Antiviral Effect and Metabolic Regularity of a Phenylpropanoid- Based Compound as Potential Immunopotentiator
Abstract
:1. Introduction
2. Materials and Methods
2.1. Fish, Cells, and Virus
2.2. In Vitro Inhibition
2.3. Horizontal Transmission
2.4. In Vivo Inhibition
2.5. RNA Extraction
2.6. Histopathology
2.7. High-Performance Liquid Chromatography (HPLC)
2.8. Statistical Analysis
3. Results
3.1. Anti-Apoptotic Effect of N6 on SVCV-Infected Cells
3.2. N6 Reduced Horizontal Transmission of SVCV
3.3. Antiviral Responses of Common Carp Under N6-Treatment
3.4. Histopathology
3.5. Metabolism of N6
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- FAO. The State of World Fisheries and Aquaculture; FAO: Rome, Italy, 2024. [Google Scholar]
- Toranzo, A.E.; Magariños, B.; Romalde, J.L. A review of the main bacterial fish diseases in mariculture systems. Aquaculture 2005, 246, 37–61. [Google Scholar] [CrossRef]
- Crane, M.; Hyatt, A. Viruses of fish: An overview of significant pathogens. Viruses 2011, 3, 2025–2046. [Google Scholar] [CrossRef]
- Alvarez-Pellitero, P. Fish immunity and parasite infections: From innate immunity to immunoprophylactic prospects. Vet. Immunol. Immunop. 2008, 126, 171–198. [Google Scholar] [CrossRef] [PubMed]
- Baudouy, A.; Danton, M.; Merle, G. SVCV infection of Carp (author’s transl). Ann. Rech. Vet. 1980, 11, 245–249. [Google Scholar]
- OIE. Aquatic Animal Health Code, Chapter 1.3. Diseases Listed by the OIE. 2024. Available online: https://www.woah.org/en/what-we-do/standards/codes-and-manuals/aquatic-code-online-access/?id=169&L=1&htmfile=chapitre_diseases_listed.htm (accessed on 20 December 2024).
- Veselý, T.; Pokorová, D.; Reschová, S.; Piačková, V. Experimental infection of common carp (Cyprinus carpio) with spring viremia of carp virus. In Proceedings of the Ninth International Symposium on Viruses of Lower Vertebrates, Malaga, Spain, 1–4 October 2014; pp. 213–214. [Google Scholar]
- Emmenegger, E.J.; Sanders, G.E.; Conway, C.M.; Binkowski, F.P.; Winton, J.R.; Kurath, G. Experimental infection of six North American fish species with the North Carolina strain of spring viremia of carp virus. Aquaculture 2016, 450, 273–282. [Google Scholar] [CrossRef]
- Teng, Y.; Liu, H.; Lv, J.Q.; Fan, W.H.; Zhang, Q.Y.; Qin, Q.W. Characterization of complete genome sequence of the spring viremia of carp virus isolated from common carp (Cyprinus carpio) in China. Arch. Virol. 2007, 152, 1457–1465. [Google Scholar] [CrossRef]
- Fijan, N. Spring viraemia of carp and other viral diseases and agents of warm water fish. In Fish Diseases and Disorders; Woo, P.T.K., Bruno, D.W., Eds.; CAB International: London, UK, 1999; Volume 3, pp. 177–244. [Google Scholar]
- Newman, D.J.; Cragg, G.M. Natural products as sources of new drugs from 1981 to 2014. J. Nat. Prod. 2016, 79, 629–661. [Google Scholar] [CrossRef]
- Yarovaya, O.I.; Salakhutdinov, N.F. Mono- and sesquiterpenes as a starting platform for the development of antiviral drugs. Russ. Chem. Rev. 2021, 90, 488–510. [Google Scholar] [CrossRef]
- Ge, H.; Wang, Y.F.; Xu, J.; Gu, Q.; Liu, H.B.; Xiao, P.G.; Zhou, J.; Liu, Y.; Yang, Z.; Su, H. Anti-influenza agents from Traditional Chinese Medicine. Nat. Prod. Rep. 2010, 27, 1758–1780. [Google Scholar] [CrossRef]
- Natella, F.; Nardini, M.; Di Felice, M.; Scaccini, C. Benzoic and cinnamic acid derivatives as antioxidants: Structure activity relation. J. Agr. Food Chem. 1999, 47, 1453–1459. [Google Scholar] [CrossRef] [PubMed]
- Hu, Y.; Liu, L.; Li, B.Y.; Shen, Y.F.; Wang, G.X.; Zhu, B. Synthesis of arctigenin derivatives against infectious hematopoietic necrosis virus. Eur. J. Med. 2019, 163, 183–194. [Google Scholar] [CrossRef]
- Kashman, Y.; Gustafson, K.R.; Fuller, R.W.; Cardellina, J.H.I.; Mcmahon, J.B.; Currens, M.J.; Buckheit, R.W.J.; Hughes, S.H.; Cragg, G.M.; Boyd, M.R. Cheminform abstract: HIV inhibitory natural products. Part 7. The calanolides, a novel HIV-inhibitory class of coumarin derivatives from the tropical rainforest tree, Calophyllum lanigerum. J. Med. Chem. 1992, 35, 2735–2743. [Google Scholar] [CrossRef]
- Charlton James, L. Antiviral Activity of Lignans. J. Nat. Prod. 1998, 61, 1447–1451. [Google Scholar] [CrossRef] [PubMed]
- Antonelli, A.C.; Zhang, Y.; Golub, L.M.; Johnson, F.; Simon, S.R. Inhibition of anthrax lethal factor by curcumin and chemically modiffed curcumin derivatives. J. Enzym. Inhib. Med. Ch. 2014, 29, 663–669. [Google Scholar] [CrossRef]
- Song, D.W.; Liu, L.; Shan, L.P.; Qiu, T.X.; Chen, J.; Chen, J.P. Rhabdoviral clearance effect of a phenylpropanoid medicine against spring viraemia of carp virus infection in vitro and in vivo. Aquaculture 2020, 526, 735412. [Google Scholar] [CrossRef]
- Song, D.W.; Liu, L.; Fu, X.Y.; Liu, G.L.; Hu, Y.; Chen, J. Immune responses and protective efffcacy on 4-(2-methoxyphenyl)-3,4-dihydro-2H-chromeno [4,3-d] pyrimidine-2,5 (1H)-dione against spring viremia of carp virus in vivo. Aquaculture 2021, 540, 736694. [Google Scholar] [CrossRef]
- Qiu, T.X.; Wang, H.; Hu, Y.; Shan, L.P.; Liu, G.L.; Liu, L.; Zhang, X.; Chen, J. Inhibition of fish rhabdovirus demonstrates application prospect of two methylimidazole phenylpropanoid-based small molecules in aquaculture. Aquaculture 2024, 595, 741636. [Google Scholar] [CrossRef]
- Liu, L.; Shan, L.P.; Xue, M.Y.; Lu, J.F.; Hu, Y.; Liu, G.L.; Chen, J. Potential application of antiviral coumarin in aquaculture against IHNV infection by reducing viral adhesion to the epithelial cell surface. Antivir. Res. 2021, 195, 105192. [Google Scholar] [CrossRef] [PubMed]
- Shan, L.P.; Zhou, Y.; Yan, M.C.; Liu, L.; Chen, J.; Chen, J.P. A novel antiviral coumarin derivative as a potential agent against WSSV infection in shrimp seedling culture. Virus Res. 2021, 297, 198387. [Google Scholar] [CrossRef]
- Koutna’, M.; Veselý, T.; Psikal, I.; Hůlova’, J. Identiffcation of spring viraemia of carp virus (SVCV) by combined RT-PCR and nested PCR. Dis. Aquat. Org. 2003, 55, 229–235. [Google Scholar] [CrossRef]
- Chen, Z.Y.; Liu, H.; Li, Z.Q.; Wang, M.; Zhang, Q.Y. Detection of viral pathogen from diseased common carp (Cyprinus carpio) by infectious tests. J. Fish. Sci. China 2006, 13, 617–623. [Google Scholar]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using realtime quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Roulston, A.; Marcellus, R.C.; Branton, P.E. Viruses and apoptosis. Annual. Rev. Microbiol. 1999, 53, 577–628. [Google Scholar] [CrossRef]
- Liang, R.; Song, H.X.; Huang, J.L.; Fei, R.M.; Zhang, J.Q. PEDV epidemic strain JS2013 induced apoptosis of Vero cell. J. Nanjing Agric. Univ. 2021, 44, 514–520. [Google Scholar]
- Suleva, P.C.; Manuel, O.V.; Patricia, D.; La, C.O.; Marina, V.P. Dynamic reorganization of the cytoskeleton during apoptosis: The two coffins hypothesis. Int. J. Mol. Sci. 2017, 18, 2393. [Google Scholar] [CrossRef] [PubMed]
- Liu, L.; Hu, Y.; Shen, Y.F.; Wang, G.X.; Zhu, B. Evaluation on antiviral activity of coumarin derivatives against spring viraemia of carp virus in epithelioma papulosum cyprini cells. Antivir. Res. 2017, 144, 173–185. [Google Scholar] [CrossRef]
- Liu, L.; Song, D.W.; Liu, G.L.; Shan, L.P.; Qiu, T.X.; Chen, J. Hydroxycoumarin efffciently inhibits spring viraemia of carp virus infection in vitro and in vivo. Zool. Res. 2020, 41, 395–409. [Google Scholar] [CrossRef]
- Chen, C.; Shen, Y.F.; Hu, Y.; Liu, L.; Chen, W.C.; Wang, G.X.; Zhu, B. Highly efficient inhibition of spring viraemia of carp virus replication in vitro mediated by bavachin, a major constituent of psoralea corlifonia Lynn. Virus Res. 2018, 255, 24–35. [Google Scholar] [CrossRef]
- Xiao, Y.; Shao, L.; Zhang, C.; An, W. Genomic evidence of homologous recombination in spring viremia of carp virus: A negatively single stranded RNA virus. Virus Res. 2014, 189, 271–279. [Google Scholar] [CrossRef] [PubMed]
- Zou, J.; Secombes, C.J. Teleost fish interferons and their role in immunity. Dev. Comp. Immunol. 2011, 35, 1376–1387. [Google Scholar] [CrossRef] [PubMed]
- Forlanza, M.; Dias, J.D.; Vesel, T. Transcription of signal-3 cytokines, IL-12 and IFNα/β, coincides with the timing of CD8α/β up-regulation during viral infection of common carp (Cyprinus carpio L.). Mol. Immunol. 2008, 45, 1531–1547. [Google Scholar] [CrossRef] [PubMed]
- Adamek, M.A.; Rakus, K.; Chyb, J.A.; Brogden, G.; Huebner, A.; Irnazarow, I.; Steinhagen, D. Interferon type I responses to virus infections in carp cells: In vitro studies on Cyprinid herpesvirus 3 and Rhabdovirus carpio infections. Fish Shellfish Immun. 2012, 33, 482–493. [Google Scholar] [CrossRef] [PubMed]
- Qiu, T.X.; Song, D.W.; Shan, L.P.; Liu, G.L.; Liu, L. Potential prospect of a therapeutic agent against spring viraemia of carp virus in aquaculture. Aquaculture 2020, 515, 734558. [Google Scholar] [CrossRef]
- Rodriguez, J.; Li, T.; Xu, Y.R.; Sun, Y.Y.; Zhu, C.L. Role of apoptosis-inducing factor in perinatal hypoxic-ischemic brain injury. Neural Regen. Res. 2020, 16, 205–213. [Google Scholar]
- Tafalla, C.; Sanchez, E.; Lorenzen, N.; DeWitte-Orr, S.J.; Bols, N.C. Effects of viral hemorrhagic septicemia virus (VHSV) on the rainbow trout (Oncorhynchus mykiss) monocyte cell line RTS-11. Mol. Immunol. 2008, 45, 1439–1448. [Google Scholar] [CrossRef]
- Lopez, M.A.; Roca, F.J.; Meseguer, J.; Mulerol, V. New insights into the evolution of IFNs: Zebrafish group II IFNs induce a rapid and transient expression of IFN-dependent genes and display powerful antiviral activities. J. Immunol. 2009, 182, 3440–3449. [Google Scholar] [CrossRef]
- Kawai, T.; Takahashi, K.; Sato, S.; Coban, C.; Akira, S. IPS-1, an adaptor triggering RIG-I and MDA5 mediated type I interferon induction. Nat. Immunol. 2005, 6, 981–988. [Google Scholar] [CrossRef]
Primer | Sequences (from 5′to 3′) | |
---|---|---|
SVCV nucleoprotein (N) | Forward | AACAGCGCGTCTTACATGC |
Reverse | CTAAGGCGTAAGCCATCAGC | |
RIG-I | Forward | AAACTGTGACTTAGACGAGGCT |
Reverse | GTTGCTGCTCATCAGCATGT | |
Mx1 | Forward | ATGAATCCTGGAAGCCCTC |
Reverse | GAACTTCGGGAAGAATTTGC | |
ISG15 | Forward | AAGCCATATTCAGCGAAGC |
Reverse | AACCGTTATCGGCAGACAG | |
MAVS | Forward | TCACACTCACTGATAGGGAAGAG |
Reverse | TAGCTCTCATCTCATTAGCCAGT | |
IRF3 | Forward | GGAGACCACTCTGTTTGGAAG |
Reverse | CGGCATCGTTCTTGTTGTC | |
IFN1 | Forward | ACCAAACCCAAATGTGGACGTG |
Reverse | CCACTCATTTCCCGAAGCAGA | |
Fish actin | Forward | GATGATGAAATTGCCGCACTG |
Reverse | ACCAACCATGACACCCTGATGT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Song, D.; Cai, X.; Shao, Q.; Tong, X.; Zhao, Z.; Liu, L.; Liu, G. Antiviral Effect and Metabolic Regularity of a Phenylpropanoid- Based Compound as Potential Immunopotentiator. Fishes 2025, 10, 77. https://doi.org/10.3390/fishes10020077
Song D, Cai X, Shao Q, Tong X, Zhao Z, Liu L, Liu G. Antiviral Effect and Metabolic Regularity of a Phenylpropanoid- Based Compound as Potential Immunopotentiator. Fishes. 2025; 10(2):77. https://doi.org/10.3390/fishes10020077
Chicago/Turabian StyleSong, Dawei, Xue Cai, Qianhao Shao, Xinhui Tong, Zhe Zhao, Lei Liu, and Guanglu Liu. 2025. "Antiviral Effect and Metabolic Regularity of a Phenylpropanoid- Based Compound as Potential Immunopotentiator" Fishes 10, no. 2: 77. https://doi.org/10.3390/fishes10020077
APA StyleSong, D., Cai, X., Shao, Q., Tong, X., Zhao, Z., Liu, L., & Liu, G. (2025). Antiviral Effect and Metabolic Regularity of a Phenylpropanoid- Based Compound as Potential Immunopotentiator. Fishes, 10(2), 77. https://doi.org/10.3390/fishes10020077