Next Article in Journal
Morphological and Physiological Responses of Weigela florida ‘Eva Rathke’ to Biostimulants and Growth Promoters
Previous Article in Journal
Changes in Fatty Acid Profiles in Seeds of Camellia oleifera Treated by Mycorrhizal Fungi and Glomalin
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Horticulturae
Volume 10
Issue 6
10.3390/horticulturae10060581
horticulturae-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Garlic (Allium sativum L.) Invertase Genes: Genome-Wide Identification and Expression in Response to Abiotic Stresses and Phytohormones

by
Olga K. Anisimova
,
Anna V. Shchennikova
,
Elena Z. Kochieva
and
Mikhail A. Filyushin
*
Institute of Bioengineering, Research Center of Biotechnology, Russian Academy of Sciences, Leninsky Ave. 33, bld. 2, Moscow 119071, Russia
*
Author to whom correspondence should be addressed.
Horticulturae 2024, 10(6), 581; https://doi.org/10.3390/horticulturae10060581
Submission received: 26 April 2024 / Revised: 23 May 2024 / Accepted: 29 May 2024 / Published: 3 June 2024
(This article belongs to the Section Genetics, Genomics, Breeding, and Biotechnology (G2B2))
Browse Figures
Versions Notes

Abstract

:
Invertases are involved in plant growth, development, and stress adaptation; however, invertase-encoding genes have not yet been reported in Allium species. In this study, we identified 23 invertase izogenes in garlic (Allium sativum L.): 11 encoding putative neutral/alkaline (AsN/AINV1–11) and 12 acid (6 cell-wall—AsCWINV1–6 and 6 vacuolar—AsVINV1–6) enzymes. Among them, AsN/AINV1, 3, 8–10, AsCWINV2–5, and AsVINV2–6 showed significant transcription in garlic organs (roots, bulbs, pseudostems, leaves, sprouts, and reproductive parts) in a tissue-specific manner, whereas the AsN/AINV4–6, 11, AsCWINV1, 6, and AsVINV1 genes had weak or no detectable expression. Gene promoters contained nine, nine, and sixteen hormone-, stress-, and light-responsive cis-regulatory elements, respectively, and fifteen sites related to transcription factor binding and plant development. Expression analysis revealed that 12 invertase genes strongly transcribed in the roots of A. sativum cv. Ershuizao showed differential expression in the roots and leaves of A. sativum cv. Sarmat exposed to abiotic stresses (low temperature, high salinity, and drought) and phytohormones (abscisic acid and methyl jasmonate), which was significantly correlated with glucose, fructose, and sucrose contents. Our results should further functional analysis of invertases from Allium crops and contribute to the breeding of stress-tolerant varieties.

1. Introduction

Sucrose, a glucose–fructose disaccharide, is a primary metabolite in plants, a source of energy and carbon atoms for growth and development [1,2]. In agricultural crops, the contents of sucrose and its constituents are essential for yield, quality, and stress resistance [3,4,5,6]. Sucrose, as the final product of photosynthesis, is transported from photosynthetic to storage (sink) organs, where it undergoes reversible hydrolysis by sucrose synthase (EC 2.4.1.13) or irreversible cleavage by invertases (EC 3.2.1.26, also known as β-fructofuranosidases) to glucose and fructose [1,7]. The activity of sucrose synthase is considered important in the biosynthesis of cellulose and cell wall development [8], whereas the roles of invertases are more diverse, including carbon partitioning, sink development, sugar signaling, and stress response [9,10].
Plant invertases are classified into neutral/alkaline (N/AINV, optimum pH 6.5– 6.8/8.0–9.0), which can be localized in the cytosol, mitochondria, plastids, and nucleus, and acid; the latter are subdivided into soluble vacuole-located (VINV, optimum pH 4.5–5.5) and insoluble cell wall-associated (CWINV, optimum pH 3.5–5.0) [11]. N/AINVs belong to the glycoside hydrolase (GH) 100 family and CWINVs and VINVs belong to the GH32 family and share some enzymatic and biochemical properties [12,13].
Invertase gene families have been identified in the genome of many plant species, including model organism Arabidopsis thaliana, dicots such as Solanum tuberosum, Camellia sinensis, Malus domestica, Glycine max, and Pisum sativum, and monocots such as Oryza sativa, Zea mays, and Triticum aestivum [12,14,15,16,17]. The importance of invertases in plant development is emphasized by phylogenetic studies of cytosolic and organelle enzymes from algae to seed plants, which link the evolution of invertases to terrestrial colonization by land plants [18]. The facts that N/AINVs and VINVs/CWINVs are simultaneously present in plants and have similarity with the invertases of cyanobacteria and respiratory eukaryotes, respectively, and that VINVs/CWINVs are more diverse than N/AINVs are consistent with the origin of phototrophic eukaryotes through endosymbiosis between cyanobacteria and non-photosynthetic respiratory eukaryotes [15].
Both N/AINVs and VINVs/CWINVs have been reported to primarily participate in the development of leaves, roots, and reproductive organs (flower, fruit, and seed/grain), where they exert positive effects, and in the regulation of plant resistance to biotic and abiotic stresses [12]. It has been shown that the activity of acid invertases can be affected by pathogens, wounding, cold, osmotic stress, and phytohormones (gibberellic and abscisic acids, auxins, etc.) [14]; thus, in S. tuberosum tubers, VINVs are shown to be responsible for cold-inducing sweetening (negative agricultural trait) [15]. Cytosolic invertases are known to affect sugar homeostasis and stress tolerance of male meiocytes in Z. mays [19] and vegetative growth, flowering, fruit set, and yield in Solanum lycopersicum [20].
Despite the close involvement of invertases in plant growth and development, including agriculturally valuable traits, little is known about these enzymes in the Allium genus comprising well-known crops. Garlic (Allium sativum L.) is a popular spice plant with considerable medicinal properties due to the presence of a large number of biologically active compounds with beneficial health effects [21]; it is also used to improve soil quality through intercropping and crop rotation [22]. Garlic is cultivated all over the world, which, given its non-sexual reproduction, suggests high adaptive plasticity of the genome and a well-developed stress response system [23,24,25]; it is known to be sensitive to various abiotic stresses, including low temperatures [26], soil salinity [27,28], and drought [29]. Transcriptomic and metabolomic studies have revealed that stresses affect the metabolism of sucrose and fructans, which contribute to garlic yield and quality [26,27,28,29]. Thus, cold exposure results in an increase in the content of fructans, the main reserve carbohydrates in Allium species, and in the upregulation of key genes controlling fructan metabolism, including FEH, which encodes fructan exohydrolase [26].
Since the accumulation of sucrose and fructans increases plant stress resistance, the regulation of their metabolism is an important part of the plant stress defense mechanism [3,4,5,6,30]. Fructans are polymers of D-fructose and as such represent sucrose derivatives [31]. Similar to sucrose, fructans can act as osmoregulators and phloem-mobile signaling compounds under stress and may contribute to the overall homeostasis of cellular reactive oxygen species [31]. As fructan synthesis depends on D-fructose content, it is regulated by the activity of sucrose-hydrolyzing enzymes sucrose synthase and invertases. The degradation of fructans is catalyzed by FEHs, which hypothetically are derived from ancestral invertases—VINVs or CWINVs [32]. FEHs cleave only terminal bonds between fructose residues and lack invertase activity because of a mutation that changes substrate specificity [33].
The release of the high-quality genome and transcriptome sequence of A. sativum cultivar (cv.) Ershuizao [34] has facilitated the identification and characterization of garlic gene families [35,36,37,38]. In this study, we identified 23 genes of the invertase family in the A. sativum genome and performed their characterization in terms of structure, phylogeny, chromosomal location, tissue expression patterns, and abiotic stress responses. The results should be useful for further investigation of the physiological role of invertases in the development of garlic and onions in general and can be used in garlic breeding to obtain stress-resistant accessions.

2. Materials and Methods

2.1. Identification and Structure Analysis of the A. sativum Invertase Gene Family In Silico and In Vitro

The gene sequences annotated as invertases were searched in the A. sativum (cv. Ershuizao) genome (PRJNA606385, assembly Garlic.V2.fa) and transcriptomes (PRJNA607255) [34]. Sequences without start and stop codons were removed during analysis. All comparative sequence alignments were carried out in MEGA 7.0.26 [39]. The identified genes were characterized in terms of chromosomal localization (visualized in MG2C v2.1, http://mg2c.iask.in/mg2c_v2.1/; accessed on 3 December 2023), exon–intron structure (GSDS v2.0 [40]), and promoter-specific (~1.0 kb) cis-regulatory elements (PlantCARE, http://bioinformatics.psb.ugent.be/webtools/plantcare/html/; accessed on 3 December 2023). The putative protein products were characterized in terms of domain structure (Conserved Domain Database; https://www.ncbi.nlm.nih.gov/cdd; accessed on 3 December 2023), consensus motifs (MEME 5.5.5; http://meme-suite.org/tools/meme; accessed on 20 March 2024), molecular weight (MW) and isoelectric point (pI) (ExPASy ProtParam; https://www.expasy.org/resources/protparam; accessed on 3 December 2023), grand average of hydropathy (GRAVY) value (Protein GRAVY; https://www.genecorner.ugent.be/protein_gravy.html; accessed on 3 December 2023), phylogenetic relationships (MEGA 7.0.26: Neighbor-Joining method, the JTT matrix-based model, bootstrap 1000), subcellular localization prediction (WoLF PSORT; https://wolfpsort.hgc.jp/; accessed on 3 December 2023), prediction of signal peptide and transmembrane helices (DeepTMHMM; https://dtu.biolib.com/DeepTMHMM; accessed on 3 December 2023), and Gene Ontology (GO) functional annotation (PANNZER2 server; http://ekhidna2.biocenter.helsinki.fi/sanspanz/; accessed on 3 December 2023).
VINV coding sequences (CDSs) were amplified by PCR using mixed cDNA preparations from garlic cv. Sarmat seedlings and cDNA-specific primers based on the cv. Ershuizao data (Supplementary Table S1). RNA extraction and cDNA synthesis are described in Section 2.4. The amplicons were sequenced and analyzed using MEGA 7.0.26.

2.2. In Silico Profiling of A. sativum Invertase Gene Expression

Expression patterns of the invertase genes were determined in silico by analyzing the transcriptome of seven tissues of A. sativum cv. Ershuizao (PRJNA607255): roots, bulbs (at 192, 197, 202, 207, 212, 217, 222, and 227 days after sowing [DAS]), leaves, pseudostems, buds, sprouts (at 217 DAS), and flowers (at 217 DAS) [34]. The expression data were visualized as a heatmap using Heatmapper [41]; the reliability of gene transcription was determined according to the fragments per kilobase of transcripts per million reads mapped (FPKM) value ≥ 10.

2.3. Garlic Plants and Abiotic Stress Simulation

Winter garlic cv. Sarmat used in this study was kindly provided by the Federal Scientific Vegetable Center (Moscow region, Russia). Peeled garlic bulb cloves of a uniform size and without external signs of disease were selected, treated with 70% ethanol for 5 min, washed three times with water, and left to germinate in water until active growth of roots and sprouts (~3 weeks at 23–25 °C and 16 h light/8 h dark cycle).
The effects of each stress factor were tested using two biological and three technical replicates; untreated plants grown under normal (pre-stress) conditions were used as a control. Seedlings of 12–15 cm were exposed to cold (4 °C), drought (10% polyethylene glycol-6000), high salinity (250 mM NaCl), abscisic acid (ABA, 100 µM), or methyl jasmonate (MeJA, 100 µM) for 2, 4, 6, and 24 h; after 24 h, some experimental plants were returned to normal conditions for another 24 h (post-stress period). Leaves and roots were collected at each time point, frozen in liquid nitrogen, and stored at −80 °C until further analyses.

2.4. Invertase Gene Expression Analysis

Invertase gene expression was analyzed by quantitative (q) Real-Time (RT)-PCR. Total RNA was extracted from ~0.1 g of tissue using the RNeasy Plant Mini Kit and RNase free DNase set (QIAGEN, Hilden, Germany), and cDNA was synthesized using the GoScript Reverse Transcription System (Promega, Madison, WI, USA). The concentrations of RNA and cDNA were measured using Qubit® Fluorometer (Thermo Fisher Scientific, Waltham, MA, USA). Amplification was performed in a CFX96 Real-Time PCR Detection System (Bio-Rad Laboratories, Hercules, CA, USA) at the following cycling conditions: 95 °C for 5 min and 40 cycles of 95 °C for 15 s and 60 °C for 40 s. Reactions contained SYBR Green RT-PCR mixture (Syntol, Moscow, Russia), 3.0 ng of cDNA, and gene-specific primers, which were selected in cDNA variable regions and were separated by at least one intron according to the cv. Ershuizao genome and transcriptome [34] (Supplementary Table S1). Additional verification of primer specificity was performed using BLASTn (https://blast.ncbi.nlm.nih.gov/; accessed on 3 December 2023) and Primer3 (http://frodo.wi.mit.edu/primer3/, accessed on 3 December 2023).
The expression of the invertase genes was normalized to that of two stably expressed reference genes encoding ubiquitin (UBQ; NCBI Gene ID MZ171222.1) and glyceraldehyde-3-phosphate dehydrogenase (GAPDH; MZ171220.1); such combination increases the accuracy of qRT-PCR results compared to the single reference assay [42] and has been successfully used to test garlic gene expression [35,36,37,38].

2.5. Soluble Sugar Content

Garlic tissue samples were analyzed for the content (mg/100 g of fresh weight) of soluble sugars (glucose, fructose, and sucrose) using the Enzytec™ Liquid D-Glucose/D-Fructose and Enzytec™ Liquid Sucrose/D-Glucose kits (R-Biopharm AG, Darmstadt, Germany) according to the manufacturer’s instructions.

2.6. Statistical Analysis

Biochemical and qRT-PCR data were statistically processed using GraphPad Prism v. 9 (https://www.graphpad.com/scientific-software/prism/; accessed on 30 January 2024) and visualized as heatmaps using Excel. The data were compared based on One-Way ANOVA (multiple comparisons corrected with Bonferroni test); p < 0.05 was considered to indicate statistically significant difference.

3. Results

3.1. Invertase Gene Family in A. sativum

Twenty-three putative full-length invertase genes were detected through comparative analysis of the annotated A. sativum cv. Ershuizao genomic and transcriptomic data; among the genes, eleven, six, and six were identified as N/AINV-like, CWINV-like, and VINV-like and named as A. sativum (As) N/AINV1–11, AsCWINV1–6, and AsVINV1–6, respectively (the numbering was based on the order of gene location in the A. sativum chromosomes) (Table 1, Figure 1a). Gene sequences contained 4–6 (AsN/AINVs), 5–8 (AsCWINVs), or 2–6 (AsVINVs) exons (Figure 1b); no splice variants or intronless sequences were found.
Six AsN/AINV genes were located as three tandems of two genes on chromosome 1, two and two were located in tandems on chromosomes 5 and 7, respectively, and one gene was detected on chromosome 3 (Figure 1a). The exon–intron structures of tandem genes were similar for AsN/AINV1-AsN/AINV2 and AsN/AINV5-AsN/AINV6 but differed for AsN/AINV3-AsN/AINV4, AsN/AINV8-AsN/AINV9, and AsN/AINV10-AsN/AINV11; the structure of AsN/AINV7 located alone on chromosome 3 was similar to that of tandem genes AsN/AINV5-AsN/AINV6 (Figure 1b).
Among the AsCWINV genes, one, one, and two were located on chromosomes 1, 5, and 6, respectively, and two formed a tandem on chromosome 8 (Figure 1a); it should be noted that the two tandemly clustered genes (AsCWINV5 and 6) significantly differed in the exon–intron structure (Figure 1b).
The VINV genes were located on chromosomes 1 (AsVINV1), 2 (AsVINV2), 3 (AsVINV3), and 5 (AsVINV4) as single genes and clustered in tandem on chromosome 6 (AsVINV5/6) (Figure 1a); the latter had the same exon–intron structure (Figure 1b).
No invertase genes were found on garlic chromosome 4 (Figure 1a).
We also searched the garlic genome for FEH genes and found eight FEH-annotated sequences (Asa1G02142.1, Asa3G02847.1, Asa3G04718.1, Asa4G02029.1, Asa4G04915.1, Asa7G00583.1, Asa7G06871.1, and Asa7G07634.1) on chromosomes 1, 3, 4, and 7; however, they were incomplete and were not transcribed, as evidenced by transcriptomic analysis. These FEH-like sequences started with a methionine codon, and the putative translated regions (67–197 aa; Supplementary Table S2) were homologous to the C-terminal domain of acid invertases. It can be suggested that the observed truncation of the detected FEH-like sequences could be a result of inaccurate genome assembly; additional experimental verification is required. The presence of incomplete FEH-like sequences may also indicate that in addition to the 23 invertase genes found, there are also family members that were lost during genome assembly.
Next, we validated the assembly of the invertase CDSs using the VINV genes as an example. The AsVINV1–6 CDSs of A. sativum cv. Sarmat were amplified and sequenced (Supplementary Table S3). Sequence alignment with the AsVINV1–6 transcripts from cv. Ershuizao (PRJNA607255) verified the correct assembly of AsVINV1, 5, 6, whereas the AsVINV2–4 sequences were corrected, because it was found that these genes contained 9-bp mini-exon II lost during transcript assembly, and in case of AsVINV1, 5, 6, this 9 bp region was a 5′-part of exon II. We also found that the AsVINV4 cDNA included sequence gttgttgagtatgaatgcatcaaaagcagcggtgcag in exon V, which in the AsVINV4 gene of cv. Ershuizao was determined as the intron between exons VI and V because of the erroneous 1 bp insertion [34]. Thus, the verified AsVINV4 sequence contained 9 bp mini-exon II as well as exon V, which is the combination of ex-exons VI and V (Figure 1b,c).
Analysis of the AsCWINV2 gene sequence also suggested the presense of a similar 9 bp mini-exon missed in the annotation of Sun et al. [34].

3.2. Putative A. sativum Invertase Proteins

Putative AsN/AINV, AsCWINV, and AsVINV proteins contained 400–621, 512–611 and 584–738 amino acids (aa), respectively; their MW and pI values are shown in Table 1. The updated characteristics of AsVINVs in cv. Sarmat are given in Supplementary Table S3.
GO analysis indicated that garlic neutral/alkaline and acid invertases could be involved in sucrose catabolism (GO:0005987) and carbohydrate metabolism (GO:0005975). Thus, AsN/AINVs could have sucrose alpha-glucosidase (GO:0004575) and glycopeptide alpha-N-acetylgalactosaminidase (GO:0033926) activities, AsCWINVs—hydrolase activity (GO:0004553, GO:0016798), and AsVINVs—beta-fructofuranosidase activity (GO:0004564) (Supplementary Table S4).
The secondary structure of AsN/AINVs was characterized by the presence of the Glyco_hydro_100 domain (pfam12899), pointing to their possible membership in the GH100 family, whereas AsCWINVs and AsVINVs contained the Glyco_32 domain (smart00640) characteristic for the GH32 family (Supplementary Table S4).
In addition, AsVINVs (except AsVINV5) included an N-terminal DUF3357 domain (cl13304), which, according to [43], may consist of a signal peptide for vacuolar sorting and a propeptide associated with protein folding, targeting, and/or control of enzymatic activity. A transmembrane helix predicted in AsVINV2–6 and a signal peptide predicted in AsVINV1 (Supplementary Table S4) may suggest a role of the N-terminal region in facilitating the transport of AsVINVs through the tonoplast into the vacuole.
Consistent with the sequence annotation, WoLF PSORT analysis indicated the localization of AsN/AINVs in the cytoplasm (AsN/AINV2–4, 9–11) or chloroplasts (AsN/AINV1, 5–8) and AsVINV2–6 in the vacuoles; however, AsVINV1 was mapped to the cytoplasm (Supplementary Table S4). Unexpectedly, for AsCWINVs, the predicted subcellular localization was not the cell wall but the cytoplasm (AsCWINV1, 3–5), chloroplasts (AsCWINV2), and nucleus (AsCWINV6) (Supplementary Table S4). Such a discrepancy could be attributed to possible errors in the gene/transcript assemblage or to insufficient accuracy of WoLF PSORT, whose sensitivity and specificity are around 70% for some sites (such as the nucleus, mitochondria, cytosol, plasma membrane, chloroplast, and extracellular space) but very low for the other [44]. Nevertheless, the localization of garlic invertases in various subcellular organelles suggests a diversity of their roles associated with the spatiotemporal pattern of sucrose catabolism during plant growth, development, and adaptation to the environment.
The predicted pI values for garlic invertases were consistent with the data for plant invertases. Thus, vacuolar AsVINV1–6 had acidic pI (4.9–5.16), which is in agreement with their location in the vacuoles known for acidic pH. The cell wall enzymes had basic (7.72–8.48; AsCWINV2, 4) or slightly acidic (5.86–6.35; AsCWINV1, 3, 5, 6) pI values and most neutral/alkaline invertases had slightly acidic pI (5.53–6.61), except for AsN/AINV11 (8.73) (Table 1); acidic pI has also previously been observed for neutral/alkaline invertases in other plant species [16].
The hallmarks of acid invertases include the Cys residue in the WECXDF motif near the C-terminus and the NDPNG pentapeptide near the N-terminus [43]. Our analysis indicated that all acid invertases found in garlic contained the WECV(P/I)DF motif and most of them had the N(T)DPNG(A) pentapeptide, with the exception of AsCWINV2 and AsVINV2–4, which contained only NG but not DPN (Supplementary Figure S1). In this respect, it should be noted that in the cDNAs of the AsVINV2–4 and AsCWINV2 genes of cv. Sarmat, the DPN motif was encoded by the 9 bp exon II, which is lost or mapped as an intronic sequence during the assembly of these genes in cv. Ershuizao [34]. This fact suggests that the absence of the DPN consensus in the cv. Ershuizao invertases could be due to errors in gene assembly.
Analysis of the AsVINV and AsCWINV sequences for the analogue of Asp239, which is responsible for the functional difference between acid invertases and FEHs [33], revealed a corresponding Asp residue in all AsVINVs (Asp277, 431, 336, 336, 345, and 341 in AsVINV1–6, respectively) and in most AsCWINVs (Asp264, 246, 208, 223, and 316 in AsCWINV2–6, respectively), except AsCWINV1, which did not contain the target Asp because of the incomplete N-terminal sequence. Thus, we can conclude that all AsVINV and AsCWINV genes encode acid invertases and not FEHs.
Phylogenetic analysis confirmed the evolutionary division of garlic invertases into neutral/alkaline and acid, which in turn are branched into α/β N/AINVs and CWINVs/VINVs, respectively (Figure 2). Comparison with the invertases of A. thaliana (dicot) and Z. mays (monocot) revealed that the Arabidopsis proteins mostly formed separate clusters, whereas maize invertases showed closer homology with garlic izozymes, which is consistent with the monocot nature of both plants (Figure 2). The high level of similarity between garlic invertases and their maize orthologs suggests similar functional activities.
The demonstrated phylogenetic division was supported by MEME-based analysis, which revealed nine and fifteen conserved motifs in AsN/AINVs and AsVINVs/AsCWINVs, respectively (Figure 3). Thus, in AsN/AINVs, sequential motifs 6-4-5-2-1-3 constituted the Glyco_hydro_100 (pfam12899) domain (Figure 3b, Supplementary Table S4). The absence of some of these motifs (6-4-5 in AsN/AINV1, 10; 6 in AsN/AINV4, and 3 in AsN/AINV7) or the presence of unusual motifs (8 and/or 9 in AsN/AINV5–7) may be due to incomplete or incorrectly assembled gene sequences.
In AsVINVs/CWINVs, sequential motifs 5-2-7-10-3-8-1-9-14-6-11-4 represented the Glyco_32 (smart00640) domain. N-terminal motif 12 (which corresponds to the DUF3357 (cl13304) domain in the AsVINVs) and C-terminal motifs 13 and 15 define the difference between AsCWINVs and AsVINVs (Figure 3c, Supplementary Table S4).
Thus, both neutral/alkaline and acid invertases of garlic are characterized by highly conserved group-specific motif arrangements, which point on the functional similarity of the enzymes within each group.

3.3. Analysis of Promoter Regions in the A. sativum Invertase Genes

Considering that transcriptional regulation of sucrose metabolism-related genes plays an important role in plant stress response, we searched for the corresponding cis-acting regulatory elements in the putative invertase gene promoter regions (~1 kb upstream of the start codon). As a result, we detected nine sites associated with phytohormone signaling, nine—with stress responses, sixteen—with light response, and fifteen—with developmental processes and transcription factor (TF) binding (Figure 4).
Among the elements, the most represented were those associated with the responses to hormones ABA (ABRE, CARE), JA (CGTCA-motif), and ethylene (ERE), stresses such as heat, osmotic, low pH, nutrient starvation, and hypoxia (STRE, ARE), light (Box 4, C-Box), and binding to MYB and MYC TFs. Among all genes, only two (AsN/AINV10 and AsVINV4) did not have hormone response elements and six (AsN/AINV1, 9, 10; AsCWINV2, 6, and AsVINV2) lacked developmental process-associated sites. Although all genes except AsCWINV6 had light-responsive elements in the promoter, only four (AsN/AINV3, 4, 7, 11) had elements associated with circadian rhythms.
Rare elements such as those associated with responses to auxin (AuxRR-core or TGA-motif) or gibberellin (P-box or GARE-motif) were found in five (AsCWINV3, 5, 6 and AsVINV2, 3) and three (AsCWINV3 and AsVINV5, 6) genes, respectively.
In line with the important and complex role of phytohormones in stress responses [45], invertase promoters that differed in the content of phytohormone-related sites also differed in abiotic and biotic stress-responsive elements. Besides the most represented STRE and ARE mentioned above, we found sites associated with the response to low temperature (LTR) in 10 genes (AsN/AINV2, 3, 5, 6, AsCWINV2, 6 and AsVINV1, 3, 4, 6), biotic stress (W-box, Wun-motif, WRE3, box S, AAGAA-motif) in 13 genes (AsN/AINV2–10 and AsCWINV1, 4–6), and nitrogen (O2-site, GCN4-motif; these elements are also related to endosperm-specific gene expression) in 10 genes (AsN/AINV4–8, AsCWINV3, 5 and AsVINV3, 4, 6). A drought-responsive element (DRE1/DRE core) was found in one gene (AsN/AINV3).
Considering the paramount role of various TFs in the regulation of plant stress response [46], it was not surprising to find cis-elements for TF binding in the promoters of most invertase genes. Thus, sites for MYB TFs were detected in all genes except AsVINV4, 6, those for MYC TFs—in nineteen genes, for WRKY TFs—in fourteen, for bZIP TFs—in three, and for HD-Zip I TFs—in two. In addition, the binding sites for nuclear factor GT-1, a key enzyme for carbon fixation in higher plants [47], were found in the promoters of AsN/AINV1, 8.
Sites associated with the specificity of gene expression to endosperm (AsN/AINV4–8, AsCWINV3, 5, and AsVINV3, 4, 6), meristem (AsN/AINV4 and AsCWINV1, 4), or cell cycle stage (AsVINV5) were also detected.
Comparison of the promoters in neutral/alkaline and acid invertase genes revealed that they mostly differed in the profiles of light-sensitive elements; furthermore, there were no auxin- and gibberellin-associated sites in the AsN/AINV genes (Figure 4).

3.4. Organ-Specific Expression Pattern of the Invertase Genes in Garlic

The expression of invertase genes was analyzed based on the A. sativum cv. Ershuizao transcriptome (PRJNA607255). Overall, the highest transcription levels were most frequently observed in the roots, pseudostems, leaves, and flowers (up to 420, 270, 358, and 487 FPKM, respectively).
Seven genes (AsN/AINV4-6, 11, AsCWINV1, 6, and AsVINV1) had very weak or no expression in garlic tissues and are likely to be inactive. The remaining 16 genes showed organ-specific expression patterns; AsN/AINV2, 9, AsCWINV2, 4, and AsVINV5 had maximal activity in the roots, AsCWINV5—in stage 5 bulbs, AsN/AINV8, 10 and AsVINV3, 4—in the leaves, AsCWINV3 and AsVINV2—in the pseudostems, AsN/AINV7—in the sprouts, and AsN/AINV1, 3 and AsVINV6—in the flowers (Figure 5). Relatively high expression levels were also observed for AsN/AINV1, 3, 8, AsCWINV3, 5, and AsVINV2–4, 6 in the roots, AsN/AINV3, 7–9, AsCWINV3, 4, and AsVINV3–6 in the bulbs, AsN/AINV1, 3, 7–9, AsCWINV2, 4, 5, and AsVINV3, 4, 6 in the pseudostems, AsN/AINV1, 3, 7, 9, AsCWINV2–5, and AsVINV2, 5, 6 in the leaves, AsN/AINV1, 3, 8-10 AsCWINV3–5, and AsVINV5 in the sprouts, AsN/AINV3, 7–9, AsCWINV3–5, and AsVINV5 in the buds, and AsN/AINV2, 7–9, AsCWINV2–5, and AsVINV3, 4 in the flowers (Figure 5).
During the development of buds into flowers, some genes were significantly upregulated (AsN/AINV1–3, AsCWINV2, 3, 5, and AsVINV3, 4, 6) or downregulated (AsN/AINV4, 6, 10, AsCWINV4, and AsVINV2, 5) (Figure 5).
During bulb growth over 36 days (stages 1–8), the strongest expression was observed for AsCWINV3, 5, with a tendency to increase towards middle stages and decrease towards the final stage (Figure 5).
Analysis of the correlation between gene expression and the degree of structural similarity provided both positive and negative examples. Thus, genes AsVINV3, 4, which had a high degree of similarity in the gene structure and composition of cis-elements in the promoter, showed similar expression profiles and genes AsVINV5, 6, which had similar structures but differed in the cis-element content, also differed in organ-specific expression. However, genes AsCWINV5, 6 with similar structures and promoter compositions did not show similarity in the expression patterns (Figure 1b, Figure 4, and Figure 5).

3.5. Expression of Invertase Genes in cv. Sarmat Seedlings in Response to High Salinity, Drought, Cold, and Phytohormones

Next, we addressed transcriptional responses to abiotic stresses of 12 genes that showed distinct expression patterns in A. sativum cv. Ershuizao: AsN/AINV1, 3, 9, AsCWINV2–5, and AsVINV2, 3/4, 5, 6.
The CDSs of AsVINV3 and 4 are highly homologous and are expressed in a very similar manner in cv. Ershuizao (Figure 5). As it was not possible to select primers specific for each of these genes, the final qRT-PCR primers (Supplementary Table S1) revealed the total expression level of AsVINV3 and 4.
Transcriptional analysis of garlic cv. Sarmat plants after exposure to high salinity, drought, cold, and phytohormones revealed that stresses had different effects on the activity of the 12 invertase genes in the roots and shoots (Figure 6, Supplementary Figure S2).

3.5.1. Response to High Salinity

Thus, in the roots, the salinity stress caused a rather suppressive effect on the expression of the analyzed genes, with the exception of an increase in the expression of AsN/AINV1, AsCWINV3, 5 and AsVINV3/4 at the beginning of treatment. By the end of the stress period (24 h), gene expression returned to control values, remained decreased (AsN/AINV3, AsVINV6) or increased (AsCWINV3, 5, AsVINV5). In the shoots, the transcriptional response to salt stress was characterized by sharp upregulation of AsCWINV2, 4 and AsVINV2, 5, 6 at 2 and 4 h and their downregulation at 6 h. By the end of the stress period (24 h), gene expression returned to control values, or was upregulated (AsCWINV3–5, AsVINV2–5) (Figure 6, Supplementary Figure S2).

3.5.2. Response to Drought

During the drought stress, the strongest transcriptional response in the roots was observed for AsN/AINV1, AsCWINV2, and AsVINV2, 5, 6, which were sharply downregulated, and AsN/AINV3, AsCWINV3, which was sharply upregulated at 2 h. At 24 h, the mRNA level of AsN/AINV3 and AsCWINV3 remained high and AsVINV6 became equal to control, whereas the other genes remained downregulated. After 24 h of post-stress treatment, most genes were downregulated, except for AsN/AINV1 and AsVINV5, which were equal to control, and AsCWINV3, 4 which were upregulated (Figure 6, Supplementary Figure S2).
In the shoots, the transcriptional response to drought stress was noticeably different from that in the roots. Thus, after 2–4 h, the expression of AsN/AINV1, AsCWINV2, 4, and AsVINV2, 5, 6 increased, whereas that of AsN/AINV9 and AsVINV3/4 decreased. By 24 h, all genes except AsCWINV4 and AsVINV3, 6 were significantly downregulated, and after 24 h in post-stress conditions, AsN/AINV1, 3, 9, AsCWINV5, and AsVINV5 remained downregulated, AsVINV2, 3/4, 6 levels were recovered to the pre-stress values, and AsCWINV2–4 were upregulated (Figure 6, Supplementary Figure S2).

3.5.3. Response to Cold

The response to cold in the roots was rather weak in the first hours; gene expression mostly remained at the normal level or changed slightly, except for AsN/AINV9 and AsCWINV3 (upregulation). However, at the end (24 h), the AsVINV5, 6 genes were sharply upregulated (by ~1000 and ~138 times, respectively), but after 24 h post-stress period, both were downregulated to an almost zero level. At the same time, AsN/AINV9, AsCWINV2, 5 and AsVINV2 were upregulated, and AsCWINV3, 4 and AsVINV3/4—downregulated (Figure 6, Supplementary Figure S2).
In the shoots, 2 h cold stress decreased the expression of AsN/AINV1, AsCWINV2, and AsVINV3/4, 6 and increased that of AsCWINV3–5 and AsVINV2, 5. After 4 h, the situation changed to the opposite; AsN/AINV1, AsCWINV2 and AsVINV3/4, 6 were upregulated, whereas AsCWINV5 and AsVINV2, 5 were downregulated. By the end of the stress period (24 h), the expression of most genes was increased, especially that of AsVINV5 (by ~114 times); however, the latter was downregulated after 24 h post-stress exposure (~2 times below the control value). Overall, after 24 h in post-stress conditions, most genes were downregulated below the control level, except for AsN/AINV9, AsCWINV2, and AsVINV3/4, 6, which were upregulated (Figure 6, Supplementary Figure S2).

3.5.4. Response to Phytohormones

The response of garlic seedlings to phytohormones MeJA and ABA varied significantly.
In the roots, the expression of all genes after MeJA treatment was mostly downregulated, with few exceptions (AsN/AINV1, AsCWINV4). In contrast, in the shoots, several genes were significantly upregulated at the early points (2–4 h): AsN/AINV1 by ~2 times, AsCWINV2 by ~5–3 times, AsCWINV4 by ~1.5–1.7 times, AsVINV2 by ~1.5–2 times, AsVINV5 by ~11–3.5 times, and AsVINV6 by ~2–3 times. By 24 h, AsN/AINV1, AsCWINV2, 4, and AsVINV6 were upregulated, whereas the other genes were downregulated. After 24 h of post-stress treatment, the expression of AsCWINV2–4 and AsVINV6 was increased, that of AsN/AINV1, and AsVINV2, 5 returned to normal, and that of the remaining genes was decreased (Figure 6, Supplementary Figure S2).
In the ABA-treated roots, the transcription of AsN/AINV1, 3, 9, AsCWINV2, 4, and AsVINV3/4 was mostly decreased, whereas that of AsCWINV3 and AsVINV6 was increased. The expression of AsVINV2 was upregulated by ~4 times after 6 h stress but was significantly downregulated, similar to that of AsVINV3/4, after 24 h stress and 24 h post-stress. The AsCWINV5 mRNA level decreased at 2, 6, 24 h of stress but increased at 4 h of stress and 24 h post-stress. The most interesting response was detected in AsVINV6, which was significantly upregulated during stress (by 13–47 times) but was sharply downregulated (to an almost zero level) after stress (Figure 6, Supplementary Figure S2).
In the shoots, the most remarkable effect was observed for AsVINV5, which was upregulated (16.5-fold) at 2 h, significantly downregulated at 4–24 h, and again upregulated (~5-fold) after 24 h of post-stress treatment. No effect was found for the gene AsVINV2. The AsN/AINV1, AsCWINV2, AsVINV6 genes were upregulated after 2 h stress, and then were downregulated at 6 h; at 24 h post-stress, AsVINV6 was upregulated, and AsN/AINV1 and AsCWINV2 returned to the control level (Figure 6, Supplementary Figure S2).
Overall, these results revealed that the expression of all 12 analyzed genes was affected (sometimes in an organ-dependent manner) by tested abiotic stresses and phytohormone treatments, suggesting the role of invertases in the regulation of defense responses in garlic.

3.6. Sucrose, Glucose, and Fructose Content in cv. Sarmat Seedlings in Response to Cold, Drought, High Salinity, and Phytohormones

The stress-exposed and phytohormone-treated garlic seedlings were also analyzed for the content of soluble sugars: sucrose, glucose, and fructose.
The results showed that the concentration of all sugars in the roots was increased in response to salt stress (2–24 h); at 24 h post-stress, the content of monosaccharides was decreased, whereas that of sucrose was increased. In the shoots, the levels of monosaccharides slightly differed from the control, whereas that of sucrose was increased by ~15 times at 2 h and further dynamics at each point were opposite to the control (Figure 7, Supplementary Figure S3).
During and after drought exposure, the content of all sugars in the roots was decreased to trace levels, whereas in the shoots, the contents of glucose and fructose were slightly increased and that of sucrose was increased by ~15 times (2 h), remained higher than the control throughout the stress, and after stress decreased and became equal to the control (24 h post-stress) (Figure 7, Supplementary Figure S3).
In cold-affected roots, the content of monosaccharides was stable at early time points, increased by 2 times after 24 h of stress, and became equal to the control 24 h after stress period. The amount of sucrose decreased by 1.5 times after 2 h, returned to the control level at 4–24 h, and increased by 2 times at 24 h post-stress. In the shoots, the level of monosaccharides was increased at 2 h, then fluctuated in the opposite way to the control at 4–24 h, and returned to the control value 24 h after the post-stress treatment. The amount of sucrose fluctuated from control values (2 h) to decrease (4 h), increase (6–24 h), and another sharp decrease almost to zero (24 h post-stress) (Figure 7, Supplementary Figure S3).
In the ABA-treated roots, the content of all sugars showed similar dynamics; glucose and fructose levels first decreased (2–4 h) and then increased by ~1.2–1.8 times (6–24 h and 24 h post-stress) and sucrose levels also slightly decreased at the early points (2–6 h), later returned to normal (24 h), and then increased by 1.7 times (24 h post-stress). In the shoots, the content of monosaccharides remained practically unchanged during treatment and then increased by ~1.2–1.3 times at 24 h post-stress, whereas that of sucrose fluctuated in the opposite way to the control at 4–24 h, and became equal to the control value 24 h after the post-stress treatment (Figure 7, Supplementary Figure S3).
In the MeJA-treated roots, all analyzed sugars were decreased at all time points, except for glucose and fructose, which were increased by ~1.3 times at 6 h of treatment. In the shoots, the contents of glucose and fructose practically coincided with the control, except for increasing by ~1.3 times at 6 h of treatment. Sucrose content increased by ~4–15 times at 2–6 h and became equal to the control values at the end of stress period (24 h) and at 24 h post-stress (Figure 7, Supplementary Figure S3).
Thus, the most dramatic changes in the content of all analyzed sugars were observed under drought conditions; moreover, the roots and shoots reacted in the opposite way. Cold stress practically reversed the daily fluctuations in sugar concentrations; at 24 h after stress, only the values of glucose and fructose returned to normal, while sucrose still showed a significant difference with the control (higher in roots and lower in shoots). Salt stress did not affect the content of monosaccharides, but significantly increased the sucrose level in the roots and reversed the daily fluctuations of sucrose in the shoots. When treated with phytohormones, we note that a day after the plants returned to normal conditions, the sugar content in the roots still remained significantly lower (MeJA) or higher (ABA) than the control, while in the shoots, it returned to normal (except for elevated glucose levels in case of ABA treatment).
These findings show that in garlic, various stress conditions affected soluble sugar content, which may be associated with the expression of invertase genes. Indeed, correlation analysis indicated that in the roots, glucose content was positively correlated with AsN/AINV1 and AsVINV6 expression under salinity stress, AsCWINV3, 5 and AsVINV5, 6 expression under cold stress, AsN/AINV1, 3, 9 and AsVINV3/4 expression under drought stress, and AsCWINV2, 3 expression after MeJA treatment (Figure 8a). At the same time, glucose content had negative correlation with AsCWINV5 expression under salt stress, AsN/AINV1, 3 and AsVINV3/4 expression under cold stress, AsCWINV3, 4 and AsVINV5 expression under drought stress, and AsN/AINV3, 9, AsCWINV5, and AsVINV3/4, 6 expression after MeJA treatment. Positive association was found between fructose content and AsCWINV3, 5 and AsVINV5, 6 expression under cold stress, AsN/AINV1, 3, 9 and AsVINV3/4 expression under drought stress, and AsCWINV3 and AsCWINV2, 3 expression after ABA and MeJA treatment, respectively. Fructose content was negatively correlated with AsCWINV3–5 activity under salt stress, AsN/AINV3 and AsVINV3/4 activity under cold stress, AsCWINV3, 4 and AsVINV2, 5 activity under drought stress, AsN/AINV1, AsCWINV2, and AsVINV2, 3/4, 6 activity after ABA treatment, and AsN/AINV3, 9, AsCWINV5, and AsVINV3/4, 6 activity after MeJAtreatment (Figure 8a). Sucrose content showed negative correlation with the activity of AsVINV3/4, 5, 6 under salt stress, that of AsN/AINV3, AsCWINV2, and AsVINV3/4 under cold stress, that of AsN/AINV1, 3, AsCWINV2, and AsVINV2, 3/4, 6 after ABA treatment, and that of AsN/AINV9 and AsVINV3/4 after MeJA treatment. Positive correlation of sucrose content was observed with AsCWINV3 and AsVINV3/4 expression under drought stress, AsCWINV3, 5 expression after ABA treatment, and AsN/AINV1, AsCWINV2–4, and AsVINV 5 expression after MeJA treatment (Figure 8a).
In the shoots, glucose content was directly correlated with AsCWINV2 and AsVINV5, 6 activity under salt stress, AsVINV3/4, 5, 6 activity under drought stress, AsCWINV5 and AsVINV2 activity under cold stress, AsCWINV4 and AsVINV5 activity after ABA treatment, and the activity of all genes except AsVINV2, 3/4, 6 after MeJA treatment. Inverse correlation of glucose content was detected with AsN/AINV1, AsCWINV5, and AsVINV3/4 expression under salt stress, AsN/AINV1 and AsVINV3/4 expression under cold stress, and AsN/AINV9 and AsCWINV2 expression after ABA treatment. Fructose levels were positively associated with the activity of AsCWINV2, 3 under salt stress, AsN/AINV1, 9, AsCWINV4, and AsVINV5, 6 expression under drought stress, AsN/AINV9, AsCWINV5, and AsVINV5 expression under cold stress, AsN/AINV1, AsCWINV4, and AsVINV5 expression after ABA treatment, and the activity of all genes except AsVINV2, 3/4, 6 after MeJA treatment. Negative association was found between fructose levels and AsN/AINV9, AsCWINV5, and AsVINV3/4 expression under salt stress, AsN/AINV1 expression under cold stress, and AsCWINV2 expression after ABA treatment (Figure 8b). Sucrose content mostly showed negative correlation with the expression of invertase genes: AsN/AINV1, 3, AsCWINV3, 4, and AsVINV2 under salt stress, AsN/AINV9 under cold stress, AsCWINV3, 5 and AsVINV2 under drought stress, AsN/AINV1, 3, 9, AsCWINV3-5, and AsVINV3/4 after ABA treatment, and AsVINV3/4 after MeJA treatment. Positive correlation of sucrose content was found only with AsCWINV2 and AsVINV6 expression after MeJA treatment (Figure 8b).
Thus, the expression level of 12 analyzed genes was linked to varying degrees with the garlic plant response to all tested treatments. Overall, the expression level of neutral/alkaline invertase genes can be most closely associated with the response to drought (roots) and MeJA (shoots); AsCWINVs—with the response to cold (roots) and phytohormones (roots, shoots); AsVINVs—with the response to cold (roots) and drought (shoots).

4. Discussion

This study provides the first comprehensive characterization of the A. sativum invertase genes, which are considered to be critical players in plant growth, development, and stress response [12]. By analyzing the A. sativum cv. Ershuizao genome, we found eleven neutral/alkaline (cytosolic) and twelve acid (six cell wall and six vacuolar) invertase-encoding genes (Table 1); the number of genes was comparable to that reported in both dicots and monocots [17]. Although the genes of acid invertases are thought to be much more extensively duplicated and more diverse than those of neutral/alkaline invertases [15], the invertase family in garlic contained almost the same numbers of the two types of invertases.
Using vacuolar invertases as an example, we confirmed the accuracy of the assembly of AsVINV1, 5, 6 CDSs and made corrections to the AsVINV2–4 gene sequences (Figure 1c, Supplementary Table S3), among which the most important was the 9 bp mini-exon found in AsVINV2–4 and also assumed to be present in AsCWINV2. Thus, four of the twelve acid invertase isogenes in garlic contain this mini-exon, which is thought to be common for acid invertases in plants. Analysis of the invertase phylogeny in view of the presence of the mini-exon suggests the emergence of isogenes, in which the 9 bp sequence is a part of other exons, through exon fusion events during evolution [16]. The 9 bp sequence encodes the functionally important DPN consensus [43], and its presence in all identified acid invertases suggests their catalytic activity.
The conserved domains and motifs found in all putative garlic invertases (Figure 3b) point to their functional conservation, including the role in plant growth, development, and stress response [12]. This notion is supported by the detection of numerous cis-regulatory elements in invertase gene promoters, which are associated with hormone and stress responses and binding to TFs (Figure 4). Considering the data on the motif profiles and promoter composition as well as tandem location of the genes on chromosomes, similarity of exon structure, and phylogenetic relationships (Figure 1, Figure 2 and Figure 3), it can be suggested that garlic invertase genes AsN/AINV5-7, AsVINV3, 4, and AsVINV1, 5, 6 should encode three groups of proteins with most similar functional activity and redundant roles within each.
The influence of invertases on plant growth may vary depending on the organ/tissue. Analysis of the expression patterns of the garlic invertase genes based on the transcriptome data [34] (Figure 5) revealed genes with predominant transcription in the roots (AsN/AINV1, 3, 8, 9, AsCWINV2–4, and AsVINV3–6), bulbs (AsN/AINV3, 8, 9, AsCWINV3, 5, and AsVINV3–6), pseudostems (AsN/AINV3, 8, 9, AsCWINV2–5, and AsVINV2–4, 6), leaves (AsN/AINV3, 8–10, AsCWINV2, and AsVINV3, 4, 6), sprouts (AsN/AINV3, 9, AsCWINV5, and AsVINV5), and reproductive organs (AsN/AINV1, 3, 9, AsCWINV3–5, and AsVINV3, 4, 6). These results are consistent with previous studies, indicating the requirement of both neutral/alkaline and acid invertases for vegetative growth and reproductive development [12,16,47]. It should be noted that seven of the twenty-three invertase genes identified in garlic had very weak or no expression in any organs (Figure 5), suggesting their pseudogenic nature or unknown functions, which could be associated with certain processes, time periods, or responses to exotic stress types.
It is known that invertases may play a role in plant adaptation to unfavorable conditions through changes in their activity, including transcription, which is sensitive to the effects of various abiotic and biotic factors [14]. Therefore, we analyzed the expression of 12 genes encoding neutral/alkaline, cell wall, and vacuolar invertases, which were selected based on their high mRNA levels revealed in silico (Figure 5), and tested their expression in the roots and shoots of garlic plants exposed to cold, drought, high salinity, and phytohormones. All 12 genes were found to be differentially expressed under stresses, and the responses differed depending on the organ and stress factor (Figure 6, Supplementary Figure S2), which is in agreement with previous observations that in unfavorable conditions, individual invertase genes are transcribed in an organ- and developmental stage-specific manner [12]. These results indicate that neutral/alkaline, cell wall, and vacuolar isoenzymes could jointly regulate sugar metabolism in garlic, protecting the plant from adverse environmental effects.
Since sugars play a key role in the perception and transmission of stress signals, osmotic adaptation, and neutralization of reactive oxygen species [47,48,49], the activity of invertases is critical for plant survival under stress. Studies in citrus, kiwi, wheat, and other plants indicate that the concentration of soluble sugars (sucrose, fructose, and glucose) depends on the expression and function of vacuolar invertases [48,50]. Protection from stress-related effects is facilitated by changes in the content of hexoses through hydrolysis of sucrose by all invertases and fructans by acid invertases and FEHs [14,15]. Consistent with these data, transcriptomic analyses indicate that the adaptive response of garlic under salt stress includes regulation of sucrose metabolism [27,28] and that fructans, which along with sucrose are important storage sugars, can stimulate garlic resistance to low temperatures [26] and drought [29].
In our study, we found that the expression of the 12 analyzed garlic invertase genes had statistically significant correlation with the content of glucose, fructose, and/or sucrose (Figure 8), which should affect the synthesis of fructans and, consequently, stress resistance of garlic. In this scenario, sucrose could be hydrolyzed by all invertases and fructans—by acid invertases, since we did not find full-length FEH genes or their transcripts in the genome and transcriptome of A. sativum [34].

5. Conclusions

We identified and characterized twenty-three invertase genes in A. sativum cv. Ershuizao; among them, eleven encoded alkaline/neutral (cytosolic) and twelve—acid (six vacuolar and six cell wall) invertases. The coding sequences of the six vacuolar invertase genes were confirmed or corrected through alignment with the sequences amplified from cDNA of cv. Sarmat. Transcriptomic analysis revealed that 16 invertase genes were expressed at considerable levels in garlic organs. Expression profiling of garlic shoots and roots exposed to abiotic stresses (cold, drought, salinity) and hormones (ABA, MeJA) showed that 12 genes had distinct expression patterns depending on the organ and stress factor, which were significantly correlated with the content of soluble sugars. Our results indicate that garlic invertases may be involved in plant defense by maintaining the required balance of soluble sugars. The identification and characterization of the invertase isogenes in A. sativum provides the basis for their further functional analysis and may contribute to the breeding of stress-tolerant garlic cultivars.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/horticulturae10060581/s1, Table S1: List of primers for Allium sativum invertase gene amplification, sequencing, and expression analysis; Table S2: Sequences of putative FEH proteins based on A. sativum cv. Ershuizao genome data; Table S3: Characteristics of vacuolar invertases in cv. Sarmat; Table S4: Predicted characteristics of A. sativum invertases; Table S5: Invertase amino acid sequences used for structural and phylogenetic analysis; Table S6: Cis-regulatory elements in the promoters of A. sativum cv. Ershuizao invertase genes; Table S7: FPKM values for invertase gene expression in A. sativum cv. Ershuizao; Figure S1: Alignment of the AsN/AINV1–11 (a) and AsCWINV1–6/AsVINV1–6 (b) proteins; Figure S2: Time-dependent invertase gene expression in response to abiotic stresses. A. sativum cv. Sarmat seedlings were exposed to the indicated factors for 2, 4, 6, and 24 h and then returned to normal conditions for 24 h (24 h R); Figure S3: Changes in the soluble sugar content in garlic cv. Sarmat roots and shoots in response to stress (salinity, drought, and cold) and phytohormones (ABA and MeJA).

Author Contributions

Investigation, M.A.F. and O.K.A.; formal analysis: E.Z.K., A.V.S. and M.A.F.; writing, A.V.S., M.A.F. and E.Z.K. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Ministry of Science and Higher Education of the Russian Federation in accordance with agreement № 075-15-2022-318 on 20 April 2022 on providing a grant in the form of subsidies from the Federal budget of Russian Federation. The grant was provided for state support for the creation and development of a World-class Scientific Center “Agrotechnologies for the Future”.

Data Availability Statement

The original contributions presented in the study are included in the article and Supplementary Material, further inquiries can be directed to the corresponding author.

Acknowledgments

We would like to thank Marina Chuenkova for English language editing. This work was performed using the experimental climate control facility in the Institute of Bioengineering (Research Center of Biotechnology, Russian Academy of Sciences).

Conflicts of Interest

The authors declare no conflicts of interest. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript; or in the decision to publish the results.

References

  1. Ruan, Y.L. Sucrose metabolism: Gateway to diverse carbon use and sugar signaling. Annu. Rev. Plant Biol. 2014, 65, 33–67. [Google Scholar] [CrossRef]
  2. Yoon, J.; Cho, L.H.; Tun, W.; Jeon, J.S.; An, G. Sucrose signaling in higher plants. Plant Sci. 2021, 302, 110703. [Google Scholar] [CrossRef]
  3. Bergareche, D.; Royo, J.; Muñiz, L.M.; Hueros, G. Cell wall invertase activity regulates the expression of the transfer cell-specific transcription factor ZmMRP-1. Planta 2018, 247, 429–442. [Google Scholar] [CrossRef]
  4. Walker, R.P.; Bonghi, C.; Varotto, S.; Battistelli, A.; Burbidge, C.A.; Castellarin, S.D.; Chen, Z.H.; Darriet, P.; Moscatello, S.; Rienth, M.; et al. Sucrose metabolism and transport in grapevines, with emphasis on berries and leaves, and insights gained from a cross-species comparison. Int. J. Mol. Sci. 2021, 22, 7794. [Google Scholar] [CrossRef] [PubMed]
  5. Li, M.; Li, H.; Zhu, Q.; Liu, D.; Li, Z.; Chen, H.; Luo, J.; Gong, P.; Ismail, A.M.; Zhang, Z. Knockout of the sugar transporter OsSTP15 enhances grain yield by improving tiller number due to increased sugar content in the shoot base of rice (Oryza sativa L.). New Phytol. 2024, 241, 1250–1265. [Google Scholar] [CrossRef] [PubMed]
  6. Su, J.; Zhang, C.X.; Zhu, L.C.; Yang, N.X.; Yang, J.J.; Ma, B.Q.; Ma, F.W.; Li, M.J. MdFRK2-mediated sugar metabolism accelerates cellulose accumulation in apple and poplar. Biotechnol. Biofuels 2021, 14, 137. [Google Scholar] [CrossRef] [PubMed]
  7. Sturm, A.; Tang, G.Q. The sucrose-cleaving enzymes of plants are crucial for development, growth and carbon partitioning. Trends Plant Sci. 1999, 4, 401–407. [Google Scholar] [CrossRef] [PubMed]
  8. Schmolzer, K.; Gutmann, A.; Diricks, M.; Desmet, T.; Nidetzky, B. Sucrose synthase: A unique glycosyltransferase for biocatalytic glycosylation process development. Biotechnol. Adv. 2016, 34, 88–111. [Google Scholar] [CrossRef]
  9. Ruan, Y.-L.; Jin, Y.; Yang, Y.-J.; Li, G.-J.; Boyer, J.S. Sugar input, metabolism, and signaling mediated by invertase: Roles in development, yield potential, and response to drought and heat. Mol. Plant 2010, 3, 942–955. [Google Scholar] [CrossRef]
  10. Liu, Y.H.; Song, Y.H.; Ruan, Y.L. Sugar conundrum in plant-pathogen interactions: Roles of invertase and sugar transporters depend on pathosystems. J. Exp. Bot. 2022, 73, 1910–1925. [Google Scholar] [CrossRef]
  11. Tauzin, A.S.; Giardina, T. Sucrose and invertases, a part of the plant defense response to the biotic stresses. Front. Plant Sci. 2014, 5, 293. [Google Scholar] [CrossRef] [PubMed]
  12. Qian, W.; Yue, C.; Wang, Y.; Cao, H.; Li, N.; Wang, L.; Hao, X.; Wang, X.; Xiao, B.; Yang, Y. Identification of the invertase gene family (INVs) in tea plant and their expression analysis under abiotic stress. Plant Cell Rep. 2016, 35, 2269–2283. [Google Scholar] [CrossRef] [PubMed]
  13. Coculo, D.; Lionetti, V. The plant invertase/pectin methylesterase inhibitor superfamily. Front. Plant Sci. 2022, 13, 863892. [Google Scholar] [CrossRef] [PubMed]
  14. Chen, Z.; Gao, K.; Su, X.; Rao, P.; An, X. Genome-wide identification of the invertase gene family in populus. PLoS ONE 2015, 10, e0138540. [Google Scholar] [CrossRef] [PubMed]
  15. Abbas, A.; Shah, A.N.; Shah, A.A.; Nadeem, M.A.; Alsaleh, A.; Javed, T.; Alotaibi, S.S.; Abdelsalam, N.R. genome-wide analysis of invertase gene family, and expression profiling under abiotic stress conditions in potato. Biology 2022, 11, 539. [Google Scholar] [CrossRef] [PubMed]
  16. Juárez-Colunga, S.; López-González, C.; Morales-Elías, N.C.; Massange-Sánchez, J.A.; Trachsel, S.; Tiessen, A. Genome-wide analysis of the invertase gene family from maize. Plant Mol. Biol. 2018, 97, 385–406. [Google Scholar] [CrossRef] [PubMed]
  17. Cheng, L.; Jin, J.; He, X.; Luo, Z.; Wang, Z.; Yang, J.; Xu, X. Genome-wide identification and analysis of the invertase gene family in tobacco (Nicotiana tabacum) reveals NtNINV10 participating the sugar metabolism. Front. Plant Sci. 2023, 14, 1164296. [Google Scholar] [CrossRef]
  18. Wan, H.; Zhang, Y.; Wu, L.; Zhou, G.; Pan, L.; Fernie, A.R.; Ruan, Y.L. Evolution of cytosolic and organellar invertases empowered the colonization and thriving of land plants. Plant Physiol. 2023, 193, 1227–1243. [Google Scholar] [CrossRef] [PubMed]
  19. Huang, W.; Li, Y.; Du, Y.; Pan, L.; Huang, Y.; Liu, H.; Zhao, Y.; Shi, Y.; Ruan, Y.L.; Dong, Z.; et al. Maize cytosolic invertase INVAN6 ensures faithful meiotic progression under heat stress. New Phytol. 2022, 236, 2172–2188. [Google Scholar] [CrossRef]
  20. Coluccio Leskow, C.; Conte, M.; Del Pozo, T.; Bermúdez, L.; Lira, B.S.; Gramegna, G.; Baroli, I.; Burgos, E.; Zavallo, D.; Kamenetzky, L.; et al. The cytosolic invertase NI6 affects vegetative growth, flowering, fruit set, and yield in tomato. J. Exp. Bot. 2021, 72, 2525–2543. [Google Scholar] [CrossRef]
  21. Ansary, J.; Forbes-Hernández, T.Y.; Gil, E.; Cianciosi, D.; Zhang, J.; Elexpuru-Zabaleta, M.; Simal-Gandara, J.; Giampieri, F.; Battino, M. Potential health benefit of garlic based on human intervention studies: A brief overview. Antioxidants 2020, 9, 619. [Google Scholar] [CrossRef] [PubMed]
  22. Wang, M.; Wu, C.; Cheng, Z.; Meng, H. Growth and physiological changes in continuously cropped eggplant (Solanum melongena L.) upon relay intercropping with garlic (Allium sativum L.). Front. Plant Sci. 2015, 6, 262. [Google Scholar] [CrossRef] [PubMed]
  23. Shemesh, E.; Scholten, O.; Rabinowitch, H.D.; Kamenetsky, R. Unlocking variability: Inherent variation and developmental traits of garlic plants originated from sexual reproduction. Planta 2008, 227, 1013–1024. [Google Scholar] [CrossRef] [PubMed]
  24. Egea, L.A.; Mérida-García, R.; Kilian, A.; Hernandez, P.; Dorado, G. Assessment of genetic diversity and structure of large garlic (Allium sativum L.) germplasm bank, by diversity arrays technology “Genotyping-by-Sequencing” platform (DArTseq). Front. Genet. 2017, 8, 98. [Google Scholar] [CrossRef] [PubMed]
  25. Casals, J.; Rivera, A.; Campo, S.; Aymerich, E.; Isern, H.; Fenero, D.; Garriga, A.; Palou, A.; Monfort, A.; Howad, W.; et al. Phenotypic diversity and distinctiveness of the Belltall garlic landrace. Front. Plant Sci. 2023, 13, 1004069. [Google Scholar] [CrossRef] [PubMed]
  26. Bian, H.; Zhou, Q.; Du, Z.; Zhang, G.; Han, R.; Chen, L.; Tian, J.; Li, Y. Integrated transcriptomics and metabolomics analysis of the fructan metabolism response to low-temperature stress in garlic. Genes 2023, 14, 1290. [Google Scholar] [CrossRef] [PubMed]
  27. Wang, G.-L.; Ren, X.-Q.; Liu, J.-X.; Yang, F.; Wang, Y.-P.; Xiong, A.-S. Transcript profiling reveals an important role of cell wall remodeling and hormone signaling under salt stress in garlic. Plant Physiol. Biochem. 2019, 135, 87–98. [Google Scholar] [CrossRef] [PubMed]
  28. Kong, Q.; Mostafa, H.H.A.; Yang, W.; Wang, J.; Nuerawuti, M.; Wang, Y.; Song, J.; Zhang, X.; Ma, L.; Wang, H.; et al. Comparative transcriptome profiling reveals that brassinosteroid-mediated lignification plays an important role in garlic adaption to salt stress. Plant Physiol. Biochem. 2021, 158, 34–42. [Google Scholar] [CrossRef] [PubMed]
  29. Zhou, Q.; Sun, H.; Zhang, G.; Wang, J.; Tian, J. Gene co-expression analysis reveals the transcriptome changes and hub genes of fructan metabolism in garlic under drought stress. Plants 2023, 12, 3357. [Google Scholar] [CrossRef]
  30. Valluru, R.; Ende, W. Plant fructans in stress environments: Emerging concepts and future prospects. J. Exp. Bot. 2008, 59, 2905–2916. [Google Scholar] [CrossRef]
  31. Van den Ende, W. Multifunctional fructans and raffinose family oligosaccharides. Front. Plant Sci. 2013, 4, 247. [Google Scholar] [PubMed]
  32. Van den Ende, W. Different evolutionary pathways to generate plant fructan exohydrolases. J. Exp. Bot. 2022, 73, 4620–4623. [Google Scholar] [CrossRef] [PubMed]
  33. Le Roy, K.; Lammens, W.; Verhaest, M.; De Coninck, B.; Rabijns, A.; Van Laere, A.; Van den Ende, W. Unraveling the difference between invertases and fructan exohydrolases: A single amino acid (Asp-239) substitution transforms Arabidopsis cell wall invertase1 into a fructan 1-exohydrolase. Plant Physiol. 2007, 145, 616–625. [Google Scholar] [CrossRef]
  34. Sun, X.; Zhu, S.; Li, N.; Cheng, Y.; Zhao, J.; Qiao, X.; Lu, L.; Liu, S.; Wang, Y.; Liu, C.; et al. A Chromosome-level genome assembly of garlic (Allium sativum) provides insights into genome evolution and allicin biosynthesis. Mol. Plant 2020, 13, 1328–1339. [Google Scholar] [CrossRef]
  35. Anisimova, O.K.; Shchennikova, A.V.; Kochieva, E.Z.; Filyushin, M.A. Pathogenesis-related genes of PR1, PR2, PR4, and PR5 families are involved in the response to Fusarium infection in garlic (Allium sativum L.). Int. J. Mol. Sci. 2021, 22, 6688. [Google Scholar] [CrossRef]
  36. Anisimova, O.K.; Kochieva, E.Z.; Shchennikova, A.V.; Filyushin, M.A. Thaumatin-like protein (TLP) genes in garlic (Allium sativum L.): Genome-wide identification, characterization, and expression in response to Fusarium proliferatum infection. Plants 2022, 11, 748. [Google Scholar] [CrossRef]
  37. Filyushin, M.A.; Anisimova, O.K.; Kochieva, E.Z.; Shchennikova, A.V. Genome-wide identification and expression of chitinase class i genes in garlic (Allium sativum L.) cultivars resistant and susceptible to Fusarium proliferatum. Plants 2021, 10, 720. [Google Scholar] [CrossRef] [PubMed]
  38. Filyushin, M.A.; Anisimova, O.K.; Shchennikova, A.V.; Kochieva, E.Z. Genome-wide identification, expression, and response to Fusarium infection of the SWEET gene family in garlic (Allium sativum L.). Int. J. Mol. Sci. 2023, 24, 7533. [Google Scholar] [CrossRef]
  39. Kumar, S.; Stecher, G.; Tamura, K. MEGA7: Molecular evolutionary genetics analysis version 7.0. Mol. Biol. Evol. 2016, 33, 1870–1874. [Google Scholar] [CrossRef]
  40. Hu, B.; Jin, J.; Guo, A.Y.; Zhang, H.; Luo, J.; Gao, G. GSDS 2.0: An Upgraded Gene Feature Visualization Server. Bioinformatics 2015, 31, 1296–1297. [Google Scholar] [CrossRef]
  41. Babicki, S.; Arndt, D.; Marcu, A.; Liang, Y.; Grant, J.R.; Maciejewski, A.; Wishart, D.S. Heatmapper: Web-enabled heat mapping for all. Nucl. Acids Res. 2016, 44, W147–W153. [Google Scholar] [CrossRef] [PubMed]
  42. Chen, M.; Wang, Q.; Li, Y.; Gao, L.; Lv, F.; Yang, R.; Wang, P. Candidate reference genes for quantitative gene expression analysis in Lagerstroemia indica. Mol. Biol. Rep. 2021, 48, 1677–1685. [Google Scholar] [CrossRef]
  43. Sturm, A. Invertases. Primary structures, functions, and roles in plant development and sucrose partitioning. Plant Physiol. 1999, 121, 1–8. [Google Scholar] [CrossRef]
  44. Horton, P.; Park, K.J.; Obayashi, T.; Fujita, N.; Harada, H.; Adams-Collier, C.J.; Nakai, K. WoLF PSORT: Protein localization predictor. Nucleic Acids Res. 2007, 35, W585–W587. [Google Scholar] [CrossRef]
  45. Waadt, R.; Seller, C.A.; Hsu, P.K.; Takahashi, Y.; Munemasa, S.; Schroeder, J.I. Plant hormone regulation of abiotic stress responses. Nat. Rev. Mol. Cell Biol. 2022, 23, 680–694. [Google Scholar] [CrossRef] [PubMed]
  46. Baillo, E.H.; Kimotho, R.N.; Zhang, Z.; Xu, P. Transcription factors associated with abiotic and biotic stress tolerance and their potential for crops improvement. Genes 2019, 10, 771. [Google Scholar] [CrossRef] [PubMed]
  47. Ouwerkerk, P.B.; Trimborn, T.O.; Hilliou, F.; Memelink, J. Nuclear factors GT-1 and 3AF1 interact with multiple sequences within the promoter of the Tdc gene from Madagascar periwinkle: GT-1 is involved in UV light-induced expression. Mol. Gen. Genet. 1999, 261, 610–622. [Google Scholar] [CrossRef] [PubMed]
  48. Wang, C.; Wang, G.; Wen, X.; Qu, X.; Zhang, Y.; Zhang, X.; Deng, P.; Chen, C.; Ji, W.; Zhang, H. Characteristics and expression analysis of invertase gene family in common wheat (Triticum aestivum L.). Genes 2022, 14, 41. [Google Scholar] [CrossRef]
  49. Saddhe, A.A.; Manuka, R.; Penna, S. Plant sugars: Homeostasis and transport under abiotic stress in plants. Physiol. Plant. 2021, 171, 739–755. [Google Scholar] [CrossRef]
  50. Peng, Y.; Zhu, L.; Tian, R.; Wang, L.; Su, J.; Yuan, Y.; Ma, F.; Li, M.; Ma, B. Genome-wide identification, characterization and evolutionary dynamic of invertase gene family in apple, and revealing its roles in cold tolerance. Int. J. Biol. Macromol. 2023, 229, 766–777. [Google Scholar] [CrossRef]
Horticulturae 10 00581 g001
Figure 1. Chromosomal localization and exon–intron structure of the A. sativum invertase genes. (a) Location of the AsN/AINV (black), AsCWINV (blue), and AsVINV (red) genes. Chromosome (chr) size (Mb, megabase) according to the A. sativum cv. Ershuizao genome [34] is indicated by the scale on the left. (b,c) Exon–intron structure of the cv. Ershuizao (b) and cv. Sarmat (c) invertase genes; (c) gene structures corrected according to our data are shown.
Figure 1. Chromosomal localization and exon–intron structure of the A. sativum invertase genes. (a) Location of the AsN/AINV (black), AsCWINV (blue), and AsVINV (red) genes. Chromosome (chr) size (Mb, megabase) according to the A. sativum cv. Ershuizao genome [34] is indicated by the scale on the left. (b,c) Exon–intron structure of the cv. Ershuizao (b) and cv. Sarmat (c) invertase genes; (c) gene structures corrected according to our data are shown.
Horticulturae 10 00581 g001
Horticulturae 10 00581 g002
Figure 2. Evolutionary relationships between A. sativum (red), Z. mays (green), and A. thaliana (black) invertases. NCBI IDs and the corresponding protein sequences are provided in Supplementary Table S5. The unrooted dendrogram was constructed in MEGA 7.0.26 using the Neighbor-Joining method, JTT model (bootstrap with 1000 replicates).
Figure 2. Evolutionary relationships between A. sativum (red), Z. mays (green), and A. thaliana (black) invertases. NCBI IDs and the corresponding protein sequences are provided in Supplementary Table S5. The unrooted dendrogram was constructed in MEGA 7.0.26 using the Neighbor-Joining method, JTT model (bootstrap with 1000 replicates).
Horticulturae 10 00581 g002
Horticulturae 10 00581 g003
Figure 3. Phylogenetic relationships of garlic invertases (a) and motif distribution in AsN/AINV (b) and AsVINV/CWINV (c) putative proteins. The dendrogram was constructed in MEGA 7.0.26 using the Neighbor-Joining method, JTT model (bootstrap with 1000 replicates). Motif consensuses were detected using MEME 5.5.5. The p-value (<0.05) is the combined value based on the individual p-values (in a range 1.0 × 10−401–5.6 × 10−12) for each motif found.
Figure 3. Phylogenetic relationships of garlic invertases (a) and motif distribution in AsN/AINV (b) and AsVINV/CWINV (c) putative proteins. The dendrogram was constructed in MEGA 7.0.26 using the Neighbor-Joining method, JTT model (bootstrap with 1000 replicates). Motif consensuses were detected using MEME 5.5.5. The p-value (<0.05) is the combined value based on the individual p-values (in a range 1.0 × 10−401–5.6 × 10−12) for each motif found.
Horticulturae 10 00581 g003
Horticulturae 10 00581 g004
Figure 4. Cis-regulatory elements found in the A. sativum invertase gene promoters (~1000 bp). Analysis was performed using PlantCARE. Color intensity (pale to dark) corresponds to the number of cis-elements (low to high). Details about the associations of cis-elements are provided in Supplementary Table S6. Briefly, factors and the associated elements (in brackets) were ABA (ABRE, CARE), auxin (AuxRR-core, TGA-element), JA (CGTCA-motif, TCA-element), gibberellin (P-box, GARE-element), ethylene (ERE), anaerobic stress (ARE), drought (DRE1/DRE core), cold (LTR), heat, low pH, nutrient starvation (STRE), any stress (TC-rich repeats), wounding and pathogens (W-box, Wun-motif, WRE3, box S, AAGAA-motif), nitrogen (O2-site, GCN4-motif), meristem-specific (CCGTTC-motif) and endosperm-specific (O2-site, GCN4-motif) gene expression, regulation of cell-cycle (MSA-like) and circadian rhythm (circadian), binding to WRKY (W-box, Wun-motif, box S, WRE3), HD-Zip (HD-Zip 1), MYB (MYB/MRE/MBS1), bZIP (A-box) TFs and plant nuclear factor GT-1 (box II, box III); unknown (CTAG-motif, CAT-box, TCA).
Figure 4. Cis-regulatory elements found in the A. sativum invertase gene promoters (~1000 bp). Analysis was performed using PlantCARE. Color intensity (pale to dark) corresponds to the number of cis-elements (low to high). Details about the associations of cis-elements are provided in Supplementary Table S6. Briefly, factors and the associated elements (in brackets) were ABA (ABRE, CARE), auxin (AuxRR-core, TGA-element), JA (CGTCA-motif, TCA-element), gibberellin (P-box, GARE-element), ethylene (ERE), anaerobic stress (ARE), drought (DRE1/DRE core), cold (LTR), heat, low pH, nutrient starvation (STRE), any stress (TC-rich repeats), wounding and pathogens (W-box, Wun-motif, WRE3, box S, AAGAA-motif), nitrogen (O2-site, GCN4-motif), meristem-specific (CCGTTC-motif) and endosperm-specific (O2-site, GCN4-motif) gene expression, regulation of cell-cycle (MSA-like) and circadian rhythm (circadian), binding to WRKY (W-box, Wun-motif, box S, WRE3), HD-Zip (HD-Zip 1), MYB (MYB/MRE/MBS1), bZIP (A-box) TFs and plant nuclear factor GT-1 (box II, box III); unknown (CTAG-motif, CAT-box, TCA).
Horticulturae 10 00581 g004
Horticulturae 10 00581 g005
Figure 5. Heatmap of invertase gene mRNA levels in A. sativum cv. Ershuizao (PRJNA607255). Roots, bulbs 1–8 (192-, 197-, 202-, 207-, 212-, 217-, 222-, and 227-day-old, respectively), leaves, pseudostems (p. stems), buds, flowers, and sprouts were analyzed. Numbers in the heatmap indicate FPKM values rounded to the second decimal place (all unrounded values are available in Supplementary Table S7).
Figure 5. Heatmap of invertase gene mRNA levels in A. sativum cv. Ershuizao (PRJNA607255). Roots, bulbs 1–8 (192-, 197-, 202-, 207-, 212-, 217-, 222-, and 227-day-old, respectively), leaves, pseudostems (p. stems), buds, flowers, and sprouts were analyzed. Numbers in the heatmap indicate FPKM values rounded to the second decimal place (all unrounded values are available in Supplementary Table S7).
Horticulturae 10 00581 g005
Horticulturae 10 00581 g006
Figure 6. Heatmap of time-dependent invertase gene expression in response to abiotic stresses and phytohormones. A. sativum cv. Sarmat seedlings were exposed to the indicated factors for 2, 4, 6, and 24 h and then returned to normal conditions for 24 h (24 h R). The number in the box is the ratio of the experimental and control qRT-PCR values, obtained by dividing the value for the stressed plant by the value for the unstressed plant. The number shows how many times the level of gene expression in a stressed plant is lower (<1) or higher (>1) than in a control (non-stressed plant) at each specific time point. The color gradient from blue to red indicates changes in the expression levels from decrease to increase, respectively, relative to control.
Figure 6. Heatmap of time-dependent invertase gene expression in response to abiotic stresses and phytohormones. A. sativum cv. Sarmat seedlings were exposed to the indicated factors for 2, 4, 6, and 24 h and then returned to normal conditions for 24 h (24 h R). The number in the box is the ratio of the experimental and control qRT-PCR values, obtained by dividing the value for the stressed plant by the value for the unstressed plant. The number shows how many times the level of gene expression in a stressed plant is lower (<1) or higher (>1) than in a control (non-stressed plant) at each specific time point. The color gradient from blue to red indicates changes in the expression levels from decrease to increase, respectively, relative to control.
Horticulturae 10 00581 g006
Horticulturae 10 00581 g007
Figure 7. Changes in the soluble sugar content in garlic cv. Sarmat roots and shoots in response to stress (salinity, drought, and cold) and phytohormones (ABA and MeJA). The treatment was performed as described in the legend for Figure 6. The number in the box is the ratio of the experimental and control values, obtained by dividing the value for the stressed plant by the value for the unstressed plant. The number shows how many times the sugar concentration in the tissue of a stressed plant is lower (<1) or higher (>1) than in the control (non-stressed plant) at each specific time point. The color gradient from blue to red indicates changes in the sugar content from decrease to increase, respectively, relative to control.
Figure 7. Changes in the soluble sugar content in garlic cv. Sarmat roots and shoots in response to stress (salinity, drought, and cold) and phytohormones (ABA and MeJA). The treatment was performed as described in the legend for Figure 6. The number in the box is the ratio of the experimental and control values, obtained by dividing the value for the stressed plant by the value for the unstressed plant. The number shows how many times the sugar concentration in the tissue of a stressed plant is lower (<1) or higher (>1) than in the control (non-stressed plant) at each specific time point. The color gradient from blue to red indicates changes in the sugar content from decrease to increase, respectively, relative to control.
Horticulturae 10 00581 g007
Horticulturae 10 00581 g008
Figure 8. Correlation between soluble sugar content and invertase gene expression in the roots (a) and shoots (b) after exposure to abiotic stresses (NaCl, drought, and cold) and phytohormones (ABA, MeJA). The number in the box is the value of the Pearson’s coefficient, which represents the linear correlation between two sets of data (sugar content and invertase gene expression level) for a stressed plant. A Pearson’s coefficient >0.5 represents a positive correlation, <−0.5 a negative correlation, and a range of −0.5–0.5 indicates no correlation.
Figure 8. Correlation between soluble sugar content and invertase gene expression in the roots (a) and shoots (b) after exposure to abiotic stresses (NaCl, drought, and cold) and phytohormones (ABA, MeJA). The number in the box is the value of the Pearson’s coefficient, which represents the linear correlation between two sets of data (sugar content and invertase gene expression level) for a stressed plant. A Pearson’s coefficient >0.5 represents a positive correlation, <−0.5 a negative correlation, and a range of −0.5–0.5 indicates no correlation.
Horticulturae 10 00581 g008
Table 1. Characteristics of the A. sativum cv. Ershuizao invertase genes.
Table 1. Characteristics of the A. sativum cv. Ershuizao invertase genes.
GeneGene ID/Transcript ID [34]Genomic LocalizationGene, bpCDS, bpProtein, aaMW, kDapIGRAVY
AsN/AINV1Asa1G00182.1/Asa7G01205.1ch1: 40208894-402142125319177659166.785.88−0.313
AsN/AINV2Asa1G00196.1/Asa7G01204.1ch1: 45988527-459918123286120340045.555.53−0.303
AsN/AINV3Asa1G02231.1/Asa2G02607.1ch1: 597271753-5972772445492165955262.966.11−0.188
AsN/AINV4Asa1G02550.1/Asa2G02247.1ch1: 692918625-6929209872363167155662.746.32−0.147
AsN/AINV5Asa1G03777.1/Asa2G00901.1ch1: 1030642218-10306475645347173757866.016.39−0.277
AsN/AINV6Asa1G03784.1/Asa2G00903.1ch1: 1031491320-10314966815362173757866.016.39−0.277
AsN/AINV7Asa3G00854.1/Asa8G04269.1ch3: 235042209-2350453723164135345050.996.11−0.212
AsN/AINV8Asa5G02977.1/Asa6G02773.1ch5: 760809575-76082116211,588186662169.836.61−0.286
AsN/AINV9Asa5G03124.1/Asa3G04501.1ch5: 803147316-8031536026287168356063.466.51−0.189
AsN/AINV10Asa7G05846.1/Asa5G05408.1ch7: 1623050841-16230548714031120340045.815.76−0.285
AsN/AINV11Asa7G06162.1/Asa5G05675.1ch7: 1691491430-16914947673338178259367.398.73−0.378
AsCWINV1Asa1G04355.1/Asa2G00250.1ch1: 1178706763-11787090212259160853560.555.86−0.321
AsCWINV2Asa5G03190.1/Asa6G03410.1ch5: 820997521-8210013543834170756864.437.72−0.407
AsCWINV3Asa6G01167.1/Asa6G07032.1ch6: 308416872-3084219145043164154662.425.72−0.315
AsCWINV4Asa6G07063.1/Asa1G04317.1ch6: 1957444508-19574465352028153951258.278.48−0.505
AsCWINV5Asa8G04697.1/Asa7G04854.1ch8: 1251531812-12515378886077156952258.965.86−0.319
AsCWINV6Asa8G04714.1/Asa7G04858.1ch8: 1255046760-12550518545095183661169.346.35−0.391
AsVINV1Asa1G00540.1/Asa0G04097.1ch1: 133485285-1334871331849175558464.874.9−0.279
AsVINV2Asa2G02355.1/Asa3G02390.1ch2: 650863353-6508661042752221773881.185.16−0.253
AsVINV3Asa3G03921.1/Asa5G01574.1ch3: 1070971636-10709756153980192063970.284.94−0.135
AsVINV4Asa5G00414.1/Asa6G00588.1ch5: 101522664-1015266453982188462769.044.93−0.137
AsVINV5Asa6G06910.1/Asa1G04114.1ch6: 1914547560-19145496032044195365071.535.00−0.221
AsVINV6Asa6G06912.1/Asa1G04116.1ch6: 1915034543-19150365922050195665172.44.98−0.197
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Anisimova, O.K.; Shchennikova, A.V.; Kochieva, E.Z.; Filyushin, M.A. Garlic (Allium sativum L.) Invertase Genes: Genome-Wide Identification and Expression in Response to Abiotic Stresses and Phytohormones. Horticulturae 2024, 10, 581. https://doi.org/10.3390/horticulturae10060581

AMA Style

Anisimova OK, Shchennikova AV, Kochieva EZ, Filyushin MA. Garlic (Allium sativum L.) Invertase Genes: Genome-Wide Identification and Expression in Response to Abiotic Stresses and Phytohormones. Horticulturae. 2024; 10(6):581. https://doi.org/10.3390/horticulturae10060581

Chicago/Turabian Style

Anisimova, Olga K., Anna V. Shchennikova, Elena Z. Kochieva, and Mikhail A. Filyushin. 2024. "Garlic (Allium sativum L.) Invertase Genes: Genome-Wide Identification and Expression in Response to Abiotic Stresses and Phytohormones" Horticulturae 10, no. 6: 581. https://doi.org/10.3390/horticulturae10060581

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop