Next Article in Journal
Biological Control Potential of Bacillus subtilis Isolate 1JN2 against Fusarium Wilt on Cucumber
Previous Article in Journal
Physiological Responses of Hollyhock (Alcea rosea L.) to Drought Stress
Previous Article in Special Issue
Potential Role of the Yeast Papiliotrema terrestris Strain PT22AV in the Management of the Root-Knot Nematode Meloidogyne incognita
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Horticulturae
Volume 10
Issue 8
10.3390/horticulturae10080842
horticulturae-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Identification of Laccase Genes in Athelia bombacina and Their Interactions with the Host

by
Xiaonan Sun
,
Weiwei Yan
,
Xinnan Zhang
,
Wenhui Wang
and
Xiaohui Jia
*
Institute of Pomology, Chinese Academy of Agricultural Sciences, Xingcheng 125100, China
*
Author to whom correspondence should be addressed.
Horticulturae 2024, 10(8), 842; https://doi.org/10.3390/horticulturae10080842
Submission received: 12 June 2024 / Revised: 5 August 2024 / Accepted: 6 August 2024 / Published: 9 August 2024
(This article belongs to the Special Issue Microbial Interaction with Horticulture Plant Growth and Development)
Browse Figures
Versions Notes

Abstract

:
Laccase (LAC), a copper-containing polyphenol oxidase, is an important pathogenic factor of pathogenic fungi, and has been identified as an important virulence factor in numerous pathogenic fungi. LAC is encoded by a gene family and belongs to the class of multicopper oxidases. The study aimed to identify the LAC genes in Athelia bombacina (Link) Pers, and their interactions with the host. The expression levels of the LAC genes were quantified using RT-qPCR. The LAC activity, level of malondialdehyde (MDA) and activities of protective enzymes in ‘Huangguan’ pears during the interaction were measured. The AbLac4 gene deletion mutant strain was constructed. Six LAC genes were identified in A. bombacina, distributed across three chromosomes. Interspecies collinearity analysis suggested that LAC genes could serve as crucial pathogenic factors in A. bombacina. The LAC gene family can be classified into three distinct subgroups. Among the subgroups, variations were observed in their characteristic sequences and conserved motifs. However, the LAC genes within the same subgroup exhibited a high degree of conservation. The genes showed diverse expression profiles, with their promoters harboring multiple stress-responsive elements. Signal peptide prediction showed that all LAC proteins, with the exception of the AbLac3 protein, possessed signal peptides, indicating that they are secretory proteins. The subcellular localization analysis showed that all LAC proteins may be localized extracellularly. RT-qPCR revealed differential expression patterns among LAC genes; specifically, AbLac1 and AbLac4 exhibited distinct expression dynamics during the infection process. The LAC activity first increased and then decreased, with the highest increase rate occurring in the early stage of culture. The MDA content and catalase (CAT) activity at the inoculated site were found to be significantly higher than the uninoculated control. In addition, the deletion of AbLac4 gene reduced the growth rate and pathogenic ability of A. bombacina. This investigation found that AbLac1 and AbLac4 may play pivotal roles in mediating host interactions, and the fruit may combat pathogen infection through increasing the activities of CAT, phenylalanine ammonia lyase and peroxidase. This study provides valuable new insights into the pathogenic mechanisms of A. bombacina, significantly contributing to the field.

1. Introduction

A. bombacina is a newly discovered and important post-harvest fruit pathogen that has been recently identified by our research team. It belongs to the Basidiomycota, Agaricomycetes, Agaricomycetidae, Atheliales and Athelia genus. A. bombacina was initially detected in ‘Huangguan’ pear fruits during storage [1], and subsequently also found in ‘Micui’ apples [2]. Studies have shown that A. bombacina can infect multiple fruits, such as strawberries, cherries, peaches, plums, apricots and jujube, besides pears [3,4]. Therefore, this disease poses a potential threat to the high-quality development of China’s fruit industry.
A. bombacina has strong laccase (LAC) production capacity. LAC is an important virulence factor in many pathogenic bacteria and is a multi-copper oxidase encoded by a gene family [5,6]. The virulence of LAC mainly manifests in its participation in various important biological processes, such as fungal morphogenesis [7,8], host–pathogen interaction [9,10,11], compound synthesis [12,13,14,15,16] and stress response [17,18]. However, to our knowledge, the identification of LAC family genes in A. bombacina, a novel pathogenic bacterium, and their dynamic changes in the interactions with the host have not been reported.
This study aimed to identify the members of the LAC gene family using bioinformatics methods, and analyze the dynamic changes of the genes during the interaction with the host and its expression at different infection stages. This study offers new ideas for mining key virulence factors of A. bombacina and analyzing its pathogenic mechanism, as well as providing a theoretical basis for disease prevention and control.

2. Materials and Methods

2.1. Strains and Pears

The A. bombacina was kept by the Post-harvest Disease Research Group, Fruit Research Institute, Chinese Academy of Agricultural Sciences. The ‘Huangguan’ pears, with uniform size and no mechanical damage, were purchased from a local fruit wholesale market in September 2023, and shipped to the laboratory for treatment on the same day.

2.2. Bioinformatics Analysis

2.2.1. Acquisition and Analysis Tool of the Target-Gene-Sequence Information

In the initial phase of our laboratory research, mononucleated mycelia were acquired through protoplast preparation. The mononucleated strain ABD-3 was utilized to compile and publish the high-quality genome of A. bombacina (NCBI accession number: PRJNA735055). The LAC family genes were discovered through analysis of the whole genome sequencing data, and the complete sequence, nucleotide sequence and CDS sequence of the target genes were extracted using TBtools software v2.019.

2.2.2. Collinearity Analysis

The chromosomal mapping information of LAC genes was derived from the whole-genome sequencing data and visually assessed through TBtools software v2.019. Intra-species collinearity analysis was conducted using the MCScanX plugin within the TBtools software v2.019. Inter-species collinearity analysis was performed utilizing the Simple Ka/Ks Calculator (NG) functional plugin.

2.2.3. Phylogenetic Analysis of the LAC Genes

The amino acid sequences of the LAC genes in A. bombacina were aligned using DNAMAN software 9.0. The phylogenetic tree was constructed using MEGA 7.0 software with a Bootstrap repetition number set at 1000, and visualized using Fig-Tree software v1.4.4.

2.2.4. The Amino Acid-Sequence Alignment of the LAC Proteins

The LAC protein sequences were aligned through Clustal X 2.0 to analyze the conserved sequences and characteristic copper ion binding sites of LAC proteins.

2.2.5. Analysis of the LAC Gene Structure

GSDS (Gene Structure Display Server) was used to map the gene intron and exon structure. MEME (http://meme-suite.org/tools/meme, accessed on 11 May 2023) was used for motif prediction.

2.2.6. Analysis of the Promoter-Based Cis-Element Composition

The sequence of the promoter region 2000 bp before the start codon ATG of the LAC gene was extracted by Sequence Extractor in TBtools, and the results were searched and analyzed in the Fungal Genome Data Bank (FGD) combined with the TRANSFAC website (http://www.gene-regulation.com, accessed on 11 May 2023), and finally visualized by Simple BioSequence Viewer software in TBtools v2.019.

2.2.7. Signal Peptide and Subcellular Localization

Signal peptide and subcellular localization were predicted for the protein sequences of AbLac1 and AbLac4 using SignalP 6.0 and Euk-mPLoc 2.0 servers.

2.3. Expression Analysis of LAC Genes during Fruit Infection of A. bombacina

Forty ‘Huangguan’ pear fruits of the same size, and with no mechanical injuries and insect pests were selected, disinfected with 70% alcohol, washed with sterile water, and then dried naturally for later use. Total RNA from 3 d to 11 d was extracted (TIANGEN, Beijing, China) and the extracted RNA was reverse transcribed into cDNA by reverse transcription kit (Accurate Biology, Beijing, China), with actin3 as an internal reference, and infection 0 d as a control for subsequent RT-qPCR analysis. The relative expression level of each gene was calculated by using the 2−ΔΔCt method [19]. Primer sequences are shown in Table 1. The activity of LAC was analyzed according to the kit instructions (Grace Biotechnology Co., Ltd., Nanjing, China). The spectrophotometric values of various enzymes were measured using a spectrometer at specific wavelengths, and the enzyme activity was calculated according to the formula in the instructions, with three repetitions for each treatment.

2.4. Determination of MDA Content and Protective Enzyme Activity

The determination of MDA content and the activities of catalase (CAT), phenylalanine ammonia lyase (PAL) and peroxidase (POD) were performed according to the kit instructions (Grace Biotechnology Co., Ltd., Nanjing, China). The spectrophotometric values of various enzymes were measured using an enzyme meter at specific wavelengths, and the enzyme activity was calculated according to the formula in the instructions, with three repetitions for each treatment.

2.5. Construction of AbLac4-Deficient Strain

The homologous recombination fragments upstream and downstream of the AbLac4 gene were connected to the pCHpH vector (Supplementary Figures S1–S3) to obtain a knockout vector for the Lac4 gene. They were introduced into wild-type strain protoplasts. Finally, single colonies that can grow on PDA plates containing hygromycin were picked out, and their DNA and RNA were extracted after being continuously cultured on hygromycin-resistant plates for three generations (Supplementary Figure S4). All primers used for constructing and verifying mutant strains are in Table 2.

2.6. Statistical Analysis

Results were expressed as mean ± standard deviations. Data obtained in this experiment were sorted by Excel 2010 and Origin 2018, processed and analyzed by one-way ANOVA, followed by Duncan test using SPSS 18.0 software (p < 0.05). Data were visualized by TBtools software.

3. Results

3.1. Intraspecific Collinearity and Interspecies Collinearity

Six LAC genes (gene IDs: EVM0009242, EVM0009399, EVM0004634, EVM0008740, EVM0007377 and EVM0006262) were identified in A. bombacina and designated as AbLac1 to AbLac6, respectively. Whole-genome analysis showed the presence of LAC genes on chromosomes 4, 8 and 11 (Figure 1), with AbLac1, AbLac2, AbLac4 and AbLac6 being specifically situated on chromosome 8. The comparative analysis of collinearity revealed that only AbLac1 and AbLac4 showed collinearity, suggesting their physical proximity on the chromosomes and potential functional similarities in their homologous sequences.
The comparative analysis of the LAC genes of A. bombacina with closely related fungi (Figure 2) found that A. bombacina showed a substantial level of homology with Athelia sp. scaffold and Phanerochaete chrysosporium. This observation suggested a common ancestry among these genes. However, no collinear pairs of the LAC genes were found between Athelia sp. scaffold and A. bombacina, indicating the potential specificity of the LAC genes in A. bombacina. In contrast, collinear pairs were identified between AbLac5 in A. bombacina and the LAC genes in P. chrysosporium, indicating their potential functional similarities.

3.2. Phylogenetic Tree Analysis of the LAC Proteins

The analysis conducted using MEGA 7 software to construct a phylogenetic tree based on the amino acid sequence of the LAC proteins in A. bombacina (Figure 3) showed that the LAC proteins can be categorized into three subgroups: AbLac1, AbLac2, AbLac4 and AbLac5 proteins belonged to the same subgroup, while AbLac3 and AbLac6 were individually located in a subgroup. The AbLac3 protein showed a close relationship with Stereum hirsutum and Hymenopellis radicata. In contrast, the AbLac6 protein was closely associated with Armillaria mellea (Vahl) P. Kumm, indicating their closest genetic relationships.

3.3. Amino Acid Sequence Alignment of LAC Proteins and Analysis of Their Characteristic Sequences

Pairwise alignment of the six LAC amino acid sequences in A. bombacina showed that their sequence homology ranged from 7.78% to 58.61%. AbLac1 and AbLac5 proteins showed the highest homology, while the other sequences exhibited lower levels of homology (Table 3). AbLac2, AbLac3, AbLac4 and AbLac6 proteins showed less than 50% similarity with other proteins. Typically, traditional LAC enzymes consist of conserved amino acid residue regions that bind copper ions (L1–L4). The lack of these regions may result in variations in enzyme catalysis. An analysis of the feature sequence alignment of the six LAC sequences in A. bombacina revealed that AbLac3 lacked crucial histidine and cysteine residues in L1–L4, making it an atypical LAC. In contrast, AbLac2 contained the usual 10 histidines, while the other LAC proteins lacked histidines that bind copper ions in T2 and T3, but showed conservation at other sites (Figure 4).

3.4. LAC Gene Structure and Conserved Motifs of Encoded Proteins

The sequence analysis results indicated that, with the exception of the full-length sequence of the AbLac2 gene at 7385 bp, the sequences of the remaining genes were all under 3 kb (Figure 5). Similar gene structures suggested that different genes may have similar functions. Gene structure analysis revealed variations in the number of exons and introns among the LAC genes of A. bombacina, with AbLac1 having the highest number of exons (20), and AbLac3 having the lowest (5). This result suggested that the LAC genes of A. bombacina exhibited structural diversity, potentially leading to functional differences. Conserved motif analysis found that AbLac3 protein contained one conserved motif (motif 2), AbLac6 protein contained two conserved motifs (motif 2 and motif 4), and AbLac1, AbLac2, AbLac4 and AbLac5 protein each contained 6 conserved motifs (Figure 6). While there was variation in the conserved motifs encoded by the LAC genes of A. bombacina, those within the same subgroup in the phylogenetic tree showed high conservation.

3.5. Composition of the Promoter Cis-Acting Element

Analysis of the promoter cis-acting elements showed that the LAC genes of A. bombacina had a variety of stress-responsive elements (Figure 7), including light-responsive, drought-responsive, low-temperature responsive, anaerobic response, and defense stress elements. AbLac1, AbLac2, AbLac3, AbLac4, AbLac5 and AbLac6 all exhibited abundant light-responsive elements. Moreover, AbLac4 possessed a relatively high number of anaerobic response elements (4). AbLac1, AbLac3 and AbLac5 had more drought-responsive elements (2, 3, and 3, respectively). These findings suggested that the promoter region of the LAC genes harbored diverse cis-acting elements that may play a crucial role in stress responses during pathogen–host interactions.

3.6. Prediction of Signal Peptides and Subcellular Localization

The results of the signal-peptide prediction indicated that all LAC proteins, with the exception of the AbLac3 protein, possessed signal peptides. These signal peptides were located after the 22nd, 20th, 25th, 22nd, and 18th amino acid residues, respectively (Figure 8). The high prediction reliability (0.99) suggested that these proteins may be primarily synthesized by ribosomes, undergo further processing in the endoplasmic reticulum, be transported to the Golgi apparatus via the vacuole, and ultimately exert their effects extracellularly through vacuolar transport. Furthermore, the subcellular localization prediction results indicated that the LAC proteins may be extracellularly localized and classified as secretory proteins (Table 4).

3.7. The LAC Gene-Expression Patterns

RT-qPCR was utilized to assess the relative expression levels of the LAC genes in ‘Huangguan’ pear fruits infected with A. bombacina at 3, 6, 9 and 11 days post infection compared to the uninfected control, with expression levels normalized to 1. The relative expression levels were normalized using Actin3 and then subjected to clustering analysis. Both AbLac1 and AbLac4 exhibited a consistently high expression level throughout the infection process, suggesting their synergistic involvement in the infection process (Figure 9). The qPCR results showed that at the early infection stage, besides AbLac1 and AbLac4 showing high expression, the remaining LAC genes exhibited low expression levels. At day 6 (middle infection period), the expression levels of AbLac1 and AbLac4 notably decreased from the early infection stage, whereas AbLac6 exhibited a significant increase, maintaining high expression levels. By day 9, the expression levels of AbLac1 and AbLac4 significantly increased once more, whereas AbLac6 decreased significantly and remained at low expression levels. By the 11th day of the late infection stage, all LAC genes exhibited low expression levels (Figure 10). Consequently, it is hypothesized that AbLac1 and AbLac4 may play pivotal roles, whereas AbLac6 may serve a complementary function during A. bombacina infection of its host.
In order to verify the expression patterns of LAC, an in vitro simulation experiment was conducted in A. bombacina, and the LAC activity monitored in its fermentation broth. The results showed that the LAC activity first increased and then decreased, with the highest increase rate occurring in the early stage of culture. The enzyme activity reached its peak on the 6th day (1707.86 nmol/min/L, Figure 11). This was consistent with the RT-qPCR results. On the 9th day of culture, the enzyme activity began to decrease, which was different from the RT-qPCR results. This may be due to a stress response by A. bombacina to further destroy host defense during the process of infecting ‘Huangguan’ pears.

3.8. Changes in MDA Content and Activities of Protective Enzymes in the Host

There were no significant changes in the MDA content of the uninoculated area across different stages. But, following inoculation with A. bombacina, the MDA content in the fruit continuously increased, significantly surpassing that of the uninoculated area during the same period (Figure 12). At the middle (9 d) and later stages (11 d) of the experiment, a minor decline was observed in the uninoculated area, while CAT activity significantly increased (p < 0.05). The PAL activity notably decreased at the early stage (5 d) of inoculation, followed by an increasing trend in the later stage, with the uninoculated area showing significantly higher activity than the inoculated area. At the early and middle stages of disease development, the POD activity in the inoculated area was lower than that in the uninoculated area, whereas at the later stage of inoculation, the POD activity in the inoculated area surpassed that in the uninoculated area.

3.9. AbLac4 Function Verification

The deletion of the AbLac4 gene slowed down the growth rate of A. bombacina and reduced its pathogenic ability. The wild-type (WT) colony showed a smooth and round shape, while the deletion of the AbLac4 gene resulted in irregular colony morphology (Figure 13A). Compared with WT as a control, the diameter of the colony was 8.12 cm and 3.34 cm after 7 days of culture, with a growth rate reduction of 58.87% (Figure 13B). In addition, when A. bombacina was inoculated into ‘Huangguan’ pear, the diameter of the disease spot was 1 cm and 0.27 cm on the 7th day, respectively. Compared with the control, the diameter of the disease spot of Lac4 was decreased by 73% (Figure 13C,D).

4. Discussion

This study focuses on the identification of six LAC genes in the entire genome of A. bombacina. Interspecies collinearity analysis revealed a high homology between the Athelia.sp scaffold fragment and the P. chrysosporium genome, but intraspecies collinearity was not observed. The LAC gene family in A. bombacina showed collinearity with the Athelia.sp scaffold fragment that is currently published, suggesting a lack of scholarly attention to LAC-related genes in the Athelia genus. P. chrysosporium is the most common wood-degrading fungus, and is considered the ancestral type of all wood-degrading basidiomycetes [20]. It has been reported that the infection by P. chrysosporium was facilitated through the disruption of lignin barriers by the LAC gene [21]. This study also identified interspecies collinearity between the LAC5 and P. chrysosporium, suggesting potential functional similarities between the two genes. This suggests that A. bombacina exhibits a certain level of pathogenicity and traceability. The LAC gene may play a role in its pathogenic process, aligning with previous research conducted in our laboratory. The findings also support A. bombacina’s significant LAC production capability. Currently, there are pertinent studies on the role of LAC genes in other fungi. The LAC produced by Colletotrichum gloeosporioides is involved in the enzymatic conversion of flavonoids and epicatechin, resulting in a reduced content of antifungal dienes and facilitating its pathogenic progression [22]. The gene BcLac2, which encodes the LAC of Botrytis cinerea, can induce enzymatic browning reactions during its infection of grapes, with the level of expression influencing the extent of discoloration [23]. LAC not only positively impacts the pathogen’s pathogenicity, but also contributes to diminishing the host’s resistance response [24,25]. Therefore, clarifying the biological functions and gene relationships of different LAC genes is crucial for understanding the role of LAC as a prerequisite for the pathogenic action of A. bombacina factors. However, there are currently no research reports showing the involvement of the LAC gene in the pathogenic process of A. bombacina. In the study, the results of sequence alignment, feature sequence analysis and phylogenetic tree analysis indicate that the LAC genes can be categorized into three subgroups. Distinct differences exist in motif types and characteristic sequences among LAC genes in A. bombacina. Specifically, AbLac3 cannot be classified as a typical LAC, due to the absence of essential histidine and cysteine residues, aligning with the identification outcomes of FGSG-03506 in Fusarium graminearum [26]. However, LAC genes within the same subgroup in the evolutionary tree show high conservation, suggesting functional similarities. These conserved sequences may be attributed to the adaptation mechanism exhibited by A. bombacina during its evolutionary process to cope with environmental changes. The promoter region of the LAC gene harbors various cis-acting elements, which could potentially play a crucial role in regulating hormone and stress responses in pathogen–host interactions. This aligns with the ability of fungi to catalyze the polymerization of phenolic substances by secreting abundant LAC, thereby mitigating oxidative stress induced by oxygen free radicals generated from these molecular reactions. The subcellular localization of proteins is intricately linked to their function. Proteins can only function effectively within specific subcellular compartments, making the study of protein localization crucial in disciplines like cell biology and proteomics. Currently, two primary research methodologies are employed for protein localization: constructing fluorescent protein assays and utilizing bioinformatics prediction. In the case of signal peptide proteins, fluorescent protein testing necessitates ongoing modifications to the target protein to ensure consistent expression in specific cellular environments. Nevertheless, a previous study has observed alterations in the subcellular localization of StSN2ΔSP protein following signal peptide deficiency [27]. Through the continuous enhancement of bioinformatics algorithms, bioinformatics tools, akin to fluorescent protein assays, can precisely determine the localization of target proteins. Hence, this study primarily employs bioinformatics techniques to predict the signal peptide and subcellular localization of LAC proteins. The findings elucidate the mechanisms through which AbLac1 and AbLac4 manifest their effects. Both proteins possess signal peptides, and the subcellular localization predictions place all LAC genes outside the cell, suggesting their classification as conventional secreted proteins that primarily function extracellularly.
The function of LAC is dependent on its source and protein specificity, with members of the gene family within the same species exhibiting diverse functions [28]. StLac2 plays a role in maintaining the integrity of the Setosphaeria turcica cell wall and melanin synthesis, as well as the development of attachment cells and conidia. The lack of the StLac2 gene results in reduced LAC activity and diminished pathogenicity [15]. The absence of the StLac4 gene may boost both intracellular and extracellular LAC activity in the bacterium [29]. The LAC gene LAC3 in Agaricus bisporus is linked to morphogenesis, while LAC2 is involved in toxin metabolism and defense [30]. In contrast, the transcription levels of LAC1 are not significantly correlated with resistance. No significant phenotypic differences were observed among the single-, double- and triple-gene deletions of Laca, Lacb and Lacc, which encode LAC in Talaromyces marneffei [31]. The knockout of Mgg-00551.5 and Mgg-02876.5 in the rice blast fungus did not significantly impact its growth and development, suggesting potential redundancy in the LAC gene’s function [32]. This study revealed that the expression levels of LAC2, LAC3 and LAC5 remained stable at the early and middle stages of infection. The expression of LAC6 significantly increased at the early stages of infection, but decreased notably as the infection progressed. Conversely, expression levels of both LAC1 and LAC4 significantly increased at both stages, with LAC1 exhibiting a more pronounced rise. This phenomenon could be attributed to the collinearity, similar protein structures, and identical endoplasmic reticulum localization of LAC1 and LAC4. These factors contribute to the functional synergy observed in the degradation of lignin and the damage to plant cell walls. When a certain LAC gene is lowly expressed, the expression level of another homologous gene will correspondingly increase to compensate for the damage caused to the strain. Therefore, it is speculated that when A. bombacina infects plant cells, the gene function of LAC1 may be more significant, followed by LAC4; after knocking out the differentially expressed LAC gene, other LAC genes may complement its function, something which requires further molecular biology experiments to verify.
As the main product of membrane lipid peroxidation [33], the high content of MDA indicated that Huangguan pear fruit suffered from greater damage by A. bombacina. CAT, PAL and POD have biological functions, such as antioxidant and stress resistance in plant [34]. Studies have shown that when fruit is under environmental stress, the defense system will be activated, showing increased activity of CAT, PAL and POD [35,36]. However, interestingly in this study, during the infection process of Huangguan pear fruit by A. bombacina, the PAL and POD activity in the uninoculated part was higher than that in the inoculated part. This may be a stress response by the fruit after being exposed to changes in the surrounding environment.

5. Conclusions

This is the first study to investigate the LAC family genes in A. bombacina using bioinformatics methods. This involves examining collinearity within and between species, constructing a phylogenetic tree, comparing characteristic amino acid sequences, analyzing gene structure, investigating promoter cis-acting elements, and predicting signal peptides and subcellular localization. LAC genes exhibited differential expression during the interaction between A. bombacina and its host, with AbLac1 and AbLac4 playing pivotal roles throughout the infection process, while AbLac6 served a complementary function. The laccase activity in the fermentation broth exhibited an initial increase, followed by a decrease. Interestingly, the elevated laccase activity in A. bombacina disrupted the pericarp tissue, compromised the permeability of fruit cell membranes, and elevated the MDA content in fruits. Moreover, fruits resist pathogen infection by boosting the activity of defense enzymes, CAT, PAL, and POD. The deletion of AbLac4 gene results in the reduction ingrowth rate and pathogenicity of A. bombacina.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/horticulturae10080842/s1, Figure S1. Amplification of the lower arm of AbLac4 gene (A), carrier enzyme cutting (B), connection of carrier and lower arm (C), and sequencing comparison results(D); Figure S2. Amplification of the upper arm of AbLac4 gene (A), carrier enzyme cutting (B), connection of carrier and upper arm (C), sequencing comparison result (D); Figure S3. Verify the construction result of AbLac4 gene knockout vector; Figure S4. DNA (A) and RNA (B) verification results. The high-quality genome of A. bombacina (NCBI accession number: PRJNA735055).

Author Contributions

Conceptualization, X.S. and X.J.; methodology, X.S., X.Z., W.Y. and X.J.; software, X.S., W.W. and W.Y.; validation, X.J. and W.W.; formal analysis, X.S. and X.Z.; investigation, X.S.; resources, X.J.; data curation, X.S.; writing—original draft preparation, X.S.; writing—review and editing, X.J. and W.W.; visualization, X.S.; supervision, X.J.; project administration, X.J.; funding acquisition, X.J. and W.W. All authors have read and agreed to the published version of the manuscript.

Funding

This paper has been supported by China’s Modern Agricultural Industrial Technology System Construction Special Project (CARS-29-19), the Science and Technology Innovation Project of Chinese Academy of Agricultural Sciences (CAS-ASTIP-RIP), Central Public welfare Research institutes (1610182022010), the General Project of Liaoning Provincial Natural Science Foundation (2021-MS-036) and Fundamental Research Funds for Central Non-profit Scientific Institution (1610182024007).

Data Availability Statement

Data are contained within the article.

Acknowledgments

The authors would like to acknowledge Xiaohui Jia of the Institute of Pomology, Chinese Academy of Agricultural Sciences, and Yang Bi of Food Science and Technology, Gansu Agricultural University, for their valuable advice.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Jia, X.H. The Etiology and Pathogenesis of Athelia bombacina Causing Postharvest Fruit Rot on Pear. Ph.D. Thesis, Shenyang Agriculture University, Shenyang, China, 2019. [Google Scholar]
  2. Hou, L.J.; Li, W.T.; Zou, J.Y.; Ma, R.; Li, Q.S.; Kebil, M. Isolation and identification of Athelia bombacina causing postharvest fruit rot of Honeycrisp apple in Xinjiang. J. Fruit Sci. 2022, 39, 1081–1088. [Google Scholar] [CrossRef]
  3. Jia, X.H.; Wang, W.H.; Fu, J.F.; Du, Y.M.; Wang, Y.; Zhou, R.J.; Liu, B.L. Biological characteristics and host range of Athelia bombacina causing postharvest fruit rot on pear. Acta Hortic. Sin. 2020, 47, 1253–1263. [Google Scholar] [CrossRef]
  4. Jia, X.H.; Zhang, X.N.; Du, Y.M.; Zhou, R.J.; Wang, W.H.; Fu, J.F. Preparation and pathogenicity evaluation of mononuclear hyphae of Athelia bombacina. J. Fruit Sci. 2021, 38, 1340–1348. [Google Scholar] [CrossRef]
  5. Thurston, C.F. The structure and function of fungal laccases. Microbiology 1994, 140, 19–26. [Google Scholar] [CrossRef]
  6. Xiao, C.L.; Zhong, C.K.; Zhang, M.T.; Yu, Z.R.; Dong, L.L.; Tan, Q.; Zhang, H.; Pu, J.J.; Liu, X.M. Effects of deletion of lac-case gene Cglac10 on the asexual reproduction and infection ability of Colletotrichum gloeosporioides. J. Fruit Sci. 2021, 38, 1066–1076. [Google Scholar] [CrossRef]
  7. Sakamoto, Y.; Nakade, K.; Sato, S.; Yoshimi, A.; Sasaki, K.; Konno, N.; Abe, K. Cell wall structure of secreted lac-case-silenced strain in Lentinula edodes. Fungal Biol. 2018, 122, 1192–1200. [Google Scholar] [CrossRef] [PubMed]
  8. Zhang, J.; Chen, H.; Chen, M.; Ren, A.; Huang, J.; Wang, H.; Zhao, M.; Feng, Z. Cloning and functional analysis of a laccase gene during fruiting body formation in Hypsizygus marmoreus. Microbiol. Res. 2015, 179, 54–63. [Google Scholar] [CrossRef] [PubMed]
  9. Surendran, A.; Siddiqui, Y.; Saud, H.M.; Ali, N.S.; Manickam, S. Inhibition and kinetic studies of lignin degrading enzymes of Ganoderma boninense by naturally occurring phenolic compounds. J. Appl. Microbiol. 2018, 125, 876–887. [Google Scholar] [CrossRef]
  10. Veloz, V.E.; Mali, T.; Mattila, H.K.; Lundell, T. Enzyme activity profiles produced on wood and straw by four fungi of different decay strategies. Microorganisms 2020, 8, 73. [Google Scholar] [CrossRef]
  11. Lv, Z.Y. Functional Analysis of Laccase Gene ShLAC1 in Scleromitrula shiraiana and Chitin Recognition Receptor in Mulberry. Ph.D. Thesis, Xinan University, Chongqing, China, 2019. [Google Scholar]
  12. Almeida, F.; Wolf, J.M.; Casadevall, A. Virulence-associated enzymes of Cryptococcus neoformans. Eukaryot. Cell 2015, 14, 1173–1185. [Google Scholar] [CrossRef]
  13. Lǚ, Z.; Kang, X.; Xiang, Z.; He, N. Laccase gene Sh-lac is involved in the growth and melanin biosynthesis of Scleromitrula shiraiana. Phytopathology 2017, 107, 353–361. [Google Scholar] [CrossRef] [PubMed]
  14. Dullah, S.; Hazarika, D.J.; Goswami, G.; Borgohain, T.; Ghosh, A.; Barooah, M.; Bhattacharyya, A.; Boro, R.C. Melanin production and laccase mediated oxidative stress alleviation during fungal-fungal interaction among basidiomycete fungi. IMA Fungus 2021, 12, 17–33. [Google Scholar] [CrossRef] [PubMed]
  15. Ma, S.; Cao, K.; Liu, N.; Meng, C.; Cao, Z.; Dai, D.; Jia, H.; Zang, J.; Li, Z.; Hao, Z.; et al. The StLAC2 gene is required for cell wall integrity, DHN-melanin synthesis and the pathogenicity of Setosphaeria turcica. Fungal Biol. 2017, 121, 589–601. [Google Scholar] [CrossRef] [PubMed]
  16. Guetsky, R.; Kobiler, I.; Wang, X.; Perlman, N.; Gollop, N.; Avila-Quezada, G.; Hadar, I.; Prusky, D. Metabolism of the flavonoid epicatechin by laccase of Colletotrichum gloeosporioides and its effect on pathogenicity on avocado fruits. Phytopathology 2005, 95, 1341–1348. [Google Scholar] [CrossRef] [PubMed]
  17. Courty, P.E.; Hoegger, P.J.; Kilaru, S.; Kohler, A.; Buée, M.; Garbaye, J.; Martin, F.; Kües, U. Phylogenetic analysis, genomic organization, and expression analysis of multi-copper oxidases in the ectomycorrhizal basidiomycete Lac-caria bicolor. New Phytol. 2009, 182, 736–750. [Google Scholar] [CrossRef] [PubMed]
  18. Janusz, G.; Pawlik, A.; Swiderska-Burek, U.; Polak, J.; Sulej, J.; Jarosz-Wilkolazka, A.; Paszczynski, A. Laccase properties, physiological functions, and evolution. Int. J. Mol. Sci. 2020, 21, 966. [Google Scholar] [CrossRef] [PubMed]
  19. Xu, X.; Chen, Y.; Li, B.; Tian, S. Histone H3K4 Methyltransferase PeSet1 regulates colonization, patulin biosynthe-sis, and stress responses of Penicillium expansum. Microbiol. Spectr. 2023, 11, 123–145. [Google Scholar] [CrossRef] [PubMed]
  20. Chen, L.X.; Zhang, H.Y. Recent research advances on the lignin biodegradation and applications. J. Cent. South For. Univ. 2003, 23, 79–85. [Google Scholar] [CrossRef]
  21. Lin, Y.Q.; Zhou, S.Q. Advances of investigation on the degradation of the lignin and cellulose by white rot fungi. Environ. Technol. 2003, 4, 32–36. [Google Scholar]
  22. Wei, Y.; Pu, J.; Zhang, H.; Liu, Y.; Zhou, F.; Zhang, K.; Liu, X. The laccase gene (LAC1) is essential for Colleto-trichum gloeosporioides development and virulence on mango leaves and fruits. Physiol. Mol. Plant Pathol. 2017, 99, 55–64. [Google Scholar] [CrossRef]
  23. Buddhika, U.; Savocchia, S.; Steel, C.C. Copper induces transcription of BcLCC2 laccase gene in phytopathogenic fungus, Botrytis cinerea. Mycology 2020, 12, 48–57. [Google Scholar] [CrossRef] [PubMed]
  24. Wang, Q.R.; Wu, J.X.; Zhang, R.Q.; Chi, Y.C.; Xu, M.L.; Xia, S.C.; Yan, H.H. Analysis of cell wall degrading enzymes secret-ed by Rhizoctonia solani and its pathogenicity. Plant Physiol. J. 2016, 52, 269–276. [Google Scholar] [CrossRef]
  25. Yang, C.H. Expression and Function Analysis of a laccase-1 Gene from Bemisia tabaci Cryptic Species Middle East-Asia Minor 1 (Hemiptera: Aleyrodidae) and Trialeurodes vaporariorum (Hemiptera: Aleyrodidae). Ph.D. Thesis, Xinan University, Chongqing, China, 2014. [Google Scholar]
  26. Liu, N.; Qu, Q.; Li, L.N.; Pang, Q.; Liu, J.H.; Zhang, Y.; Cao, Z.Y.; Dong, J.G. Identification of laccase-like multicopp Eroxi-dases in Fusarium graminearum and expression profiling during maize stalk infection. Acta Phytopathol. Sin. 2019, 49, 763–772. [Google Scholar] [CrossRef]
  27. Wen, H.; Cai, C.C.; Li, L.P.; Liu, S.F.; Liang, X.; Wang, Q.; Wang, X.Y. The impact of signal peptide deletion on the localization and protein-protein interaction of potato StSN2 protein. Genom. Appl. Biol. 2024, 11, 2096–4188. [Google Scholar] [CrossRef]
  28. Soni, N.; Hegde, N.; Dhariwal, A.; Kushalappa, A.C. Role of laccase gene in wheat NILs differing at QTL-Fhb1 for resistance against Fusarium head blight. Plant Sci. 2020, 298, 110–574. [Google Scholar] [CrossRef] [PubMed]
  29. Liu, N.; Cao, Z.; Cao, K.; Ma, S.; Gong, X.; Jia, H.; Dai, D.; Dong, J. Identification of laccase-like multicopper oxidases from the pathogenic fungus Setosphaeria turcica and their expression pattern during growth and infection. Eur. J. Plant Pathol. 2019, 153, 1149–1163. [Google Scholar] [CrossRef]
  30. Sjaarda, C.P.; Abubaker, K.S.; Castle, A.J. Induction of lcc2 expression and activity by Agaricus bisporus provides defence against Trichoderma aggressivum toxic extracts. Microb. Biotechnol. 2015, 8, 918–929. [Google Scholar] [CrossRef] [PubMed]
  31. Sapmak, A.; Kaewmalakul, J.; Nosanchuk, J.D.; Vanittanakom, N.; Andrianopoulos, A.; Pruksaphon, K.; Youngchim, S. Talaromyces marneffei laccase modifies THP-1 macrophage responses. Virulence 2016, 7, 702–717. [Google Scholar] [CrossRef] [PubMed]
  32. Chen, X. Function Analysis of Two Laccase Genes in Magnaporthe. Master’s Thesis, Fujian Agriculture and Forestry University, Fuzhou, China, 2008. [Google Scholar]
  33. Fang, D.L.; Yang, W.J.; Kimatu, B.M.; An, X.X.; Hu, Q.H. Effect of nanocomposite packaging on postharvest quality and reactive oxygen species metabolism of mushrooms (Flammulina velutipes). Postharvest Biol. Technol. 2016, 119, 49–57. [Google Scholar] [CrossRef]
  34. Guo, Z.G.; Wang, M.X.; Cui, L.; Han, B.Y. Research progress on the underlying mechanisms of plant defense enzymes in response to pest stress. Chin. J. Appl. Ecol. 2018, 29, 4248–4258. [Google Scholar] [CrossRef]
  35. Chen, Y.H.; Hung, Y.C.; Chen, M.Y.; Lin, M.S.; Lin, H.T. Enhanced storability of blueberries by acidic electrolyzed oxidizing water application may be mediated by regulating ROS metabolism. Food Chem. 2019, 270, 229–235. [Google Scholar] [CrossRef] [PubMed]
  36. Zipfel, C.; Robatzek, S.; Navarro, L.; Oakeley, E.J.; Jones, J.D.; Felix, G.; Boller, T. Bacterial disease resistance in Arabidopsis thorugh flgaelin perception. Nature 2004, 428, 764–767. [Google Scholar] [CrossRef] [PubMed]
Horticulturae 10 00842 g001
Figure 1. Collinearity analysis of the LAC gene in A. bombacina. Different color squares represent different chromosomes, and the red line indicates the presence of collinearity between LAC genes (similarly, hereinafter).
Figure 1. Collinearity analysis of the LAC gene in A. bombacina. Different color squares represent different chromosomes, and the red line indicates the presence of collinearity between LAC genes (similarly, hereinafter).
Horticulturae 10 00842 g001
Horticulturae 10 00842 g002
Figure 2. Collinearity analysis of LAC genes between A. bombacina and proximal fungal species.
Figure 2. Collinearity analysis of LAC genes between A. bombacina and proximal fungal species.
Horticulturae 10 00842 g002
Horticulturae 10 00842 g003
Figure 3. Phylogenetic analysis of LAC proteins in A. bombacina. Different colors represent different subgroups and * represents the LAC gene in A. bombacina.
Figure 3. Phylogenetic analysis of LAC proteins in A. bombacina. Different colors represent different subgroups and * represents the LAC gene in A. bombacina.
Horticulturae 10 00842 g003
Horticulturae 10 00842 g004
Figure 4. Alignment of LAC sequences of the copper-binding regions L1–L4.
Figure 4. Alignment of LAC sequences of the copper-binding regions L1–L4.
Horticulturae 10 00842 g004
Horticulturae 10 00842 g005
Figure 5. Genetic structure of LAC genes in A. bombacina.
Figure 5. Genetic structure of LAC genes in A. bombacina.
Horticulturae 10 00842 g005
Horticulturae 10 00842 g006
Figure 6. Analysis of LAC-protein conserved motif. Different color squares represent different motifs and the location of the motif.
Figure 6. Analysis of LAC-protein conserved motif. Different color squares represent different motifs and the location of the motif.
Horticulturae 10 00842 g006
Horticulturae 10 00842 g007
Figure 7. Analysis of cis-acting elements of LAC promoter regions in A. bombacina.
Figure 7. Analysis of cis-acting elements of LAC promoter regions in A. bombacina.
Horticulturae 10 00842 g007
Horticulturae 10 00842 g008
Figure 8. Prediction of LAC proteins signal peptides. From left to right and from top to bottom are the signal peptides of AbLac1–AbLac6 proteins.
Figure 8. Prediction of LAC proteins signal peptides. From left to right and from top to bottom are the signal peptides of AbLac1–AbLac6 proteins.
Horticulturae 10 00842 g008
Horticulturae 10 00842 g009
Figure 9. Analysis of cluster tree of LAC genes of A. bombacina at different infection stages.
Figure 9. Analysis of cluster tree of LAC genes of A. bombacina at different infection stages.
Horticulturae 10 00842 g009
Horticulturae 10 00842 g010
Figure 10. Analysis of the expression characteristics of LAC genes of A. bombacina at different infection stages. Note: the values are mean ± standard error, and the different letters above the bar represent significant differences (p < 0.05).
Figure 10. Analysis of the expression characteristics of LAC genes of A. bombacina at different infection stages. Note: the values are mean ± standard error, and the different letters above the bar represent significant differences (p < 0.05).
Horticulturae 10 00842 g010
Horticulturae 10 00842 g011
Figure 11. Changes in laccase activities in fermentation broth of A. bombacina.
Figure 11. Changes in laccase activities in fermentation broth of A. bombacina.
Horticulturae 10 00842 g011
Horticulturae 10 00842 g012
Figure 12. Changes in MDA content and activities of protective enzymes in fruits. Note: the values are mean ± standard error, and the different letters above the bar represent the significant differences (p < 0.05).
Figure 12. Changes in MDA content and activities of protective enzymes in fruits. Note: the values are mean ± standard error, and the different letters above the bar represent the significant differences (p < 0.05).
Horticulturae 10 00842 g012
Horticulturae 10 00842 g013
Figure 13. The effect of Lac4 gene deletion on colony morphology (A), colony diameter (B), morphology (C) and area of fruit disease (D). Note: the values are mean ± standard error, and the different letters above the bar represent significant differences (p < 0.05).
Figure 13. The effect of Lac4 gene deletion on colony morphology (A), colony diameter (B), morphology (C) and area of fruit disease (D). Note: the values are mean ± standard error, and the different letters above the bar represent significant differences (p < 0.05).
Horticulturae 10 00842 g013
Table 1. The primers used for real-time quantitative-expression-level analysis.
Table 1. The primers used for real-time quantitative-expression-level analysis.
GeneForward Primer (5′–3′)Reverse Primer (5′–3′)
AbLac1TCCGTTTCAATCCATCAAGTGGGTTCAACTCCTTCTG
AbLac2CGGAGATATGTTGGAGGATAGAACGAGTCACCAGGGA
AbLac3TCTCCAGGTCCTCTAATCCCTCTATGTCGGTGTTTT
AbLac4GCTGCTATTGGTCCTATTAAGTTATCTCCTTTGTTT
AbLac5TTGAGGTGGATGGTGTTAAAGGAGCGGTAGGCGTAT
AbLac6TCCATTGTCACATCTCTCGACCTGAATACTCCTCCG
Actin3TTCTCACTCCCCCACGCCTCACGGACAATTTCACGC
Table 2. The primers used for constructing and verifying mutant strains.
Table 2. The primers used for constructing and verifying mutant strains.
GenePrimers
KLLac4-up-FATGATTACGAATTCGAGCTCGGTACCAGCCCGTTCAGTCTTACA
KLLac4-up-RTCGACTCTAGAGGATCCCCGGGTACCGCAATAGGACCAATAGCAG
KLLac4-dn-FTTGCCTAACTCGGCGCGCCGAAGCTTCAGCACGGAATGTATCAG
KLLac4-dn-RGTAAAACGACGGCCAGTGCCAAGCTTTATCCAAAGTTGCCAGAA
KLLac4-FATGTTGCCCTCTGCGTCTCG
KLLac4-RATGTATCAGACTTGATCTAG
DLLac4-FATGATCCCAACGACCCTC
DLLac4-RTACCGAATAAGCCACGAC
Actin3-FTTCTCACTCCCCCACGCC
Actin3-FTCACGGACAATTTCACGC
Table 3. LAC protein sequence alignment.
Table 3. LAC protein sequence alignment.
IdentityAbLac1AbLac2AbLac3AbLac4AbLac5AbLac6
AbLac1100.00
AbLac243.32100.00
AbLac310.4510.59100.00
AbLac439.0140.0012.09100.00
AbLac558.6143.9010.5848.38100.00
AbLac610.8410.567.7810.5810.08100.00
Table 4. Prediction of subcellular localization of LAC proteins.
Table 4. Prediction of subcellular localization of LAC proteins.
ProteinPredicted Location
AbLac1Extracellular
AbLac2Extracellular
AbLac3Extracellular
AbLac4Extracellular
AbLac5Extracellular
AbLac6Extracellular
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Sun, X.; Yan, W.; Zhang, X.; Wang, W.; Jia, X. Identification of Laccase Genes in Athelia bombacina and Their Interactions with the Host. Horticulturae 2024, 10, 842. https://doi.org/10.3390/horticulturae10080842

AMA Style

Sun X, Yan W, Zhang X, Wang W, Jia X. Identification of Laccase Genes in Athelia bombacina and Their Interactions with the Host. Horticulturae. 2024; 10(8):842. https://doi.org/10.3390/horticulturae10080842

Chicago/Turabian Style

Sun, Xiaonan, Weiwei Yan, Xinnan Zhang, Wenhui Wang, and Xiaohui Jia. 2024. "Identification of Laccase Genes in Athelia bombacina and Their Interactions with the Host" Horticulturae 10, no. 8: 842. https://doi.org/10.3390/horticulturae10080842

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop