Next Article in Journal
Fish Community Diversity and Spatiotemporal Dynamics in the Downstream of the Fujiang River Based on Environmental DNA
Next Article in Special Issue
Optimal Dietary Carbohydrates to Lipids Ratio for Fast and Coordinated Test Growth of Juvenile Sea Urchin (Strongylocentrotus intermedius)
Previous Article in Journal
Genetic Diversity and Population Structure of Commercial Eel Conger myriaster (Anguilliformes: Congridae) Along the Coasts of China Based on Complete Mitochondrial Cyt b Sequences
Previous Article in Special Issue
Effects of Dietary Protein and Lipid Levels on the Growth Performance and Serum Biochemical Indices of Juvenile Furong Crucian Carp
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Supplementation of Enzymatic Hydrolysate in Low-Fishmeal and Low-Crop Diet Improves Growth, Antioxidant Capacity, and Immunity of Juvenile Sea Cucumber Apostichopus japonicus (Selenka)

1
School of Marine Science and Engineering, Qingdao Agricultural University, Qingdao 266109, China
2
Key Laboratory of Marine Ecology and Environmental Sciences, Institute of Oceanology, Chinese Academy of Sciences, Qingdao 266071, China
*
Author to whom correspondence should be addressed.
Fishes 2025, 10(2), 42; https://doi.org/10.3390/fishes10020042
Submission received: 9 December 2024 / Revised: 12 January 2025 / Accepted: 20 January 2025 / Published: 24 January 2025

Abstract

:
As the global demand for aquafeed ingredients continues to rise, sourcing sustainable alternatives is crucial for aquaculture industries. This study aimed to explore the potential of enzymatic hydrolysate as a substitute for traditional fishmeal and soybean meal in diets for juvenile sea cucumbers (Apostichopus japonicus). Three isonitrogenous (15% crude protein) and isolipidic (2.4% crude lipid) diets were formulated: a control diet containing 10% fishmeal and 5% soybean meal and two experimental low-fishmeal (8%) and low-soybean meal (0%) diets, supplemented with either 8% enzymatically hydrolyzed fish stickwater (EFS) or 8% enzymatically hydrolyzed chicken pulp (ECP), designated as Control, EFS, and ECP, respectively. Juvenile sea cucumbers (initial body weight, 0.25 ± 0.01 g) were fed these diets for 84 days to evaluate the effects of ECP and EFS on their growth performance, antioxidant capacity, and inflammatory responses. The results revealed significantly higher final weights and specific growth rates in both experimental groups than the control (p < 0.05). The proximate chemical compositions of sea cucumber were less affected by the diets (p > 0.05). Compared with the control group, significantly elevated levels of digestive enzymes, antioxidants, and lysozyme, together with lower malondialdehyde levels, were recorded in the experimental groups (p < 0.05). ECP appeared to exhibit greater potency than EFS in enhancing growth performance and antioxidant capacity. Similar trends were observed in the mRNA expression of SOD, CAT, and inflammation-related genes across the groups. In a nutshell, both ECP and EFS supplemented in a low-fishmeal and low-soybean meal diet could effectively promote the growth and health of A. japonicus, with ECP showing a superior effect over EFS. These findings suggest that enzymatic hydrolysate demonstrates potential as a viable alternative to traditional fishmeal and soybean meal in diets for sustainable sea cucumber aquaculture. Further investigations are warranted to reveal its underlying mechanism.
Key Contribution: Enzymatic hydrolysate as a sustainable alternative to fishmeal and soybean meal in the diet could enhance growth, boost immune responses, and strengthen antioxidant defenses in cultured sea cucumber.

1. Introduction

The aquaculture industry has long relied on traditional fishmeal and soybean meal as the primary protein sources of aquatic diets [1]. However, the escalating demand for fishmeal and soybean meal has led to a concern of stable supply, coupled with rising prices [2] that challenge the economic sustainability of aquaculture practices [3]. Moreover, the increasing need for fishmeal inevitably drives the overexploitation of fishery resources, threatening the ecological balance of marine biodiversity [4]. In addition, the excessive use of fishmeal can lead to water quality degradation, resulting in eutrophication and environmental stress in aquaculture systems [5]. Likewise, the consumption of soybean meal in the aquafeed industry inevitably competes with the interests of human food sources, raising a series of social issues, such as greenhouse gas emission, land appropriation, the displacement of communities, and challenges for food security [6]. These predicaments have necessitated the exploration of alternative protein sources that can effectively replace fishmeal and soybean meal without compromising the nutritional quality of the feed. The urgent need for sustainable practices in aquaculture aligns with global efforts to minimize reliance on overexploited marine resources and valuable human food resources [7]. To this end, innovative solutions are urgently required to transform underutilized by-products into viable feed alternatives, ensuring both ecological and economic sustainability within the aquaculture sector.
Poultry-derived protein has been well recognized as the most promising alternative to fishmeal due to its high-quality amino acid profile, cost-effectiveness, wide availability, and relatively low environmental impact compared with traditional fishery resources [8]. Global chicken meat production has steadily increased, with poultry processing generating 37–67% waste, including bones and skin [9]. These by-products are rich in amino acids and possess attractant properties, making them a suitable non-grain protein resource [10]. Despite their nutritional potential, many of these resources remain underutilized due to limited deep processing and technical constraints [11], resulting in increased disposal costs, minimal profit margins for producers, and heightened risks of environmental pollution [12,13]. As regulatory pressures mount and public awareness regarding environmental issues grows, the imperative to convert these underused resources into valuable products becomes increasingly clear.
Recent advancements in biotechnological processes have led to the development of various treatments, including enzymatic and chemical hydrolysis [14], which has been frequently used to improve the functional and nutritional properties of proteins [15] in diets for aquaculture. Enzymatic hydrolysis treatment could effectively produce low-molecular-weight substances, including water-soluble peptides, free amino acids, and taurine [16]. These processes not only enhance the nutritional profile of the by-products but also yield bioactive peptides that possess health-promoting properties [17]. For example, fish stickwater (FS) is an attractant that is widely used in aquafeed to improve the feed intake of farmed fish species. Enzymatic hydrolysis of FS confers superior effects in term of enhanced feed intake, boosted immune responses, and increased antioxidant capacity when enzymatic hydrolyzed fish stickwater (EFS) is incorporated into diets [18,19,20]. Likewise, enzymatic hydrolysis possesses the ability to extract these bioactive compounds from chicken pulp; the resultant enzymatic hydrolyzed chicken pulp (ECP) has significant implications for the development of nutraceuticals and functional diets. A mounting number of studies have shown positive effects of incorporating ECP into the feed of Scophthalmus maximus [21], Litopenaeus vannamei [22], Larimichthys crocea [23], and pearl gentian grouper [24], establishing ECP as a sustainable alternative to traditional protein sources like fishmeal.
Apostichopus japonicus, a member of the phylum Echinodermata, class Holothuroidea, and family Stichopodidae, is a valuable and popular sea delicacy in China. It is highly valued for its unique flavor [25], nutritional benefits [26,27], and medicinal properties [28]. Over recent years, sea cucumber farming has seen a significant rise, driven by growing economic and nutritional demand [29]. In the wild, A. japonicus is a detritivore species that naturally feeds on detritus found on the sea floor. However, in indoor intensive culture systems, the growth of sea cucumbers relies entirely on artificial feed. Although sea cucumbers do not require a large amount of protein, the dietary protein quality significantly influences their growth and health [30]. The published literature has clearly indicated the excellence of a mixture of fishmeal and soybean meal as the primary protein source in the diet of sea cucumber [31,32,33]. Considering the limited supply of fishmeal and food–feed competition of soybean meal [34], by exploring these human-inedible protein sources, the aquaculture industry can move towards more sustainable feeding practices, ensuring the long-term viability of sea cucumber farming. A considerable number of publications have proved the success of ECP as a substitute for fishmeal without compromising the growth and health of farmed aquatic species. However, few efforts have been made to investigate its viability in a diet for sea cucumber. Given the importance of efficient protein utilization in sea cucumber farming, we conducted experiments to compare the effects of EFS and ECP on the growth and immune function of A. japonicus. This investigation aimed to explore the potential application of these enzymatic hydrolysates in sea cucumber feed, highlighting their contribution to resource-efficient aquaculture practices.

2. Materials and Methods

2.1. Experimental Diet

The two enzymatically hydrolyzed proteins, EFS and ECP, utilized in this experiment were supplied by Bio-way Ingredients biotechnology company, based in Qingdao, China. The basal feed serving as the control diet was formulated using fishmeal, soybean meal, cornmeal, and mixed seaweed meal as the primary protein sources. The protein content of the diets was around 16%, which was determined to be optimal for juvenile sea cucumber, as indicated by the published literature [35,36]. Two experimental diets (EFS and ECP) were formulated by replacing 2% fishmeal and 5% soybean meal in the diet with 8% EFS or ECP, respectively (Table 1). The diets were prepared in dry powder form. All raw materials were processed through a 100 μm sieve and thoroughly homogenized. The diets were sealed in airtight packaging and stored at −20 °C throughout the feeding trial. Two weeks after preparation, the diets were manually fed to the sea cucumbers after the feeding trial started. The nutritional compositions of the enzymatically hydrolyzed protein products were determined as follows: A raw amino acid analyzer (ninhydrin column) was used to determine the amino acid composition. Fatty acids were analyzed by hydrolysis extraction, and the biogenic amine composition was determined by liquid chromatography. The acid content and peptide molecular weight distribution were assessed according to the GB/T 22729-2008 standard (Table 2).

2.2. Experimental Sea Cucumber and Feeding Trial

The sea cucumbers (Apostichopus japonicus) used in the experiment were sourced from a local aquaculture company in Qingdao, China. Prior to the feeding trial, the sea cucumbers underwent a two-week acclimatization period in an aquaculture tank where they were provided with a control diet. Then, the A. japonicus were subjected to a 24 h fasting period before being batch-weighed. The individuals of similar size were then randomly distributed into nine experimental tanks at a stocking density of 30,000 individuals per tank (2 m × 10 m × 1 m). Each diet was assigned to the sea cucumbers in triplicate. The A. japonicus were fed once daily at 3:00 PM to apparent satiation by adjusting the feeding amount according to the total biological mass. Continuous aeration was supplied to maintain dissolved oxygen levels above 6.5 mg L−1, and the A. japonicus were cultured in a dark environment throughout the experiment. Each tank was equipped with an independent water supply and drainage system, with one-third of the water exchanged daily. The water temperature was maintained at 24 ± 2 °C, the salinity varied from 25‰ to 30‰, and the pH levels were at 7.5–8.0. Separate cleaning tools were assigned to each tank and disinfected after use. The feeding trial lasted for 84 days.

2.3. Growth Indicators

At the termination of the experiment, the sea cucumbers were deprived of food for 24 h before sampling. Their individual body weights in each tank were estimated through measuring 100 sea cucumbers that were randomly selected, and the total count of viable sea cucumbers was determined by dividing the total biomass by the average weight of the representatives. The survival rate and growth performance were calculated as follows:
Survival rate (SR) = final count of sea cucumbers/initial count of sea cucumbers;
Feed intake (FI) = total consumed feed (g)/final count of sea cucumbers;
Specific growth rate (SGR) (% day−1) = [Ln (FW/IW)/t] × 100;
RNA/DNA ratio = CRNA/CDNA.
Here, IW and FW represent the initial and final body weights (g) of the sea cucumbers, respectively, and t denotes the duration of the experiment (days); CRNA is the body wall RNA concentration; CDNA is the body wall DNA concentration. Both RNA and DNA extractions were performed using a marine animal tissue genomic DNA extraction kit (TIANGEN, Beijing, China), following the manufacturer’s protocol. The concentrations of RNA and DNA were quantified using a NanoDrop spectrophotometer, and their quality was evaluated through gel electrophoresis analysis.
Six sea cucumbers were randomly selected from each unit and placed on ice for dissection. The intestines were separated, promptly snap-frozen in liquid nitrogen, and subsequently stored at −80 °C for future analysis. After this, the sea cucumbers’ body walls were preserved in plastic sealing bags for proximate chemical composition analyses. The measurements of intestinal enzyme activities and RNA extraction were conducted on pooled samples comprising six individuals from each replicate.

2.4. Proximate Chemical Composition Analysis of Ingredients and Body Wall of Sea Cucumber

The proximate compositions of the biological samples, ingredients, and experimental diets were analyzed using published methods [37]. The moisture content was measured by drying the samples to a constant weight at 105 °C. The crude protein content was determined using the Kjeldahl method on a semi-automatic Kjeldahl nitrogen analyzer (FOSS) [38]. Crude lipids were measured using Soxhlet extraction, and the crude ash content was determined by incineration in a muffle furnace at 550 °C.

2.5. Determination of Intestinal Enzyme Activities

Frozen intestine samples were homogenized on ice in 0.9% NaCl solution using a tissue homogenizer. The homogenized suspension was centrifuged at 12,000× g for 20 min at 4 °C, and the supernatant was transferred to new vials for enzyme activity assays. Digestive enzyme activities (trypsin, lipase, and amylase) and antioxidant enzyme activities, including superoxide dismutase (SOD, WST-1 method), catalase (CAT, ammonium molybdate method), lysozyme (LZM, turbidimetric method), malondialdehyde (MDA, TBA method), acid phosphatase (ACP), and alkaline phosphatase (AKP), were measured according to the protocols of commercial kits purchased from Nanjing Jiancheng Bioengineering Research Institute (Nanjing, China). Enzyme activities were assessed using a SpectraMax iD5 multifunctional microplate reader (Molecular Devices, San Jose, CA, USA) and a 721 visible spectrophotometer (Youke, Shanghai, China).

2.6. RNA Extraction, cDNA Synthesis, and Quantitative Real-Time PCR

Total RNA was extracted from intestinal tissue using the SPARKeasy Improved Tissue/Cell RNA Kit (SparkJade, Jinan, China). The RNA concentration and purity were assessed using a NanoDrop One Ultra-Micro Spectrophotometer (Thermo Fisher, Waltham, MA, USA). The extracted RNA was reverse-transcribed into cDNA with PrimeSTAR® Max DNA Polymerase (TaKaRa, Kusatsu, Japan) and diluted with DEPC-treated water for further analysis. Specific primers for RT-PCR assays of target genes were designed according to the sea cucumber genome in NCBI (Table 3). Quantitative real-time PCR was conducted in a 10 μL reaction system containing 0.2 μL of each primer (sequences listed above), 1 μL of cDNA, 5 μL of Hieff UNICON® Universal Blue qPCR SYBR Green Master Mix (Yeasen, Shanghai, China), and 3.6 μL of nuclease-free water. Amplification was performed using a Bio-Rad CFX96 real-time PCR system (Bio-Rad, Hercules, CA, USA). The qPCR cycling conditions included an initial denaturation at 95 °C for 30 s, followed by 39 cycles of denaturation (95 °C for 5 s) and annealing (60 °C for 30 s). A melting curve analysis was carried out post-amplification to verify the product specificity. Ct values were obtained, and the relative mRNA expression levels of target genes were normalized to that of β-actin. Relative gene expression was calculated using the 2−ΔΔCt method [39].

2.7. Statistical Analysis

The experimental results were expressed as the mean ± standard deviation (SD) of three replicates per treatment. Prior to analysis, the data were assessed for normality using the Shapiro–Wilk test and for homogeneity of variance using Levene’s test. Only data meeting these assumptions were subjected to further statistical analysis. A one-way analysis of variance (ANOVA) was conducted to evaluate the significance of differences between treatment groups. Duncan’s multiple comparison tests were applied to assess differences between treatment groups at a significance level of p < 0.05. All statistical analyses were performed using SPSS 25.0 statistical software, and graphs were generated using GraphPad Prism (San Diego, CA, USA).

3. Results

3.1. Growth Performance

As shown in Table 4, no significant difference was detected for the survival rate among the treatments. Experimental sea cucumbers given diets supplemented with enzymatically hydrolyzed proteins showed significantly higher feed intake, final weights, SGR, and RNA/DNA ratios compared with the control group (p < 0.05). These values tended to be higher in sea cucumbers fed the ECP diet than those fed the EFS diet, although the difference was not statistically significant (p > 0.05).

3.2. Proximate Chemical Composition of A. japonicus Body Wall

Sea cucumbers in the EFS group exhibited notably higher crude protein levels in their body walls compared with those in the control and ECP groups (p < 0.05). There was no significant difference in the moisture, lipid, or ash content of the body wall of A. japonicus across the treatments (p > 0.05) (Table 5).

3.3. Activities of Digestive Enzymes

As presented in Figure 1, trypsin activity was significantly higher in the EFS group compared with the control and ECP groups (p < 0.05), while the control group exhibited the lowest activity. Lipase activity was elevated in both experimental groups relative to the control (p < 0.05). No significant difference in lipase activity was observed between the EFS and ECP groups, although LPS activity was slightly higher in the ECP group. Similarly, the highest amylase activity was observed in the EFS group, followed by that in the ECP group, which was significantly higher than that in the control group (p < 0.05).

3.4. Immune and Antioxidant Enzyme Activities

The dietary treatments significantly influenced immune and antioxidant enzyme activities, as well as MDA levels, in sea cucumber (Figure 2). ACP activity was significantly higher in the EFS and ECP groups compared with the control (p < 0.05). LZM activity followed the same trend (p < 0.05). AKP activity was markedly greater in the ECP group than the control (p < 0.05), while the EFS group showed no significant differences from the control. SOD activity was significantly higher in both experimental groups compared with the control group (p < 0.05), with no statistical differences between the EFS and ECP groups. CAT activity was significantly elevated in the ECP group relative to both the control and EFS groups (p < 0.05). The concentrations of MDA, a marker of oxidative stress, were significantly reduced in the EFS and ECP groups compared with the control (p < 0.05).

3.5. Gene Expression

As shown in Figure 3, the expression levels of the TOR gene in sea cucumbers fed experimental diets were substantially higher than those in the control group. The expression levels of SOD and CAT were significantly higher in the experimental groups compared to the control group, with the highest expression being detected in the group given an ECP-incorporated diet (p < 0.05). The EFS group exhibited the highest LZM mRNA expression, with no significant differences compared with the ECP group; however, both experimental groups showed substantially higher expression than the control group (p < 0.05). In the 8% ECP group, the immune-related gene TLR was substantially regulated, leading to a reduction in pro-inflammatory factors. Immune-related genes such as NF-kB p105, C-type lectin, and glutamine synthetase were upregulated in the ECP group, and their expression levels were higher in all experimental groups compared with the control group. In the ECP group, the expression levels of the heat shock protein genes Hsp70 and Hsp90 increased with the addition of hydrolyzed protein, showing statistically significant differences compared with the control group (p < 0.05).

4. Discussion

Numerous studies have indicated that enzymatically hydrolyzed proteins that are abundant in free amino acids (FAAs) and peptides are readily digested and absorbed by organisms [40], possessing remarkable growth-enhancing effects. In practice, a lack of free amino acids leads to a significant decrease in the feeding rate of Japanese flounder [21] and poor growth of Atlantic salmon [41]. Also, the inclusion of enzymatic hydrolyzed poultry by-products in feed has been reported to promote growth in various species such as turbot [42], Oreochromis niloticus [43], and Litopenaeus vannmei [44]. This is consistent with the current study, in which incorporating both ECP and EFS into sea cucumber diets significantly improved growth performance (indicated by increased SGR and RNA/DNA ratio) compared with the control diet. To the best of our knowledge, this is also the first study to demonstrate the viability of enzymatic hydrolysates as a substitute for fishmeal in artificial diets for sea cucumbers. Generally, the growth of organisms is closely associated with feed intake [45]. A study on Persian sturgeon by Shamushaki et al. [46] revealed that FAAs—especially those related to taste, such as Glu, Ala, Gly, Pro, Leu, and Tau—have appetite-stimulating effects. Similarly, Carr et al. [47] found that partially hydrolyzed peptides extracted from marine bony fish exhibited significant appetite-inducing properties. Therefore, the facilitated feed palatability and consumption by the sea cucumbers in the experimental groups are attributable to the availability of FAAs and low-molecular-weight peptides provided by enzymatic hydrolysate [48]. Moreover, the digestive enzymes, including trypsin, lipase, and amylase, are pivotal in determining nutrient uptake and assimilation, which are directly responsible for the improved growth of aquaculture species. Studies on other aquaculture species, such as olive flounder and shrimp, demonstrated that dietary supplementation with enzymatic hydrolysates can stimulate enzyme production, improving digestibility and growth rates [2,49]. By contrast, different outcomes have been reported regarding the effects of enzymatic hydrolysate on the digestibility of diets. Feeding trials with turbot [50] and juvenile barramundi indicated that with a higher inclusion level (20–50%) of protein hydrolysates, no enhancing effects were detected, but detrimental effects were observed [51]. It was proposed that this notable decrease in digestibility could be attributed to an excess of free amino acids and nucleotides in the diet. Such an imbalance may have disrupted the typical digestive and metabolic processes, leading to reduced efficiency in digesting the ingested diets [52]. Considering this, it is necessary to take dose-dependent effects into consideration when it comes to incorporating enzymatic hydrolysates into diet formulations for new aquaculture practices.
The enzymatic hydrolysis of proteins substantially increases their acid solubility without altering the total protein content, leading to greater production of FAAs and peptides with molecular weights smaller than 5000 Da. Protein hydrolysis typically produces enzymatic hydrolysates with peptide fractions ranging from 200 to 3000 Da, which are considered biologically active [53]. Only these biologically active peptides possess the capacity to support better nutrient assimilation and health enhancement. Numerous pieces of evidence have shown that the specific effects of hydrolysates are dependent on the molecular weight and amino acid sequence of the peptides. Enzymatic hydrolysates with different profiles of peptides confer varying effects on the growth and health of farmed animals, according to the published results [54]. The present findings clearly indicated that ECP, with its higher concentration of bioactive peptides (500–3000 Da), possesses superior growth-promoting effects to EFS. These peptides optimize cellular protein turnover, as evidenced by elevated TOR gene expression in sea cucumbers fed a diet containing ECP. Mechanistically, the TOR pathway plays a pivotal role in regulating nutrient sensing, protein synthesis, and cellular growth [55]. In sea cucumbers, the enhanced expression of TOR in response to ECP supplementation on the one hand underscores the activation of this key anabolic pathway induced by enriched amino acids and peptides that are rapidly taken up by intestinal cells [56,57]. On the other hand, elevated TOR expression indicates an upregulation of a signaling pathway that promotes cell growth, proliferation, and efficient protein utilization, leading to improved growth and increased protein content in the body wall. However, excessive levels of ECP in the feed can lead to an overabundance of FAAs [58,59]. High levels of FAAs can induce satiety, and their premature absorption may cause an amino acid imbalance [15]. This imbalance can result in reduced feeding and, subsequently, decreased growth in sea cucumbers.
Besides improving feed intake and utilization and enhancing protein synthesis, enzymatic hydrolysates are widely recognized for their ability to bolster health conditions by enhancing immune and antioxidant responses, according to a growing number of studies on both fish and poultry [60]. Comparable results were found in the present study with sea cucumber, showing that diets including ECP and EFS could significantly enhance antioxidant defense by increasing the activity of enzymes such as SOD and CAT. Similarly, the elevated expression of antioxidant genes, as observed in organisms supplemented with enzymatic hydrolysates, highlights their capacity to sustain cellular homeostasis under oxidative stress. Moreover, the reduced levels of MDA, a marker of lipid peroxidation and oxidative stress, in organisms fed with hydrolysates further corroborate their roles in protecting cells from reactive oxygen species (ROS) and free radicals. This reduction is crucial for maintaining the structural integrity of membranes and supporting overall cellular function. Meanwhile, enzymatic hydrolysates appeared to upregulate immune-related genes, such as TLRs and NF-κB (p105). The NF-κB signaling pathway plays a core role in innate immunity by regulating the expression of antimicrobial peptides, cytokines, and reactive oxygen and nitrogen species enzymes [61,62]. Consequently, enzymatic hydrolysates increase the activities of AKP, ACP, and LZM, enhancing the resistance of aquatic organisms to microbial and environmental stress [63,64]. The upregulation of genes such as C-type lectins and glutamine synthetase further underscores the immunomodulatory effects of enzymatic hydrolysates. These responses enable the organism to maintain a balanced immune system, reducing inflammation while enhancing resistance to environmental stressors, which is particularly beneficial in aquaculture where fish and invertebrates are exposed to variable conditions.
As far as sea cucumber is concerned, optimal water temperatures, typically ranging from 16 °C to 22 °C, can support optimal growth, feeding activity, and physiological health [65]. In the present experiment, sea cucumbers were cultivated under relatively unfavorable water temperatures, with the maximum water temperature reaching 26 °C. It has been well documented that prolonged exposure to high water temperatures can lead to oxidative stress, protein denaturation, and cellular damage in sea cucumbers [66]. As an adaptive mechanism to protect cells and maintain physiological balance in response to thermal stress, heat shock proteins are prominently upregulated under high-temperature conditions. The upregulated HSPs act as molecular chaperones to stabilize and refold damaged proteins, thereby maintaining homeostasis [67]. Among these, Hsp70 and Hsp90 are two molecules that have been extensively studied [68]. Hsp70, in particular, is highly sensitive to thermal stress and serves as a key marker of an organism’s ability to tolerate unfavorable conditions by supporting immune pathways, such as NF-kB activation, and enhancing antioxidant defenses through enzymes like SOD and CAT [69]. Furthermore, Hsp90 collaborates with Hsp70 to maintain cellular integrity under prolonged heat stress, ensuring that immune cells and vital metabolic processes remain functional. Therefore, the increased expression of HSPs clearly shows that the addition of all types of enzymatically hydrolyzed proteins enhanced the sea cucumbers’ ability to withstand high temperatures and stressful conditions.
Notably, compared with the EFS group, the immune and antioxidant responses of sea cucumbers were significantly enhanced by ECP supplementation, as evidenced by further upregulated gene expressions and increased enzyme activities. This phenomenon has been well demonstrated by numerous studies [70,71]. As noted earlier, the different peptide profiles of enzymatic hydrolysates influence not only the growth-promoting effects but also the health and antioxidant responses. For example, FPH containing peptides with molecular weights ranging from 500 to 3000 Da was reported to stimulate the innate immunity and antioxidant capacity of many fish [72,73,74]. In this study, peptides with molecular weights ranging from 500 to 3000 Da accounted for approximately 31% and 51% of the EFS and ECP, respectively. Accordingly, it seems that the higher percentage of those bioactive peptides probably contributed to the stronger antioxidant and immune responses in the ECP group. Suffice it to say that the beneficial effects and the potential risks associated with enzymatic hydrolysis, particularly the formation of biogenic amines and elevated total volatile basic nitrogen (T-VBN) levels, should not be overlooked [75]. Biogenic amines, byproducts of protein hydrolysis, can accumulate during the enzymatic process and pose health risks when consumed in excess. Herein, we did not intend to establish an in-depth discussion regarding the exact mechanism of how these biogenic amines and elevated total volatile basic nitrogen exert their effects. Indeed, it has been revealed that elevated T-VBN levels, often associated with the breakdown of nitrogenous compounds, can lead to impaired gut health by promoting inflammation, oxidative stress, or disruptions in the gut microbiome [76]. In view of this, it is understandable that the EFS diet exhibited significantly lower levels of bioactive peptides and significantly higher T-VBN and histamine contents compared to the ECP diet, potentially explaining the superior benefits, including antioxidant and immune responses, in sea cucumbers fed ECP [77]. These findings highlight the importance of optimizing enzymatic hydrolysis processes to minimize the formation of harmful byproducts.

5. Conclusions

This study demonstrated that a diet supplemented with 8% ECP significantly enhanced the growth performance and health status of juvenile sea cucumbers (Apostichopus japonicus). Indeed, the results obtained for EFS are noteworthy because this protein source promotes growth and enhances the antioxidant and heat stress responses in sea cucumbers. It is also a novel feed ingredient for sea cucumbers, and it appears to be a good alternative component. The relatively abundant bioactive peptide profile and significantly lower levels of TVBN and biogenic amines in ECP were critical factors contributing to its superior effects in improving growth performance, antioxidant capacity, and immune responses. Additionally, the non-grain characteristic of ECP supports global food security by reducing the dependence on traditional feed resources like fishmeal and soybeans. ECP also promotes environmental sustainability by utilizing underexploited poultry by-products and reducing waste, thus contributing to a circular economy within aquaculture. Future research should investigate the underlying molecular mechanisms of ECP’s benefits to expand its application to other commercially valuable aquatic species.

Author Contributions

Conceptualization, J.C.; Data curation, Q.L., Z.L., D.Z. and B.X.; Formal analysis, Q.L.; Funding acquisition, J.C.; Investigation, Q.L. and Z.L.; Methodology, Z.L., G.Y., D.Z., H.Q., S.L. and B.X.; Resources, S.L. and B.X.; Software, Z.L. and H.Q.; Supervision, J.C.; Validation, G.Y., D.Z. and S.L.; Writing—original draft, Q.L. and Z.L.; Writing—review and editing, Q.L. and J.C. All authors have read and agreed to the published version of the manuscript.

Funding

This project was financially supported by National Key R&D Program of China (2021YFB3901300, 2023YFD2402000); and Shandong Agricultural Technical System (SDAIT-12-05, SDAIT-22-08).

Institutional Review Board Statement

This animal study protocol was approved by the Ethics Committee of Qingdao Agricultural University (protocol code EC-2023-0723, approved on 23 July 2023).

Data Availability Statement

The data supporting the findings of this study are available from the corresponding author upon reasonable request.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Cho, J.H.; Kim, I.H. Fish meal—Nutritive value. J. Anim. Physiol. Anim. Nutr. 2011, 95, 685–692. [Google Scholar] [CrossRef] [PubMed]
  2. Hlordzi, V.; Wang, J.; Kuebutornye, F.K.A.; Yang, X.; Tan, B.; Li, T.; Cui, Z.; Lv, S.; Lao, T.; Chi, S. Hydrolysed fish protein powder is better at the growth performance, hepatopancreas and intestinal development of Pacific white shrimp (Litopenaeus vannamei). Aquac. Rep. 2022, 23, 101025. [Google Scholar] [CrossRef]
  3. Maulu, S.; Langi, S.; Hasimuna, O.J.; Missinhoun, D.; Munganga, B.P.; Hampuwo, B.M.; Gabriel, N.N.; Elsabagh, M.; Van Doan, H.; Abdul Kari, Z.; et al. Recent advances in the utilization of insects as an ingredient in aquafeeds: A review. Anim. Nutr. 2022, 11, 334–349. [Google Scholar] [CrossRef]
  4. Zhou, S.; Smith, A.D.; Knudsen, E.E. Ending overfishing while catching more fish. Fish Fish. 2015, 16, 716–722. [Google Scholar] [CrossRef]
  5. Hussain, S.M.; Bano, A.A.; Ali, S.; Rizwan, M.; Adrees, M.; Zahoor, A.F.; Sarker, P.K.; Hussain, M.; Arsalan, M.Z.-u.-H.; Yong, J.W.H.; et al. Substitution of fishmeal: Highlights of potential plant protein sources for aquaculture sustainability. Heliyon 2024, 10, e26573. [Google Scholar] [CrossRef]
  6. da Silva, R.F.B.; Viña, A.; Moran, E.F.; Dou, Y.; Batistella, M.; Liu, J. Socioeconomic and environmental effects of soybean production in metacoupled systems. Sci. Rep. 2021, 11, 18662. [Google Scholar] [CrossRef]
  7. Zhang, G.-G.; Li, X.; Cai, X.-B.; Zhang, S.-X.; Hua, X.-M.; Huang, Z.-Y.; Li, N.-Y.; Yao, J.-T. Effects of Enzymatic Hydrolyzed Soybean Meal on Growth Performance, Liver Function and Metabolism of Largemouth Bass (Micropterus salmoides). Acta Hydrobiol. Sin. 2019, 43, 1001–1012. [Google Scholar] [CrossRef]
  8. Zhang, X.; Li, X.; Liu, S.-Q. Enzymatic hydrolysis of minced chicken carcasses for protein hydrolysate production. Poult. Sci. 2023, 102, 102791. [Google Scholar] [CrossRef]
  9. Five, K.K.; Fålun, I.; Roland, G.J.; Forshaug, D.; Helgeland-Rossavik, M.-K.; Hals, R.; Sandbakken, I.S.; Rustad, T. Enzymatic hydrolysis of chicken viscera and bones: Rest raw material characterization and evaluation of industrially relevant process parameters on product yields. Process Biochem. 2024, 146, 68–80. [Google Scholar] [CrossRef]
  10. Lasekan, A.; Abu Bakar, F.; Hashim, D. Potential of chicken by-products as sources of useful biological resources. Waste Manag. 2013, 33, 552–565. [Google Scholar] [CrossRef]
  11. Shi, Y.; Zhong, L.; Ma, X.; Liu, Y.; Tang, T.; Hu, Y. Effect of replacing fishmeal with stickwater hydrolysate on the growth, serum biochemical indexes, immune indexes, intestinal histology and microbiota of rice field eel (Monopterus albus). Aquac. Rep. 2019, 15, 100223. [Google Scholar] [CrossRef]
  12. Bui, H.T.D.; Khosravi, S.; Fournier, V.; Herault, M.; Lee, K.-J. Growth performance, feed utilization, innate immunity, digestibility and disease resistance of juvenile red seabream (Pagrus major) fed diets supplemented with protein hydrolysates. Aquaculture 2014, 418–419, 11–16. [Google Scholar] [CrossRef]
  13. Seidavi, A.R.; Zaker-Esteghamati, H.; Scanes, C.G. Present and potential impacts of waste from poultry production on the environment. World’s Poul. Sci. J. 2019, 75, 29–42. [Google Scholar] [CrossRef]
  14. Cruz-Casas, D.E.; Aguilar, C.N.; Ascacio-Valdés, J.A.; Rodríguez-Herrera, R.; Chávez-González, M.L.; Flores-Gallegos, A.C. Enzymatic hydrolysis and microbial fermentation: The most favorable biotechnological methods for the release of bioactive peptides. Food Chem. Mol. Sci. 2021, 3, 100047. [Google Scholar] [CrossRef]
  15. Tonheim, S.K.; Espe, M.; Hamre, K.; Rønnestad, I. Pre-hydrolysis improves utilisation of dietary protein in the larval teleost Atlantic halibut (Hippoglossus hippoglossus L.). J. Exp. Mar. Biol. Ecol. 2005, 321, 19–34. [Google Scholar] [CrossRef]
  16. Liou, S.-T.; Wang, C. Small glutamine-rich tetratricopeptide repeat-containing protein is composed of three structural units with distinct functions. Arch. Biochem. Biophys. 2005, 435, 253–263. [Google Scholar] [CrossRef]
  17. Srichanun, M.; Tantikitti, C.; Kortner, T.M.; Krogdahl, Å.; Chotikachinda, R. Effects of different protein hydrolysate products and levels on growth, survival rate and digestive capacity in Asian seabass (Lates calcarifer Bloch) larvae. Aquaculture 2014, 428–429, 195–202. [Google Scholar] [CrossRef]
  18. Cheng, H.-H.; Jiang, G.-Z.; Zheng, X.-C.; Xu, C.-Y.; Sun, C.-X.; Zhang, D.-D.; Liu, W.-B. Effects of five attractants on Chinese mitten crab, Eriocheir sinensis. Acta Hydrobiol. Sin. 2019, 43, 395–401. [Google Scholar] [CrossRef]
  19. Delcroix, J.; Gatesoupe, F.-J.; Desbruyères, E.; Huelvan, C.; Le Delliou, H.; Le Gall, M.-M.; Quazuguel, P.; Mazurais, D.; Zambonino-Infante, J.L. The effects of dietary marine protein hydrolysates on the development of sea bass larvae, Dicentrarchus labrax, and associated microbiota. Aquac. Nutr. 2015, 21, 98–104. [Google Scholar] [CrossRef]
  20. Zheng, K.; Liang, M.; Yao, H.; Wang, J.; Chang, Q. Effect of dietary fish protein hydrolysate on growth, feed utilization and IGF-I levels of Japanese flounder (Paralichthys olivaceus). Aquac. Nutr. 2012, 18, 297–303. [Google Scholar] [CrossRef]
  21. Hao, Y.-T.; Guo, R.; Jia, G.-W.; Zhang, Y.; Xia, H.; Li, X.-H. Effects of enzymatic hydrolysates from poultry by-products (EHPB) as an alternative source of fish meal on growth performance, hepatic proteome and gut microbiota of turbot (Scophthalmus maximus). Aquac. Nutr. 2020, 26, 1994–2006. [Google Scholar] [CrossRef]
  22. Chen, J.; Yang, F.; Cheng, T.; Yi, J.; Yang, Z.; Li, Z.; Tan, B.; Chi, S. Glutathione-rich yeast hydrolysate makes the contributions to growth performance, healthy of Pacific white shrimp (Litopenaeus vannamei), and helps shrimp resist nitrite stress. Aquac. Rep. 2023, 33, 101825. [Google Scholar] [CrossRef]
  23. Li, W.; Zhao, X.; Zhang, Y.; Song, W.; Zeng, L.; Zhang, H.; Zhao, X. Effects of Small Peptides on the Growth and Intestinal Development of Large Yellow Croaker Larvae and Their Antioxidant Stress Response under Low Temperature Stress. Anim. Nutr. 2021, 33, 572–583. [Google Scholar] [CrossRef]
  24. Wang, J. Application of Enzymatic Hydrolyzed Chicken Paste and Soy Protein Concentrate in Feed for Pearl Grouper (Epinephelus lanceolatus). Master’s Thesis, Guangdong Ocean University, Zhanjiang, China, 2020. [Google Scholar] [CrossRef]
  25. Vafidis, D.; Antoniadou, C. Holothurian Fisheries in the Hellenic Seas: Seeking for Sustainability. Sustainability 2023, 15, 9799. [Google Scholar] [CrossRef]
  26. Boziaris, I.S.; Anagnostopoulos, D.A.; Parlapani, F.F.; Syropoulou, F.; Martsikalis, P.V.; Apostologamvrou, C.; Kokioumi, D.; Vafidis, D. Microbial and Physicochemical Status of Raw and Processed Sea Cucumbers from the Hellenic Seawaters. Sustainability 2023, 15, 13467. [Google Scholar] [CrossRef]
  27. Karapanagiotidis, I.T.; Gkalogianni, E.Z.; Apostologamvrou, C.; Voulgaris, K.; Varkoulis, A.; Vafidis, D. Proximate Compositions and Fatty Acid Profiles of Raw and Processed Holothuria polii and Holothuria tubulosa from the Aegean Sea. Sustainability 2024, 16, 6048. [Google Scholar] [CrossRef]
  28. Ru, X.; Zhang, L.; Li, X.; Liu, S.; Yang, H. Development Strategies for the Sea Cucumber Industry in China. J. Oceanol. Limnol. 2019, 37, 300–312. [Google Scholar] [CrossRef]
  29. Ministry of Agriculture and Rural Affairs of the People’s Republic of China. China Fisheries Statistical Yearbook; China Agriculture Press: Beijing, China, 2023.
  30. Bai, Y.; Zhang, L.; Xia, S.; Liu, S.; Ru, X.; Xu, Q.; Zhang, T.; Yang, H. Effects of dietary protein levels on the growth, energy budget, and physiological and immunological performance of green, white and purple color morphs of sea cucumber, Apostichopus japonicus. Aquaculture 2016, 450, 375–382. [Google Scholar] [CrossRef]
  31. Zhang, Z.; Chi, Y.; Du, Y.; Li, F.; Ma, N.; Qin, S. Effects of kelp phlorotannins on the growth, immunity, intestinal health and disease resistance against Vibrio splendidus of sea cucumber Apostichopus japonicus. Aquac. Rep. 2025, 40, 102614. [Google Scholar] [CrossRef]
  32. Chen, J.; Ren, Y.; Wang, G.; Xia, B.; Li, Y. Dietary supplementation of biofloc influences growth performance, physiological stress, antioxidant status and immune response of juvenile sea cucumber Apostichopus japonicus (Selenka). Fish Shellfish Immunol. 2018, 72, 143–152. [Google Scholar] [CrossRef]
  33. Dou, H.; Wu, S. Dietary fulvic acid supplementation improves the growth performance and immune response of sea cucumber (Apostichopus japonicus). Fish Shellfish Immunol. 2023, 135, 108662. [Google Scholar] [CrossRef] [PubMed]
  34. Nogales-Mérida, S.; Gobbi, P.; Józefiak, D.; Mazurkiewicz, J.; Dudek, K.; Rawski, M.; Kierończyk, B.; Józefiak, A. Insect meals in fish nutrition. Rev. Aquac. 2019, 11, 1080–1103. [Google Scholar] [CrossRef]
  35. Chen, J.; Liu, P.; Li, Y.; Li, M.; Xia, B. Effects of dietary biofloc on growth, digestibility, protein turnover and energy budget of sea cucumber Apostichopus japonicus (Selenka). Anim. Feed Sci. Technol. 2018, 241, 151–162. [Google Scholar] [CrossRef]
  36. Xia, B.; Wang, J.; Gao, Q.-F.; Sun, Y.; Zhang, L.; Ma, J.; Liu, X. The nutritional contributions of dietary protein sources to tissue growth and metabolism of sea cucumber Apostichopus japonicus (Selenka): Evidence from nitrogen stable isotope analysis. Aquaculture 2015, 435, 237–244. [Google Scholar] [CrossRef]
  37. Official Methods of Analysis of AOAC International; Oxford University Press: Oxford, UK, 2023. [CrossRef]
  38. Chen, J.; Sui, C.; Hu, Y.; Qin, H.; Zhang, D.; Wei, J.; Cao, B.; Li, Q. Effects of dietary phospholipids on growth performance, antioxidant capacity, and lipid metabolism of juvenile Chinese sturgeon (Acipenser sinensis), a critically endangered sturgeon in the Yangtze River. Aqua. Rep. 2024, 39, 102366. [Google Scholar] [CrossRef]
  39. Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
  40. Sibilla, S.; Godfrey, M.; Brewer, S.; Budh-Raja, A.; Genovese, L. An Overview of the Beneficial Effects of Hydrolysed Collagen as a Nutraceutical on Skin Properties: Scientific Background and Clinical Studies. Open Nutraceuticals J. 2015, 8, 29–42. [Google Scholar] [CrossRef]
  41. Kim, S.-K.; Takeuchi, T.; Yokoyama, M.; Murata, Y.; Kaneniwa, M.; Sakakura, Y. Effect of dietary taurine levels on growth and feeding behavior of juvenile Japanese flounder Paralichthys olivaceus. Aquaculture 2005, 250, 765–774. [Google Scholar] [CrossRef]
  42. Omura, Y.; Inagaki, M. Immunocytochemical localization of taurine in the fish retina under light and dark adaptations. Amino Acids 2000, 19, 593–604. [Google Scholar] [CrossRef]
  43. Wu, J.; Liu, W.; Wen, H.; Zhou, Y.; Wu, J. Animal by-products with or without enzymatic hydrolysis completely replacement of fish meal in genetically improved farmed tilapia diets (Oreochromis niloticus). Aquac. Res. 2021, 52, 291–301. [Google Scholar] [CrossRef]
  44. Hlordzi, V.; Tan, B.; Dong, X.; Zhang, S.; Zhu, L.; Zhang, L.; Hu, X.; Chi, S. Enzymatic Chicken Pulp Promotes Appetite, Digestive Enzyme Activity, and Growth in Litopenaeus vannamei. Metabolites 2022, 12, 698. [Google Scholar] [CrossRef] [PubMed]
  45. Li, M.; Wang, A.; Lin, X.; Miao, H.; Liu, X.; Xu, J.; Ma, X.; Wu, Y.; Dong, X.; Ge, J.; et al. Effects of dietary trimetlylamine oxide on the growth performance, feed utilization and appetite regulation of Chinese mitten crab (Eriocheir sinensis). Aquaculture 2023, 575, 739754. [Google Scholar] [CrossRef]
  46. Shamushaki, V.A.J.; Kasumyan, A.O.; Abedian, A.; Abtahi, B. Behavioural responses of the Persian sturgeon (Acipenser persicus) juveniles to free amino acid solutions. Mar. Freshw. Behav. Physiol. 2007, 40, 219–224. [Google Scholar] [CrossRef]
  47. Carr, W.E.S.; Netherton, J.C., III; Gleeson, R.A.; Derby, C.D. Stimulants of feeding behavior in fish: Analyses of tissues of diverse marine organisms. Biol. Bull. 1996, 190, 149–160. [Google Scholar] [CrossRef]
  48. Khosravi, S.; Rahimnejad, S.; Herault, M.; Fournier, V.; Lee, C.-R.; Dio Bui, H.T.; Jeong, J.-B.; Lee, K.-J. Effects of protein hydrolysates supplementation in low fish meal diets on growth performance, innate immunity and disease resistance of red sea bream Pagrus major. Fish Shellfish Immunol. 2015, 45, 858–868. [Google Scholar] [CrossRef]
  49. Khosravi, S.; Bui, H.T.D.; Rahimnejad, S.; Herault, M.; Fournier, V.; Kim, S.-S.; Jeong, J.-B.; Lee, K.-J. Dietary supplementation of marine protein hydrolysates in fish-meal based diets for red sea bream (Pagrus major) and olive flounder (Paralichthys olivaceus). Aquaculture 2015, 435, 371–376. [Google Scholar] [CrossRef]
  50. Wei, Y.; Liu, J.; Wang, L.; Duan, M.; Ma, Q.; Xu, H.; Liang, M. Influence of fish protein hydrolysate on intestinal health and microbial communities in turbot Scophthalmus maximus. Aquaculture 2023, 576, 739827. [Google Scholar] [CrossRef]
  51. Siddik, M.A.B.; Howieson, J.; Ilham, I.; Fotedar, R. Growth, biochemical response and liver health of juvenile barramundi (Lates calcarifer) fed fermented and non-fermented tuna hydrolysate as fishmeal protein replacement ingredients. PeerJ 2018, 6, e4870. [Google Scholar] [CrossRef]
  52. Abdullah-Zawawi, M.-R.; Afiqah-Aleng, N.; Ikhwanuddin, M.; Sung, Y.Y.; Tola, S.; Fazhan, H.; Waiho, K. Recent development in ecdysone receptor of crustaceans: Current knowledge and future applications in crustacean aquaculture. Rev. Aquac. 2021, 13, 1938–1957. [Google Scholar] [CrossRef]
  53. Kim, A.L.; Raffo, A.J.; Brandt-Rauf, P.W.; Pincus, M.R.; Monaco, R.; Abarzua, P.; Fine, R.L. Conformational and molecular basis for induction of apoptosis by a p53 C-terminal peptide in human cancer cells. J. Biol. Chem. 1999, 274, 34924–34931. [Google Scholar] [CrossRef]
  54. Hevrøy, E.M.; Espe, M.; Waagbø, R.; Sandnes, K.; Ruud, M.; Hemre, G.-I. Nutrient utilization in Atlantic salmon (Salmo salar L.) fed increased levels of fish protein hydrolysate during a period of fast growth. Aqua. Nutr. 2005, 11, 301–313. [Google Scholar] [CrossRef]
  55. Zhou, X.; Ding, Y.; Yang, C.; Li, C.; Su, Z.; Xu, J.; Qu, C.; Shi, Y.; Kang, X. FHL3 gene regulates bovine skeletal muscle cell growth through the PI3K/Akt/mTOR signaling pathway. Comp. Biochem. Physiol. Part D Genom. Proteom. 2024, 52, 101356. [Google Scholar] [CrossRef] [PubMed]
  56. Lv, Z.; Yue, Z.; Shao, Y.; Li, C.; Zhao, X.; Guo, M. mTORC2/Rictor Is Essential for Coelomocyte Endocytosis in Apostichopus japonicus. Dev. Comp. Immunol. 2021, 118, 104000. [Google Scholar] [CrossRef] [PubMed]
  57. Sun, J.H.; Song, S.; Yang, J.F. Oral administration of sea cucumber (Stichopus japonicus) protein exerts wound healing effects via the PI3K/AKT/mTOR signaling pathway. Food. Funct. 2022, 13, 9796–9809. [Google Scholar] [CrossRef]
  58. Kousoulaki, K.; Olsen, H.J.; Albrektsen, S.; Langmyhr, E.; Mjøs, S.A.; Campbell, P.; Aksnes, A. High growth rates in Atlantic salmon (Salmo salar L.) fed 7.5% fish meal in the diet. Micro-, ultra- and nano-filtration of stickwater and effects of different fractions and compounds on pellet quality and fish performance. Aquaculture 2012, 338–341, 134–146. [Google Scholar] [CrossRef]
  59. Cudennec, B.; Fouchereau-Peron, M.; Ferry, F.; Duclos, E.; Ravallec, R. In vitro and in vivo evidence for a satiating effect of fish protein hydrolysate obtained from blue whiting (Micromesistius poutassou) muscle. J. Funct. Foods 2012, 4, 271–277. [Google Scholar] [CrossRef]
  60. Li, X.; Wei, X.; Guo, X.; Mi, S.; Hua, X.; Li, N.; Yao, J. Enhanced growth performance, muscle quality and liver health of largemouth bass (Micropterus salmoides) were related to dietary small peptides supplementation. Aquac. Nutr. 2020, 26, 2169–2177. [Google Scholar] [CrossRef]
  61. Tullio, V.; Spaccapelo, R.; Polimeni, M. Lysozymes in the Animal Kingdom. In Human and Mosquito Lysozymes; Springer: Cham, Switzerland, 2015. [Google Scholar] [CrossRef]
  62. Frosali, S.; Pagliari, D.; Gambassi, G.; Landolfi, R.; Pandolfi, F.; Cianci, R. How the intricate interaction among Toll-like receptors, microbiota, and intestinal immunity can influence gastrointestinal pathology. J. Immunol. Res. 2015, 489821, 12. [Google Scholar] [CrossRef]
  63. Zhang, R.-Q.; Chen, Q.-X.; Zheng, W.-Z.; Lin, J.-Y.; Zhuang, Z.-L.; Zhou, H.-M. Inhibition kinetics of green crab (Scylla serrata) alkaline phosphatase activity by dithiothreitol or 2-mercaptoethanol. Int. J. Biochem. Cell Biol. 2000, 32, 865–872. [Google Scholar] [CrossRef]
  64. Cheng, T.C. The Role of Lysosomal Hydrolases in Molluscan Cellular Response to Immunologic Challenge. In Invertebrate Models for Biomedical Research; Bulla, L.A., Cheng, T.C., Eds.; Springer: Boston, MA, USA, 1978; pp. 59–71. [Google Scholar] [CrossRef]
  65. Abyaba, H.; Pasquini, V.; Ennas, C.; Addis, P.; Pusceddu, A. Organic matter ingestion and assimilation rates by the sea cucumber Holothuria (Holothuria) tubulosa (Gmelin, 1788) at different temperatures and potential effects on benthic trophic status. Mar. Environ. Res. 2025, 203, 106830. [Google Scholar] [CrossRef]
  66. Xu, D.; Sun, L.; Liu, S.; Zhang, L.; Yang, H. Polymorphisms of heat shock protein 90 (Hsp90) in the sea cucumber Apostichopus japonicus and their association with heat-resistance. Fish Shellfish Immunol. 2014, 41, 428–436. [Google Scholar] [CrossRef] [PubMed]
  67. Liu, J.; Xu, D.; Chen, Y.; Zhao, C.; Liu, L.; Gu, Y.; Ren, Y.; Xia, B. Adverse effects of dietary virgin (nano)microplastics on growth performance, immune response, and resistance to ammonia stress and pathogen challenge in juvenile sea cucumber Apostichopus japonicus (Selenka). J. Hazard. Mater. 2022, 423, 127038. [Google Scholar] [CrossRef] [PubMed]
  68. Tower, J. Hsps and aging. Trends Endocrinol. Metab. 2009, 20, 216–222. [Google Scholar] [CrossRef]
  69. Lyu, Q.K.; Wawrzyniuk, M.; Rutten, V.P.M.G.; van Eden, W.; Sijts, A.J.A.M.; Broere, F. Hsp70 and NF-kB Mediated Control of Innate Inflammatory Responses in a Canine Macrophage Cell Line. Int. J. Mol. Sci. 2020, 21, 6464. [Google Scholar] [CrossRef]
  70. dos Santos Aguilar, J.G.; de Souza, A.K.S.; de Castro, R.J.S. Enzymatic Hydrolysis of Chicken Viscera to Obtain Added-Value Protein Hydrolysates with Antioxidant and Antihypertensive Properties. Int. J. Pept. Res. Ther. 2020, 26, 717–725. [Google Scholar] [CrossRef]
  71. Zhuang, Y.; Zhang, W.; Zheng, J.; Tang, Z.; Li, X.; Cao, X.; Zhang, L.; Xu, W.; Mai, K.; Ai, Q. Effects of enzymatic hydrolysis chicken by-product in high plant-based protein diet on growth performance, digestive capacity, antioxidant capacity and non-specific immunity of juvenile turbot (Scophthalmus maximus L.). Aquac. Nutr. 2021, 27, 1578–1589. [Google Scholar] [CrossRef]
  72. BØGwald, J.; Dalmo, R.O.Y.; McQueen Leifson, R.; Stenberg, E.; Gildberg, A. The stimulatory effect of a muscle protein hydrolysate from Atlantic cod, Gadus morhua L., on Atlantic salmon, Salmo salar L., head kidney leucocytes. Fish Shellfish Immunol. 1996, 6, 3–16. [Google Scholar] [CrossRef]
  73. Gildberg, A.; Bøgwald, J.; Johansen, A.; Stenberg, E. Isolation of acid peptide fractions from a fish protein hydrolysate with strong stimulatory effect on atlantic salmon (Salmo salar) head kidney leucocytes. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 1996, 114, 97–101. [Google Scholar] [CrossRef]
  74. Leduc, A.; Hervy, M.; Rangama, J.; Delépée, R.; Fournier, V.; Henry, J. Shrimp by-product hydrolysate induces intestinal myotropic activity in European seabass (Dicentrarchus labrax). Aquaculture 2018, 497, 380–388. [Google Scholar] [CrossRef]
  75. Feddern, V.; Mazzuco, H.; Fonseca, F.N.; de Lima, G.J.M.M. A review on biogenic amines in food and feed: Toxicological aspects, impact on health and control measures. Anim. Prod. Sci. 2019, 59, 308–318. [Google Scholar] [CrossRef]
  76. Tapia-Salazar, M.; Cruz-Suárez, L.E.; Ricque-Marie, D.; Pike, I.H.; Smith, T.K.; Harris, A.; Nygård, E.; Opstvedt, J. Effect of fishmeal made from stale versus fresh herring and of added crystalline biogenic amines on growth and survival of blue shrimp Litopenaeus stylirostris fed practical diets. Aquaculture 2004, 242, 437–453. [Google Scholar] [CrossRef]
  77. Wu, D.; Zhou, L.; Gao, M.; Wang, M.; Wang, B.; He, J.; Luo, Q.; Ye, Y.; Cai, C.; Wu, P. Effects of stickwater hydrolysates on growth performance for yellow catfish (Pelteobagrus fulvidraco). Aquaculture 2018, 488, 161–173. [Google Scholar] [CrossRef]
Figure 1. Activities of digestive enzymes in intestine of A. japonicus fed diets containing various levels of different enzymatic hydrolysates. Data are presented as the mean ± SD (n = 3); bars with different letters indicate significant differences between the treatments (p < 0.05).
Figure 1. Activities of digestive enzymes in intestine of A. japonicus fed diets containing various levels of different enzymatic hydrolysates. Data are presented as the mean ± SD (n = 3); bars with different letters indicate significant differences between the treatments (p < 0.05).
Fishes 10 00042 g001
Figure 2. Activities of immune and antioxidant enzymes in intestine of sea cucumbers fed diets supplemented with different enzymatic hydrolysates: (a) acid phosphatase (ACP), (b) alkaline phosphatase (AKP), (c) superoxide dismutase (SOD), (d) catalase (CAT), (e) lysozyme (LZM), and (f) malondialdehyde (MDA) content of A. japonicus. Data are presented as the mean ± SD (n = 3). Bars with different letters mean significant differences between diet treatments (p < 0.05).
Figure 2. Activities of immune and antioxidant enzymes in intestine of sea cucumbers fed diets supplemented with different enzymatic hydrolysates: (a) acid phosphatase (ACP), (b) alkaline phosphatase (AKP), (c) superoxide dismutase (SOD), (d) catalase (CAT), (e) lysozyme (LZM), and (f) malondialdehyde (MDA) content of A. japonicus. Data are presented as the mean ± SD (n = 3). Bars with different letters mean significant differences between diet treatments (p < 0.05).
Fishes 10 00042 g002aFishes 10 00042 g002b
Figure 3. Gene expression in the intestines of sea cucumbers fed diets containing different levels of enzymatically hydrolyzed proteins: (a) SOD: superoxide dismutase, CAT: catalase, LZM: lysozyme, TOR: mammalian target of rapamycin; (b) GS: glutamine synthetase, CL: C-type lectin, TLR: Toll-like receptor, p105: NF-kB factor p105; (c) Hsp90: heat shock protein 90, Hsp70: heat shock protein 70. Data are presented as the mean ± SD (n = 3); bars with different letters indicate significant differences between the treatments (p < 0.05).
Figure 3. Gene expression in the intestines of sea cucumbers fed diets containing different levels of enzymatically hydrolyzed proteins: (a) SOD: superoxide dismutase, CAT: catalase, LZM: lysozyme, TOR: mammalian target of rapamycin; (b) GS: glutamine synthetase, CL: C-type lectin, TLR: Toll-like receptor, p105: NF-kB factor p105; (c) Hsp90: heat shock protein 90, Hsp70: heat shock protein 70. Data are presented as the mean ± SD (n = 3); bars with different letters indicate significant differences between the treatments (p < 0.05).
Fishes 10 00042 g003aFishes 10 00042 g003b
Table 1. Experimental diet formulations and proximate compositions (dry matter, %).
Table 1. Experimental diet formulations and proximate compositions (dry matter, %).
Ingredient (%)Diet
ControlEFSECP
Fishmeal10.008.008.00
Soybean meal5.0000
Corn meal10.009.009.00
Starch3.003.003.00
Mixed seaweed meal *70.0070.0070.00
EFS 8.00 
ECP  8.00
Mineral premix **0.500.500.50
Vitamin premix ***0.500.500.50
Ca(H2PO4)21.001.001.00
Proximate Chemical Composition
Moisture8.208.128.19
Crude protein15.615.1915.29
Crude lipid 2.012.352.50
Ash23.4824.0624.23
* The mixed seaweed meal was a mixture of Sargassum polycystum, Laminaria japonica, Ulva lactuca, and Enteromorpha prolifera at a ratio of 2:1:1:1. ** Mineral premix (mg kg−1 diet): FeSO4·H2O, 120.0; ZnSO4·7H2O, 90; MnSO4·H2O, 60; CuSO4·5H2O, 7.5; Ca(IO3)2, 0.4; CoCl2·6H2O, 1.0; Na2SeO3, 0.25. *** Vitamin premix (mg kg−1 diet): l-ascorbic acid, 300.0; DL-α-tocopherol acetate, 210.0; thiamin hydrochloride, 60.0; riboflavin, 80.0; pyridoxine hydrochloride, 50.0; niacin, 40.0; myo-inositol, 200.0; D-biotin, 3.0; folic acid, 15.0; calcium pantothenate, 53.7; menadione, 40.0; retinyl acetate, 15.0; cholecalciferol, 2.5; cyanocobalamin, 0.05.
Table 2. Nutritional specifications of enzymatic fish stickwater and enzymatic chicken pulp.
Table 2. Nutritional specifications of enzymatic fish stickwater and enzymatic chicken pulp.
ComponentEFSECP
Proximate composition of enzymatic hydrolysates, % Wet Weight
Moisture50.3248.96
Protein37.7234.22
Lipid1.384.26
Ash10.3212.31
Acid-soluble protein62.5256.23
T-VBN (mg/100 g)445.43133.73
Histamine (mg/kg)98564.7
Percentage of peptides with different molecular weights in hydrolysates, % Protein
<200 Da45.2618.68
200–500 Da11.0024.89
500–1000 Da18.8927.61
1000–2000 Da9.7720.10
2000–3000 Da6.284.18
>3000 Da8.804.55
Amino acid composition of hydrolysates, % wet weight
Arg1.311.68
His0.580.73
Ile0.610.97
Leu1.251.86
Lys1.471.91
Met0.500.58
Phe0.730.99
Thr0.701.05
Val0.911.15
Ala2.472.21
Asp2.062.42
Cys0.290.27
Glu3.623.93
Gly4.533.28
Pro4.753.98
Ser0.841.03
Tyr0.390.77
Table 3. Primers for real-time qPCR analysis.
Table 3. Primers for real-time qPCR analysis.
Genes Primer Sequences 5′-3′Annealing Temp. (°C)EfficiencyAccession Number
β-actinF: GTCACAAACTGGGATGATATGGAG59.180.92AB510191
 R: TTGGCTTTAGGGTTGAGTGGA   
LZMF: TTGGTCCGCCGTTGTGT59.431.02EF036468
 R: CTGGATGGAGATTGGCAGAAA   
SODF: CGATGATAATGGTGTGGCTAGTGT60.741.02JX097096
 R: TAAATCGTCAACCCCTTCGTG   
CATF: GCTGGTGCATTTGGTTACTTTG58.940.97JQ776634
 R: AGTGGTGTTTTCTTGCCGATTT   
GSF: CAACCCACGGAAAAAGTTACCTG60.240.98KJ839835
 R: TTGCTGTCTGTTTAGTGTCTGGG   
p105F: CAACACACCCCTCCATCTT56.941.01JF828766
 R: TCTTCTTCGCTAACGTCACACC   
CLF: CCTGGTTGGGGTATGTCTGT59.011.05HQ728281
 R: AGTGTCCGGTAGCTAAGTCG   
Hsp90F: GGAGGAGCGAACAAACCAAG59.120.98HO054976
 R: GTCAAATGGCGCCCTCTTAG   
Hsp70F: GCCGCATCCCTTGTAAGAAG58.980.92EU930813
 R: AGTTCAAATTGACCGAGGCG   
TLRF: TGCAGCTCTCCATCAGTTCA59.020.97KC708868
 R: CAACTTCCCTGGCCTTTTCC   
TORF: CCAAGAGACAGAAGACAGTG55.431.02MH807454
 R: CATCGGTTCCAAGAGTTCCT   
Note: SOD: superoxide dismutase; CAT: catalase; LZM: lysozyme; p105: NF-kB factor p105; GS: glutamine synthetase; CL: C-type lectin; TLR: Toll-like receptor; Hsp90: heat shock protein 90; Hsp70: heat shock protein 70; TOR: target of rapamycin; β-actin: beta actin. F: forward primer; R: reverse primer.
Table 4. Effects of enzymatic hydrolysate protein on growth performance and feed utilization of A. japonicus.
Table 4. Effects of enzymatic hydrolysate protein on growth performance and feed utilization of A. japonicus.
ParameterDiet
ControlEFSECP
IW (g)0.25 ± 0.010.25 ± 0.010.25 ± 0.01
FW (g)0.93 ± 0.03 a1.25 ± 0.07 b1.31 ± 0.04 b
SR (%)61.21 ± 5.4163.79 ± 5.7661.51± 6.45
FI (g)1.58 ± 0.05 a1.82 ± 0.10 b1.93 ± 0.06 b
SGR (%/day)1.56 ± 0.04 a1.91 ± 0.09 b1.97 ± 0.08 b
RNA/DNA ratio1.00 ± 0.27 a1.58 ± 0.02 b1.74 ± 0.14 b
Note: Values are presented as the mean ± SD (n = 3). Different superscript letters within the same row denote significant differences (p < 0.05). IW: initial weight; FW: final weight; SR: survival rate; FI: feed intake; SGR: specific growth rate.
Table 5. Body composition (%) of A. japonicus fed different experimental diets.
Table 5. Body composition (%) of A. japonicus fed different experimental diets.
ParameterDiet
ControlEFSECP
Moisture92.35 ± 0.1892.23 ± 0.4592.18 ± 0.84
Crude protein3.34 ± 0.25 a4.01 ± 0.13 b4.26 ± 0.1 b
Crude lipid0.38 ± 0.080.30 ± 0.060.28 ± 0.03
Ash2.77 ± 0.352.15 ± 0.262.28 ± 0.37
Note: Values are presented as the mean ± SD (n = 3). Different superscript letters within the same row denote significant differences (p < 0.05).
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Li, Q.; Liu, Z.; Yang, G.; Zhang, D.; Qin, H.; Xia, B.; Liu, S.; Chen, J. Supplementation of Enzymatic Hydrolysate in Low-Fishmeal and Low-Crop Diet Improves Growth, Antioxidant Capacity, and Immunity of Juvenile Sea Cucumber Apostichopus japonicus (Selenka). Fishes 2025, 10, 42. https://doi.org/10.3390/fishes10020042

AMA Style

Li Q, Liu Z, Yang G, Zhang D, Qin H, Xia B, Liu S, Chen J. Supplementation of Enzymatic Hydrolysate in Low-Fishmeal and Low-Crop Diet Improves Growth, Antioxidant Capacity, and Immunity of Juvenile Sea Cucumber Apostichopus japonicus (Selenka). Fishes. 2025; 10(2):42. https://doi.org/10.3390/fishes10020042

Chicago/Turabian Style

Li, Qingfei, Zhengyong Liu, Gang Yang, Danyang Zhang, Huimin Qin, Bin Xia, Shilin Liu, and Jinghua Chen. 2025. "Supplementation of Enzymatic Hydrolysate in Low-Fishmeal and Low-Crop Diet Improves Growth, Antioxidant Capacity, and Immunity of Juvenile Sea Cucumber Apostichopus japonicus (Selenka)" Fishes 10, no. 2: 42. https://doi.org/10.3390/fishes10020042

APA Style

Li, Q., Liu, Z., Yang, G., Zhang, D., Qin, H., Xia, B., Liu, S., & Chen, J. (2025). Supplementation of Enzymatic Hydrolysate in Low-Fishmeal and Low-Crop Diet Improves Growth, Antioxidant Capacity, and Immunity of Juvenile Sea Cucumber Apostichopus japonicus (Selenka). Fishes, 10(2), 42. https://doi.org/10.3390/fishes10020042

Article Metrics

Back to TopTop