Identification of the Oleosin Genes and Functional Analysis of CeOle4 Gene in Cyperus esculentus L.

Abstract

Tiger nut is the tuber of the perennial herbaceous plant Cyperus esculentus L., whose unique underground tubers are not only the main reproductive organ but also an important oil storage site. Oleosin is the most abundant structural protein in the oil body, which is an important membrane structural protein, playing a role in the formation and stability of lipid droplets in oilseed crops. Most studies have focused on the oleosin in oilseeds, but rarely on the oil containing tuber. In this study, nine oleosin genes from the Cyperus esculentus transcriptome were identified and divided into two groups via phylogenetic analysis. The expression patterns of the nine oleosins were examined through quantitative real-time PCR (qRT-PCR) in various development stages of stem tissue (35 d, 50 d, 75 d, 90 d, and 120 d after sowing). The subcellular localization of CeOle4 indicated that this protein was localized exclusively to membrane, indicating that it functioned in the plasma membrane. The highly expressed gene CeOle4 within the CeOleosin gene family was further transformed into yeast cells and plant materials. The results demonstrate that CeOle4 can promote lipid synthesis, enhancing the stability of oil lipids at low temperature and changing seed phenotypic traits. This discovery addresses and enriches the research on the function of CeOleosin genes and lays the groundwork for future studies on novel and superior transgenic crops related to tiger nut.

1. Introduction

Cyperus esculentus L. is a perennial herbaceous plant belonging to the Cyperaceae family and Cyperus genus, propagated through tubers. It is widespread in tropical and temperate zones and is also present in cooler regions [1]. Tiger nut is the tuber of Cyperus esculentus L. and contains abundant nutrients such as lipids, protein, starch, fiber, vitamins, minerals, and various bioactive compounds, which have been found to play a role in preventing liver damage [2]. The predominant and highest content component in tiger nut is oil, accounting for approximately 20% to 35% of the total volume in its tubers [3]. Oil extracted from tiger nut tubers is particularly abundant in oleic acid and linoleic acid, possessing nutritional value comparable to olive oil while exhibiting strong antioxidant properties [4,5]. It has been shown to promote blood circulation, protect cardiovascular and cerebrovascular health, and prevent related diseases [6,7]. The drought-resistant, salt-alkali tolerant and infertile soil adaptive characteristics of tiger nut make it an attractive candidate for the development of novel oil crops.

Lipids serve as a crucial means of energy storage in plants, with triacylglycerols (TAGs) being a pivotal component. Within plant cells, TAGs primarily exist in the form of subcellular droplets known as oil bodies [8,9,10]. Oleosins, alkaline hydrophobic structural proteins, are found across a spectrum of organisms from algae to higher plants, acting on the surface of plant oil bodies [9]. Oleosins consist of three structural domains: a hydrophilic N-terminus, a central hydrophobic domain, and a hydrophilic C-terminus. Near the C-terminus, adjacent to the central hydrophobic domain, there exist amphipathic α-helical structures capable of interacting with the phospholipid bilayer horizontally [10]. However, due to the lower conservation of amino acid sequences, the N- and C-termini are present only on the surface of oil bodies, primarily functioning as binding receptors for lipases during TAG degradation [11,12]. The central hydrophobic region, composed of 70 amino acids arranged in two inversely oriented β-fold structures, features a proline knot consisting of one serine and three proline residues at the apex [13]. Research suggests that this proline knot is crucial for the functional role of oleosin in oil bodies, adopting a hairpin configuration within the oil phase [8,14], Oleosins maintain oil body stability primarily due to their electronegativity and the presence of this structure, which impedes fusion between oil bodies, thus ensuring their stable dispersion within the cytoplasm [12,15]. Studies indicate that even under the action of strong detergents like SDS, oleosin molecules retain considerable stability [16]. Oleosins can stabilize oil bodies and enhance plant tolerance to low temperatures. Under low-temperature conditions, plant fatty acid chains transition from a normal disordered state to an ordered state, causing normally dispersed oil bodies in the cytoplasm to aggregate and fuse, forming large and unstable oil bodies. This severely reduces the fluidity, morphology, and thickness of plant lipid membranes, thereby impeding normal physiological functions and, in severe cases, affecting plant growth and development [17,18].

In previous research, we studied the molecular mechanism of lipid biosynthesis during the development of tiger nut [19]. In this study, we identified nine oleosin genes to analyze the different expression levels in tubers at different stages, and further transform yeast cells and plant materials to validate the function of oil body protein genes.

2. Materials and Methods

2.1. Plant Material and Treatment

In field experiments, Cyperus esculentus plants were grown for 120 days from May to September, 43°05′ N 124°18′ W, 24–32 °C, Jilin, Changchun. Regular planting was performed with the planting density of three rows with a row length of 20 m, a distance of 40 cm between rows, and a 17 cm interval distance between two plants within a row. Each sample was planted in 24 m², with triplicate plots, 72 m² in total. Based on observations on Cyperus esculentus tuber development, five developmental stages were classified in this study. We arranged with names these five developmental stages as 35 days after sowing (35 DAS), 50 DAS, 70 DAS, 90 DAS, and finally 120 DAS. Tubers were collected in three replicates for each developmental stage (five developmental stages), then immediately the collected materials were frozen in liquid nitrogen and stored at −80 °C until further use.

2.2. Nile Red Staining

The Nile red staining experimental method was performed as described previously [20]. Five development tubers were collected, peeled, cut into small pieces of 0.5 × 0.5 cm, and then transferred into a fix solution of 4% tissues for 24 h at 4 °C. Then, the tuber tissues were embedded into paraffin by using embedding cassettes, blocked, held at 4 °C until complete solidification, and cut to 5–10 µm, dewaxing with an Electro Thermostatic Blast Oven (Henan Lanphan Technology Co., Ltd., Zhengzhou, China) at 60 °C. The sections were deparaffinized, rehydrated, and stained with Nile red (Invitrogen, Waltham, MA, USA) for a period of 2 min.

Yeast cells were centrifuged at 12,000 r/min for 1 min and 500 μL PBS was used to resuspend the cells, 1 μL Nile red solution added (1 mg Nile red powder with 1 mL dimethyl sulfoxide), vortex oscillation carried out for 2 min, staining in the dark for 10 min, and finally, rinsing twice with PBS solution.

Nile red fluorescence was imaged by confocal microscopy (TCS-SP8; Leica, Weztlar, Germany), with 488 nm excitation and 562–611 nm emission. Sections were then rinsed in running tap water, dehydrated, mounted, and captured; the sheet was sealed with neutral gum at the end.

2.3. RNA Isolation and qRT-PCR Analysis

The total RNA content was extracted using the FastPure Plant Total RNA Isolation Kit (Vazyme, Nanjing, China), and the extracted RNA was measured for purity and concentration by a NanoDrop 2000 ultraviolet spectrophotometer. Then, the first-strand cDNA was synthesized using MonScript™ RTIII All-in-One Mix with dsDNase (Monad, Suzhou, China) kit and preserved at −20 °C. A set of gene-specific primers of CeOleosin genes was synthesized based on the information obtained from the coding sequences in Premier version 6 (Premier Biosoft, Palo Alto, CA, USA). Primer sequences are to be found in Supplementary Table S2. To verify the integrity of primer specificity, each primer pair was generated away from the conserved domain of the genes. The internal reference genes of tiger nut used in the qRT-PCR analysis included the 18S ribosomal RNA gene [21]. All qRT-PCR reactions were performed with MonAmp™ ChemoHS qPCR Mix from Monad Biotechnology Co., Ltd. (Suzhou, China) using the Stratagene MX3000P real-time PCR machine. Following the manufacturer’s instructions, a 20 µL reaction mixture was prepared with 2.0 µL cDNA template, 0.2 µM primers (F/R), 0.2 µL ROX dye (100×), 10 µL master mix, and 7 µL RNase-free water. PCR conditions were set according to the manufacturer’s protocol. The relative transcript abundance values were calculated using the 2−∆Ct method.

2.4. Identification and Characterization of Oleosin Genes

DNAMAN 6.0 software was used to align the amino acid sequences of tiger nut with model plants including C. esculentus, Oryza sativa, Hordeum vulgare, Brassica napus, grain sorghum, Ananas comosus, and Arabidopsis thaliana. For the evolutionary analysis of the CeOles, we employed the neighbor-joining method to construct a phylogenetic tree with MEGA 7.0 software [22] (1000 bootstraps) and EvolVIEW 2.0 (China National Center for Bioinformation, Beijing, China) [23] was used for a better image. The Expasy Protparam tool website was used to analyze the amino acid sequence. The NovoPro online website was used to analyze and predict the transmembrane region, using SWISS-MODLE online analysis software to predict the three-dimensional structure of the oleosin protein family.

2.5. Cloning and Vector Construction of CeOle4 Genes in Tiger Nut

RNA was extracted from tiger nut at 120 days after sowing, and the RNA was reverse transcribed into cDNA templates. Primers were designed for CeOle4 as target genes (Table S3) for PCR amplification. The cloned CeOle4 gene band was ligated to the pMD-18T cloning vector and transformed into the DH5α E. coli competent state. They were sent to a biotech company for sequencing and aligned with the correct sequence using DNAMAN software. The correctly sequenced genes were cloned into the pCAMBIA1302 plant expression vector and transformed into EHA105 Agrobacterium for protein subcellular localization research.

CeOle4 was constructed into the pYES2/NTC yeast recombinant expression vector, the successfully sequenced pYES2/NTC-CeOle4 plasmid was transformed into INVSC1 yeast cells, while the pYES2/NTC empty vector was transformed as a negative control. INVSc1 yeast strain was purchased from AngYuBio Company, and pYES2/NT C carrier was purchased from Wuhan Miaoling Biotechnology Co., Ltd. (Wuhan, China), while 2 × Taq PCR premix was purchased from the Beijing Solarbio Science & Technology Co., Ltd. (Beijing, China). The seamless cloning kit was purchased from Monad Biotechnology Co., Ltd. (Suzhou, China), the restriction endonuclease from TAKARA, and the purification and recovery kit, plasmid extraction kit, and Escherichia coli DH5α competent state from Qingke Biotechnology Co., Ltd. (Beijing, China).

The CeOle4 gene was constructed using seamless cloning technology onto the pCAMBIA3301 plant expression recombinant vector to obtain the pCAMBIA3301- CeOle4 recombinant expression vector, which was then transformed into Agrobacterium EHA105 for transgenic plant expression research. The pCAMBIA3301 vector was provided by the Bioreactor and Drug Development Engineering Research Center of the Ministry of Education in Jilin Agricultural University.

2.6. Transformation and Observation of Tobacco Leaf Cells

This was carried out as follows. Extract the plasmids pCAMBIA1302-CeOle4, and perform EHA105 Agrobacterium competent transformation. Incubate in liquid YEP medium containing kanamycin (50 μg/mL) and rifampicin (100 µg/mL) resistance, shake at 28 °C for 20 h on a shaker. Inoculate the cultured bacterial solution into 50 mL of liquid YEP medium containing the above-mentioned resistance, and add 100 µL MES and 4 µL AS (acetyl eugenol) to every 10 mL medium. Shake the medium at 28 °C on a shaker until the OD₆₀₀ value of Agrobacterium is between 1.0–1.2. Centrifuge at 4000 r/min for 10 min in a high-speed centrifuge. Resuspend the bacterial pellet in 10 mM MgCl₂ solution containing 20 µL AS per 10 mL until the OD₆₀₀ value is 1.0, and let it stand for at least 2 h. Select healthy and disease-free tobacco plants at around three weeks of age, use a syringe to extract the resuspended bacterial solution, and inject it from the back of the tobacco leaves. The injected tobacco plants were cultured in a dark place for 60 h. Take the injected leaf slices and observe them under a confocal laser microscope. EHA105 Agrobacterium competent cells were purchased from Shanghai Angyu Biotechnology Co., Ltd. (Shanghai, China), MES, AS, kanamycin and rifampicin were purchased from Beijing Solarbio Science & Technology Co., Ltd. (Beijing, China).

2.7. Induced Expression of Target Protein in Yeast Cell

This was carried out as follows. Inoculate the yeast cells successfully transformed with pYES2/NTC-CeOle4 recombinant plasmids into 50 mL Cultivate in SD-URA liquid medium for 24 h. Centrifuge the cultured bacterial solution at 4 °C and 5000 r/min for 10 min. Discard the supernatant, resuspend the bacterial pellet in 0.9% NaCl solution, and centrifuge at 4 °C, 5000 r/min for 10 min. Repeat the above steps. Inoculate the obtained bacterial pellet into SC-URA medium containing 2% lactose until the OD₆₀₀ value reaches 0.4. Take 5 mL samples of the inoculated bacterial solution at time points of 4 h, 6 h, 8 h, 12 h, 24 h, 36 h, and 48 h. The total protein extraction of yeast liquid is carried out according to the fungal total protein extraction kit.

2.8. TAG and DAG Content Detection

This was carried out as follows. Take 2 mL of the induced cell solution, uninduced cell solution, and empty cell solution from each time period, centrifuge at 3000 r/min for 10 min in a centrifuge, resuspend the cells in 1mL PBS solution for precipitation, boil in water for 10 min, place in liquid nitrogen for 5 min, and then boil in water for 5 min. The treated cell solution is centrifuged at 3000 r/min for 20 min, and the supernatant is taken for TAG content detection. The determination of TAG and DAG content in transgenenic Camelina sativa is as follows. Take 0.1 g of T3 generation seeds and grind them thoroughly in liquid nitrogen. After grinding, transfer them into a 2 mL centrifuge tube, add 900 µL PBS solution, centrifuge at 4 °C for 20 min, collect the supernatant for TAG content detection, and treat the wild-type seeds in the same way as the control group. The operational procedure for determining the DAG content is the same as TAG. The TAG content detection kits (Triglyceride (TG) Content Assay kit) were purchased from Beijing Boxbio Science & Technology Co., Ltd. (Beijing, China).

2.9. Western Blotting Analysis Target Protein Expression

Yeast cells were lysed with yeast total protein extraction kit (Solarbio, Beijing, China) for protein extraction [24]. The protein concentration was determined by bicinchoninic acid protein kit. Extracted proteins were separated by SDS-PAGE assays, transferred onto nitro-cellulose membranes, followed by blocking with 10% skimmed milk in the TBST. PVDF membranes were treated with primary antibodies targeted to anti-his taq (1:5000) at room temperature for 1.5 h. Subsequently the membranes were incubated with secondary antibody which was HRP-conjugate (1:7000) at room temperature for 1 h. Signals were detected using an ECL kit (GE Healthcare, Chicago, IL, USA). The primary antibody for anti-his taq and the secondary antibody were from Solarbio, Beijing, China.

2.10. CeOle4-Overexpressed Transgenic Camelina Sativa and Expression Analysis

For the construction of overexpression vectors, the CDS of CeOle4 was cloned into the pCAMBIA3301 vector and transformed into Agrobacterium tumefaciens EHA105 competent cells (liquid nitrogen for 5 min, then 37 °C water bath for 5 min). The transformation was carried out by the floral dip method and Agrobacterium-mediated inoculation of plants at the early flowering stage along with a vacuum infiltration procedure [25]. The gene-specific primers (F:TATGACCATGATTACGAATTCATGGCG GACCGCGGGCAG; R:CAGGTCGACTCTAGAGGATCCCTACTTGTCGGTCTTCCCG CC) were used to screen out transgenic plants until T3 generation was obtained harboring the CeOle4 gene. The phenotype of the T3 transgenic plants [26,27] was observed for morphological differences, and the expression profiling was carried out simultaneously using qRT-PCR assay.

2.11. Observation of Phenotype of Transgenic Camelina Sativa

This was carried out as follows. Select transgenic Camelina sativa seeds with relatively high expression levels, TAG content, and DAG content, comparing them with wild-type Camelina sativa seeds to observe differences in seed size and seed coat color, and then measure the hundred-seed weight, further demonstrating the function of CeOle4 in plants.

2.12. Data Analysis

All experiments mentioned were conducted in triplicate, and the resulting data were subjected to statistical analysis using the t-test. A significant difference was defined as * p < 0.05, ** p < 0.01, and *** p < 0.001.

3. Results

3.1. Lipid Droplets Accumulation during Tuber Development

As the days of tuber cultivation increased, its diameter also continued to increase (Figure 1A). The different development stages of tubers were stained by Nile red. Nile red fluorescence was imaged by confocal microscopy with 488 nm excitation and 562–611 nm emission. There was a significant increase in lipid accumulation within the tuber (Figure 1B–F), accompanied by a rising trend in structural abundance and density, gradually transitioning from sporadic occurrences to clustering into dense cell-like structures. The maximum density was reached at the 120 DAS developing stage.

3.2. Gene Expression Analysis of CeOleosin Family

The qRT-PCR expression analysis of the CeOleosin gene family is illustrated in Figure 2. The expression levels of different oleosin genes vary significantly across different developing stages. CeOle1, CeOle4, CeOle5, CeOle8, and CeOle9 maintain relatively high expression levels throughout the entire growth period. Specifically, CeOle1 shows a gradual increase in expression as the growth period extends, peaking at 120 DAS (days after sowing). CeOle4 and CeOle5 also exhibit increasing expression levels with prolonged growth, reaching their highest levels at 90 DAS. In contrast, ole8 and ole9 initially display high expression levels in the early growth stages but decrease thereafter, reaching their lowest point at 90 DAS. CeOle7 demonstrates relatively stable expression, peaking at 50 DAS, and gradually declining thereafter. On the other hand, CeOle2, CeOle3, and CeOle6 consistently exhibit lower expression levels throughout the developing period.

3.3. Phylogenetic Analysis of Oleosin Family Members

Using MEGA 7.0 software, a phylogenetic tree was constructed to validate the evolutionary status of the oleosin family in C. esculentus (shown in Figure 3). The resulting phylogenetic chart indicates a high degree of conservation of oleosin across various species. The oleosin family members of these species are categorized into four lineages, T, U, SL, and SH [28]. The nine oleosin sequences from the C. esculentus transcriptome data were identified and divided into two lineages. CeOle6, CeOle7, CeOle8, and CeOle9 were divided into SH lineage, while CeOle1, CeOle2, CeOle3, CeOle4, and CeOle5 were divided into SL. CeOle6-9 likely plays a role in the synthesis of oleic acid, total fatty acids (FAs), and phosphatidic acid (PA) [29]. CeOle1–5 are likely associated with neutral lipid synthesis [30].

3.4. Subcellular Location of CeOle4

Using Agrobacterium transformed with the empty vector pCAMBIA1302 as a positive control, and selecting FM4-64FX as a specific marker for cell membranes, the localization of the pCAMBIA1302-CeOle4 recombinant vector in tobacco leaf cells was observed. Tobacco plants with consistent growth were chosen for injection. Under the same culture conditions, tobacco leaf cells injected with Agrobacterium harboring the pCAMBIA1302 empty vector exhibited fluorescence excitation at both the cell membrane and the cell nucleus. In contrast, tobacco leaf cells injected with the pCAMBIA1302-CeOle4 recombinant vector showed fluorescence only at the cell membrane under the same conditions (Figure 4). This indicates that CeOle4 is localized to the cell membrane and classified as a membrane-targeted protein.

3.5. Exogenous Expression of CeOleosin4 and Function Analysis

To investigate the functionality of the CeOle4 gene on affecting the size and stability of oil bodies, formation and degradation of oil bodies, etc., yeast cells were employed for the exogenous induction of CeOle4 expression. The target protein was induced using SC-URA liquid medium containing 2% galactose, and yeast cells were harvested at 4 h, 6 h, 8 h, 12 h, 24 h, 36 h, and 48 h, respectively. Western blot analysis was conducted, with empty vector-containing yeast and uninduced yeast cells serving as negative controls. Based on the Western blot results, the optimal induction time for CeOle4 gene-transformed yeast cells was determined to be 8 h (as shown in Figure 5 and Figure 6).

To further investigate the function of CeOle4, yeast cells were subjected to low-temperature (4 °C) cultivation during the optimal induction period, and the growth status and Nile red staining results of the cells were continuously monitored. The results revealed that after 2 h of low-temperature treatment, yeast cells overexpressing the CeOle4 gene still exhibited a high accumulation of lipids. However, with increasing treatment duration, the lipid accumulation noticeably decreased (Figure 7). When the low-temperature treatment duration reached 6 h, the accumulation of lipid substances in yeast cells overexpressing the CeOle4 gene showed no significant difference compared to the wild type and uninduced yeast cells. This suggests that CeOle4 not only promotes lipid synthesis in eukaryotes, but also enhances the stability of the oil body and protects lipid droplets from degradation under low-temperature stress.

3.6. Analysis of Agronomic Traits in Transgenic Camelina Sativa Seeds

To further elucidate the function of the CeOle4 gene, the triacylglycerol (TAG) content in transgenic Camelina sativa seeds was determined. Seven transgenic lines were compared to the wild type, and the TAG and diacylglycerol (DAG) contents were measured. TAG analysis revealed that the TAG content in lines OE1, OE2, OE4, and OE6 increased by 33.2%, 40.52%, 20.02%, and 30.82%, respectively, compared to the wild type, while lines OE3, OE5, and OE7 showed marginal increases of 0.25%, 3.34%, and 9.00%, respectively (Figure 8A). DAG analysis indicated that compared to the wild type, lines OE1, OE2, and OE4 exhibited significantly elevated DAG levels, whereas lines OE5, OE6, and OE7 showed only slight increases, and OE3 line exhibited a slight decrease in DAG content (Figure 8B).

Based on the expression levels of CeOle4 and the content of TAG and DAG in transgenic Camelina sativa seeds, OE1 and OE2 lines were selected for further experimental measurements. By comparing the seed length of WT Camelina sativa seeds with those of the selected transgenic lines, it was observed that the seed length of the OE1 line increased by 41% compared to the wild type, while the OE2 line increased by 53% (Figure 9A). Additionally, during the observation of seed size, it was noticed that the seed coat color of the wild-type lines was darker than that of the transgenic lines (Figure 9C). Subsequently, hundred-seed weight analysis was conducted on both wild-type and transgenic lines. The results revealed that the weight of seeds in the OE1 group increased by 12.6% compared to the wild type, while the OE2 group increased by 11.3% (Figure 9B). The presence of CeOle4 not only increased the length and weight of seeds but also had a certain influence on the color of the seed coat (Figure 9D).

4. Discussion

Lipids are essential components of eukaryotic cells, typically categorized into two subgroups: polar and neutral lipids. Neutral lipids, including sterol esters (SE) and TAG, have garnered considerable interest in recent years for their formation and accumulation within neutral lipid bodies, driving extensive research across various fields. As a high-quality oil crop, tiger nut primarily metabolizes and stores lipids in its tubers [31].

Previous studies indicated that the primitive type oleosin (P) is distributed in mosses and ferns, the ubiquitous type (U) is found in all land plants, the low molecular weight type (SL) is prevalent in seed plants, while the high molecular weight type (SH) is present in angiosperms. Additionally, the woolly type (T) is distributed in Brassicaceae plants [32]. A systematic phylogenetic analysis was conducted on nine oleosin proteins within the tiger nut gene family, along with gene expression profiling across different developmental stages of stem tubers. The highly expressed proteins in tiger nut tubers belong to the SL type. It is speculated that this type of oleosin exhibits a highly conserved structure, with maximum expression levels observed during the mature stage of stem tuber development, suggesting a close association between the expression level of SL-type oleosin and lipid accumulation and synthesis in tiger nut stem tubers.

To gain preliminary insights into the gene function of CeOle4 in tiger nut, the gene was cloned, and a subcellular localization vector, pCAMBIA1302-CeOle4, was constructed to observe the subcellular localization of CeOle4. CeOle4 was found to localize on the cell membrane. Its functional domain shares high similarity with GmOle5 and AtOle7, suggesting involvement in cell membrane morphogenesis, assembly, or transport. Previous studies have also suggested its association with plant immune responses and intracellular and extracellular signal transduction [33].

To further investigate the function of CeOloe4, this study constructed a yeast recombinant expression vector and introduced it into yeast cells. Verification was conducted using precise SDS-PAGE and Western blot analysis. Subsequently, different types of yeast cells were subjected to low-temperature stress and Nile red staining to observe differences in size, density, and brightness, verifying their cold tolerance characteristics. In yeast cells, the primary focus of neutral lipid research lies in the production of biofuels from oleaginous yeast species [34]. Studies have shown that TAG within eukaryotic cells serves not only as a storage form of fatty acids but also plays a crucial role in maintaining cell membrane structure and fluidity [35,36]. This is consistent with the localization of CeOle4 on the cytoplasmic membrane in this study, implying that the homeostasis of TAG is closely associated with the process of membrane lipid renewal and remodeling, which are crucial for maintaining the structure and fluidity of cell membranes. However, the traditional view of TAG as a storage form for cellular carbon and energy is being challenged by recent research, which suggests that TAG also plays an important role in maintaining membrane function [37]. The results of this study also indicate that while CeOle4 localizes to the cytoplasmic membrane, increasing the content of intracellular TAG enhances cell cold tolerance. Since the cell membrane is the primary site of cold stress, the elevation of unsaturated fatty acids on the membrane increases its fluidity, thereby significantly improving cold tolerance [38]. Due to the stabilizing effect of the oleosin on cell membranes, plants with high levels of oleosin expression also exhibit strong cold tolerance [39].

Oil body proteins are related to lipid synthesis and content, with a decrease in oil body protein content in rice seeds resulting in reduced oil content and increased oil body size [40]. Expression of the oleosin gene from Brassica napus in Arabidopsis thaliana leads to larger oil bodies in the seeds of all transgenic lines except OLE1 compared to the wild type. In Arabidopsis thaliana, removal of the oleosin gene results in decreased C18:1 fatty acid content and increased C20:1 fatty acid content in seeds, and studies have shown that overexpression of OLEs can increase oil and linoleic acid production [41]. Camelina sativa is a cruciferous oil crop that contains a greater variety of unsaturated fatty acids in its seeds compared to other oil crops, and it has low cultivation costs, rapid growth, and many other excellent characteristics. In this study, Camelina sativa was used as the gene transformation recipient, and the content of TAG and DAG in the seeds was detected to validate the function of the CeOle4 gene. It was found that Ceole4 is related to the lipid content in Camelina sativa seeds and is associated with seed weight [42], and there is also a certain correlation between lipid accumulation and seed coat color [43]. Overexpression of Ceole4 in Camelina sativa seeds resulted in lighter seed coat color compared to the WT, with significantly higher TAG content, suggesting a negative correlation between TAG and seed coat color. Recent studies showed that seed coats participate in plant cold tolerance by increasing embryo cutinization [44]. However, other studies showed that plant lipid substances accumulate in the seed coat rather than primarily in the embryo under low temperature treatment, indicating that the accumulation of lipid substances in seeds may be related to embryo cutinization, ultimately promoting plant seed tolerance to low temperatures [45,46]. Based on a comprehensive analysis of the results of this study, it is speculated that CeOle4 may be involved in the regulation of seed coat color changes and plant cold tolerance. This study provides a preliminary exploration of the function of the CeOle4 gene in the oleosin family of Camelina sativa and has achieved promising results, laying the foundation for further in-depth research into the molecular mechanisms of oilseed crops.