mathrm{C}}_{14}{\mathrm{H}}_{10}\mathrm{O}$	P53	MW = 238.24${\mathrm{C}}_{15}{\mathrm{H}}_{10}{\mathrm{O}}_3$	P54	MW = 255.25${\mathrm{C}}_{15}{\mathrm{H}}_{11}{\mathrm{O}}_4$	P55	MW = 256.25${\mathrm{C}}_{15}{\mathrm{H}}_{12}{\mathrm{O}}_4$
P56	MW = 234.2${\mathrm{C}}_{16}{\mathrm{H}}_{10}{\mathrm{O}}_2$	P57	MW = 220.27${\mathrm{C}}_{16}{\mathrm{H}}_{12}\mathrm{O}$	P58	MW = 250.2${\mathrm{C}}_{17}{\mathrm{H}}_{14}{\mathrm{O}}_2$	P59	MW = 241.22${\mathrm{C}}_{14}{\mathrm{H}}_9{\mathrm{O}}_4$	P60	MW = 242.23${\mathrm{C}}_{14}{\mathrm{H}}_{10}{\mathrm{O}}_4$
P61	MW = 202${\mathrm{C}}_{16}{\mathrm{H}}_{10}$	P62	MW = 238.2${\mathrm{C}}_{16}{\mathrm{H}}_{14}{\mathrm{O}}_2$	P63	MW = 234.2${\mathrm{C}}_{16}{\mathrm{H}}_{10}{\mathrm{O}}_2$	P64	MW = 238.2${\mathrm{C}}_{16}{\mathrm{H}}_{14}{\mathrm{O}}_2$	P65	MW = 270.28${\mathrm{C}}_{16}{\mathrm{H}}_{14}{\mathrm{O}}_4$
P66	MW = 264.32 ${\mathrm{C}}_{18}{\mathrm{H}}_{16}{\mathrm{O}}_2$	P67	MW = 220.22${\mathrm{C}}_{15}{\mathrm{H}}_8{\mathrm{O}}_2$	P68	MW = 236.26${\mathrm{C}}_{16}{\mathrm{H}}_{12}{\mathrm{O}}_2$	P69	MW = 218.25${\mathrm{C}}_{16}{\mathrm{H}}_{10}\mathrm{O}$	P70	MW = 249.28${\mathrm{C}}_{17}{\mathrm{H}}_{13}{\mathrm{O}}_2$
P71	MW = 266.25${\mathrm{C}}_{16}{\mathrm{H}}_{10}{\mathrm{O}}_4$	P72	MW = 208.25${\mathrm{C}}_{12}{\mathrm{H}}_{16}{\mathrm{O}}_3$	P73	MW = 122.12${\mathrm{C}}_7{\mathrm{H}}_6{\mathrm{O}}_2$	P74	MW = 218.25${\mathrm{C}}_{16}{\mathrm{H}}_{10}\mathrm{O}$	P75	MW = 192.17${\mathrm{C}}_{10}{\mathrm{H}}_8{\mathrm{O}}_4$

, while

Table 7. Proposed degradation pathways and the active genes during pyrene oxidation.

Organism	Active Enzyme/Gene	Proposed Pathways	References
Mycobacterium vanbaalenii PYR-1	*	$\left(1\right) \mathrm{Pyrene}\to \mathrm{P}64\to \mathrm{P}56\to \mathrm{P}58\to \mathrm{P}66$ $$\begin{gathered} \left(2\right) \mathrm{Pyrene}\to \mathrm{P}62\to \mathrm{P}63\to \mathrm{P}48\to \mathrm{P}44\to \mathrm{P}55 \\ \to \mathrm{P}46\to \mathrm{P}36\to \mathrm{P}23\to \mathrm{P}37 \\ \to \mathrm{P}18\to \mathrm{P}12\to \mathrm{P}7\to \mathrm{P}24 \\ \to \mathrm{P}15\to \mathrm{Crboxlyic} \mathrm{acid} \\ \to \mathrm{Tricarboxylic} \mathrm{acid} \mathrm{cycle} \end{gathered}$$	[18]
Mycobacterium vanbaalenii PYR-1	PhdF, PhdG, PhdI, PhdJ, NidA3, NidAB, NidD, PhtAa, PhtB, and PhtAc	$$\begin{gathered} \mathrm{Pyrene}\to \mathrm{P}62\to \mathrm{P}63\to \mathrm{P}48\to \mathrm{P}44\to \mathrm{P}55 \\ \to \mathrm{P}59\to \mathrm{P}60\to \mathrm{P}23\to \mathrm{P}37 \\ \to \mathrm{P}22\to \mathrm{P}18\to \mathrm{P}12\to \mathrm{P}7 \\ \to \mathrm{P}24\to \mathrm{P}14 \\ \to \mathrm{Tricarboxylic} \mathrm{acid} \mathrm{cyclic} \mathrm{acid} \end{gathered}$$	[22]
Mycobacterium vanbaalenii PYR-1	NidAB, PhdE, PhtC, PdoA2B2, PhdF, PhdG, NidD, PhdJ, PhtAaB, PhtB, and PcaGH	$$\begin{gathered} \mathrm{Pyrene}\to \mathrm{P}62\to \mathrm{P}63\to \mathrm{P}68\to \mathrm{P}48\to \mathrm{P}38 \\ \to \mathrm{P}55\to \mathrm{P}46\to \mathrm{P}36\to \mathrm{P}23 \\ \to \mathrm{P}37\to \mathrm{P}18\to \mathrm{P}19\to \mathrm{P}7 \\ \to \mathrm{P}24\to \mathrm{P}15\to \mathrm{Crboxlyic} \mathrm{acid} \\ \to \mathrm{Tricarboxylic} \mathrm{acid} \mathrm{cycle} \end{gathered}$$	[24]
Mycobacterium sp. KMS		$$\begin{gathered} \mathrm{Pyrene}\to \mathrm{P}62\to \mathrm{P}63\to \mathrm{P}68\to \mathrm{P}48\to \mathrm{P}38 \\ \to \mathrm{P}7\to \mathrm{P}15\to \mathrm{Crboxlyic} \mathrm{acid} \\ \to \mathrm{Tricarboxylic} \mathrm{acid} \mathrm{cycle} \end{gathered}$$
Coriolopis byrsina APC5	*	$$\begin{gathered} \mathrm{Pyrene}\to \mathrm{P}57\to \mathrm{P}62\to \mathrm{P}63\to \mathrm{P}51\to \mathrm{P}5 \\ \to \mathrm{P}72\to \mathrm{P}73\to \mathrm{P}6 \\ \to \mathrm{Tricarboxylic} \mathrm{acid} \mathrm{cyclic} \mathrm{acid} \end{gathered}$$
Mycobacterium spp. PO1 and PO2	NidA, PhdA, and NidA3	$$\begin{gathered} \mathrm{Pyrene}\to \mathrm{P}62\to \mathrm{P}63\to \mathrm{P}48\to \mathrm{P}44\to \mathrm{P}43 \\ \to \mathrm{P}46\to \mathrm{P}16\to \mathrm{P}23\to \mathrm{P}37 \\ \to \mathrm{P}18\to \mathrm{P}12\to \mathrm{P}8 \\ \to \mathrm{P}17 \mathrm{or} \mathrm{P}24\to \mathrm{P}15 \\ \to \mathrm{Carboxtlic} \mathrm{acid} \mathrm{cycle} \\ \to \mathrm{Tricarboxylic} \mathrm{acid} \mathrm{cyclic} \mathrm{acid} \end{gathered}$$	[28]
Mycobacterium sp. flavescens PYR-1	*	$$\begin{gathered} \mathrm{Pyrene}\to \mathrm{P}62\to \mathrm{P}63\to \mathrm{P}48\to \mathrm{P}44\to \mathrm{P}55 \\ \to \mathrm{P}46\to \mathrm{P}60\to \mathrm{P}7 \end{gathered}$$	[43]
Mycobacterium sp. A1-PYR	Monooxygenases and Dioxygenases	$\mathrm{Pyrene}\to \mathrm{P}63\to \mathrm{P}44\to \mathrm{P}52$	[45]
Many bacterial strains including Mycobacterium	*	$$\begin{gathered} \mathrm{Pyrene}\to \mathrm{P}62\to \mathrm{P}44\to \mathrm{P}60\to \mathrm{P}37\to \mathrm{P}7 \\ \to \mathrm{Crboxlyic} \mathrm{acid} \\ \to \mathrm{Tricarboxylic} \mathrm{acid} \mathrm{cycle} \end{gathered}$$	[50]
Mycobacterium aromativorans Strain JS19b1	*	$$\begin{gathered} \mathrm{Pyrene}\to \mathrm{P}48\to \mathrm{P}44\to \mathrm{P}46\to \mathrm{P}22 \\ \to \mathrm{P}13 \mathrm{or} \mathrm{P}7 \end{gathered}$$	[70]
Mycobacterium vanbaalenii PYR-1	*	$\left(1\right) \mathrm{Pyrene}\to \mathrm{P}64\to \mathrm{P}56\to \mathrm{P}58\to \mathrm{P}66$ $$\begin{gathered} \left(2\right) \mathrm{Pyrene}\to \mathrm{P}62\to \mathrm{P}63\to \mathrm{P}48\to \mathrm{P}53\to \mathrm{P}39 \\ \to \mathrm{P}45\to \mathrm{P}30\to \mathrm{P}40\to \mathrm{P}7 \\ \to \mathrm{Tricarboxylic} \mathrm{acid} \mathrm{cycle} \end{gathered}$$	[71]
Leclerciaadecarboxylata PS4040	*	$\mathrm{Pyrene}\to \mathrm{P}69\to \mathrm{P}48\to \mathrm{P}12\to \mathrm{P}7\to \mathrm{P}13$	[73]
Coriolopsis byrsina strain APC5	laccase, LiP and MnP	$$\begin{gathered} \mathrm{Pyrene}\to \mathrm{P}62\to \mathrm{P}63\to \mathrm{P}51\to \mathrm{P}5\to \mathrm{P}72 \\ \to \mathrm{P}73\to \mathrm{P}6 \\ \to \mathrm{Tricarboxylic} \mathrm{acid} \mathrm{cycle} \\ \to {\mathrm{CO}}_2 \end{gathered}$$	[75]
Halophilic Hortaea sp. B15	Dioxygenase	$$\begin{gathered} \mathrm{Pyrene}\to \mathrm{P}49\to \mathrm{P}35\to \mathrm{P}7 \\ \to \mathrm{Tricarboxylic} \mathrm{acid} \mathrm{cycle} \end{gathered}$$	[77]
Pseudomonas sp. ISTPY2	*	$\mathrm{Pyrene}\to \mathrm{P}63\to \mathrm{P}7 \mathrm{or} \mathrm{P}22$ $\mathrm{P}7\to \mathrm{P}14 \mathrm{or} \mathrm{P}15\to \mathrm{Tricarboxylic} \mathrm{acid} \mathrm{cycle}$ $\mathrm{P}22\to \mathrm{P}13\to \mathrm{Tricarboxylic} \mathrm{acid} \mathrm{cycle}$	[80]
Achromobacterxylosoxidans PY4 strain	4-hydroxyphenylpyruvate dioxygenase and homogentisate 1,2-dioxygenase	$\mathrm{Pyrene}\to \mathrm{P}74\to \mathrm{P}51\to \mathrm{P}42 \mathrm{or} \mathrm{P}60$ $\mathrm{P}42\to \mathrm{P}31\to \mathrm{P}7\to \mathrm{Tricarboxylic} \mathrm{acid} \mathrm{cycle}$ $\mathrm{P}60\to \mathrm{P}75\to \mathrm{P}12\to \mathrm{Tricarboxylic} \mathrm{acid} \mathrm{cycle}$	[86]
Enterobacter sp. MM087 (KT933254)	*	$$\begin{gathered} \mathrm{Pyrene}\to \mathrm{P}62\to \mathrm{P}46\to \mathrm{p}23\to \mathrm{P}7 \\ \to \mathrm{Small} \mathrm{carboxylic} \mathrm{acids} \\ \to {\mathrm{CO}}_2+{\mathrm{H}}_2\mathrm{O} \end{gathered}$$	[87]
Consortium microbes	NidA, NidA3, and PAH-RHDα-GP)	$$\begin{gathered} \mathrm{Pyrene}\to \mathrm{P}62\to \mathrm{P}44\to \mathrm{P}46\to \mathrm{P}36\to \mathrm{P}26 \\ \to \mathrm{P}37\to \mathrm{p}18\to \mathrm{P}12\to \mathrm{P}7 \\ \to \mathrm{P}15 \\ \to \mathrm{Tricarboxylic} \mathrm{acid} \mathrm{cycle} \end{gathered}$$	[90]
Earthworm (Eisenia fetida)	Peroxidase, Laccase, Invertase, Glucosidase, Phosphatase, Phytase, Urease, Hydrolase, Chitinase, Nitrogenase, Aminopeptidase, and Arylsulfatase.	$\mathrm{Pyrene}\to \mathrm{P}68\to \mathrm{P}48\to \mathrm{P}44\to \mathrm{P}15$	[91]
Rhodococcus sp. UW1	*	$\left(1\right) \mathrm{Pyrene}\to \mathrm{P}63\to \mathrm{P}47\to \mathrm{P}65$ $\left(2\right) \mathrm{Pyrene}\to \mathrm{P}56\to \mathrm{P}70\to \mathrm{P}7$	[104]
Kocuria flava and Rhodococcus pyridinivorans	catechol 2,3-dioxygenase, dehydrogenase, and peroxidase	$$\begin{gathered} \mathrm{Pyrene}\to \mathrm{P}64\to \mathrm{P}65\to \mathrm{P}50 \\ \to \mathrm{Intermediat} \mathrm{products} \\ \to \mathrm{Tricarboxylic} \mathrm{acid} \mathrm{cycle} \end{gathered}$$	[105]
Ruegeria pomeroyi DSS-3, Dinoroseobacter shibae DFL 12, and Pelagibaca bermudensis HTCC2601	PahE	$$\begin{gathered} \mathrm{Pyrene}\to \mathrm{P}63\to \mathrm{P}44\to \mathrm{P}46\to \mathrm{P}23\to \mathrm{P}37 \\ \to \mathrm{P}22\to \mathrm{P}12\to \mathrm{P}19\to \mathrm{P}13 \\ \to \mathrm{P}3\to \mathrm{citric} \mathrm{acid} \mathrm{cycle} \end{gathered}$$	[106]
Rhodococcus sp.	MboI, RsaI, and AluI.	$$\begin{gathered} \mathrm{Pyrene}\to \mathrm{P}51\to \mathrm{P}29\to \mathrm{P}28\to \mathrm{P}21\to \mathrm{P}7 \\ \to \mathrm{Tricarboxylic} \mathrm{acid} \mathrm{cycle} \end{gathered}$$	[107]
Tolypocladium sp. strain CBMAI 1346and Xylaria sp. CBMAI 1464	Many enzymes for example (phenol 2-monooxygenase, epoxide hydrolases, and some dioxygenases)	$\mathrm{Pyrene}\to \mathrm{P}62\to \mathrm{P}44\to \mathrm{P}55\to \mathrm{P}52$	[108]

[* Data unavailable].

shows an example of pyrene degradation pathways via different microbial species.

5. Future Perspectives and Challenges

The current techniques for the biodegradation of pyrene by Mycobacterium strains still need further investigation for future works:

• A knowledge gap between pyrene oxidation at the field site compared to laboratory conditions needs to be addressed for each product seeking commercial success.
• The degradation of pyrene by Mycobacterium strains generates many metabolites. Some of the metabolites and their bio-toxicity have been identified, while most of them need bio-toxicity assessment.
• The main biodegradation drawback is the limitation of the bioavailability of the target pollutant. Therefore, it is highly recommended to add a biosurfactant to increase the bioavailability.
• The literature revealed that the biodegradation of pyrene via consortium microbial gives a better result than a single strain. That is referred to diverse enzymes capable of oxidizing pyrene and its metabolites.
• There are several studies that applied successful synergetic biodegradation systems for pyrene degradation, such as biofuel cells and coupling of the advanced oxidation process and biodegradation system.

6. Conclusions

This article attempted to provide a review of pyrene bioremediation using Mycobacterium strains in various biodegradation mediums. This study’s findings are summarized as follows:

• Mycobacterium strains are efficient biological agents to degrade pyrene, that is, referring to their ability to produce many functional enzymes able to metabolite pyrene and its transformation molecules.
• Phenantharene-4,5-dicarboxylic acid, dihydroxy pyrene, phenanthrene-4-carboxylic acid, phthalic acid, and pyrene-4,5-dihydrodiol were the most frequent metabolites that were detected when Mycobacterium sp. strains were used for pyrene degradation.
• Some metabolites showed positive results for the Ames mutagenicity prediction test, such as 1,2-phenanthrenedicarboxylic acid, 1-hydroxypyrene, 4,5-dihydropyrene, 4-phenanthrene-carboxylic acid, 3,4-Dihydroxyphenanthrene, Monohydroxy pyrene, and 9,10-phenanthrenequinone. However, 4-phenanthrol showed positive results for experimental and prediction tests.