Development of the First Microsatellite Multiplex PCR Panel for Meagre (Argyrosomus regius), a Commercial Aquaculture Species
Abstract
:1. Introduction
2. Materials and Methods
2.1. Sample
2.2. Primer Desing
2.3. PCR Conditions
2.4. Genotyping Reliability of Microsatellite Markers
2.5. Genetic Diversity and Parental Assignment
3. Results and Discussion
3.1. Microsatellite Selection, Multiplex PCR Design and Parental Assignment
3.2. Genetic Diversity
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- FAO. Fisheries & Aquaculture-FAO Yearbook of Fishery and Aquaculture Statistics. Available online: https://www.fao.org/fishery/statistics-query/en/aquaculture/aquaculture_value (accessed on 7 May 2022).
- Cárdenas, S. Crianza de La Corvina (Argyrosomus Regius). In Cuadernos de Acuicultura; Consejo Superior de Investigaciones Científicas (CSIC): Madrid, Spain, 2010; ISBN 9788400092917. [Google Scholar]
- Lee-Montero, I.; Navarro, A.; Borrell, Y.; García-Celdrán, M.; Martín, N.; Negrín-Báez, D.; Blanco, G.; Armero, E.; Berbel, C.; Zamorano, M.J.; et al. Development of the First Standardised Panel of Two New Microsatellite Multiplex PCRs for Gilthead Seabream (Sparus Aurata L.). Anim. Genet. 2013, 44, 533–546. [Google Scholar] [CrossRef] [PubMed]
- Aslam, M.L.; Carraro, R.; Bestin, A.; Cariou, S.; Sonesson, A.K.; Bruant, J.S.; Haffray, P.; Bargelloni, L.; Meuwissen, T.H.E. Genetics of Resistance to Photobacteriosis in Gilthead Sea Bream (Sparus Aurata) Using 2b-RAD Sequencing. BMC Genet. 2018, 19, 43. [Google Scholar] [CrossRef] [PubMed]
- Palaiokostas, C.; Ferraresso, S.; Franch, R.; Houston, R.D.; Bargelloni, L. Genomic Prediction of Resistance to Pasteurellosis in Gilthead Sea Bream (Sparus Aurata) Using 2B-RAD Sequencing. Genes Genomes Genet. 2016, 6, 3693–3700. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ma, H.; Zhang, Y.; Xiang, Z.; Zhang, Y.; Qin, Y.; Yu, Z. Development of Tri-Nucleotide Microsatellite Markers from Crassostrea Hongkongensis Using Enriched Genomic Libraries and Cross-Species Amplification in Two Closely Related Species. Aquac. Rep. 2021, 19, 100592. [Google Scholar] [CrossRef]
- Villanueva, B.; Verspoor, E.; Visscher, P.M. Parental Assignment in Fish Using Microsatellite Genetic Markers with Finite Numbers of Parents and Offspring. Anim. Genet. 2002, 33, 33–41. [Google Scholar] [CrossRef]
- Liu, Z.J.; Cordes, J.F. DNA Marker Technologies and Their Applications in Aquaculture Genetics. Aquaculture 2004, 238, 1–37. [Google Scholar] [CrossRef]
- Marshall, T.C.; Slate, J.; Kruuk, L.E.B.; Pemberton, J.M. Statistical Confidence for Likelihood-Based Paternity Inference in Natural Populations. Mol. Ecol. 1998, 7, 639–655. [Google Scholar] [CrossRef] [Green Version]
- Archangi, B.; Chand, V.; Mather, P.B. Isolation and Characterization of 15 Polymorphic Microsatellite DNA Loci from Argyrosomus Japonicus (Mulloway), a New Aquaculture Species in Australia. Mol. Ecol. Resour. 2009, 9, 412–414. [Google Scholar] [CrossRef]
- Farias, I.P.; Muniz, L.B.; Astolfi-Filho, S.; Sampaio, I. Isolation and Characterization of DNA Microsatellite Primers for Cynoscion Acoupa, the Most Exploited Sciaenid Fish along the Coast of Brazil. Mol. Ecol. Notes 2006, 6, 660–663. [Google Scholar] [CrossRef]
- Saillant, E.; Cizdziel, K.; O’Malley, K.G.; Turner, T.F.; Pruett, C.L.; Gold, J.R. Microsatellite Markers for Red Drum, Sciaenops ocellatus. Gulf. Mex. Sci. 2004, 22, 101–107. [Google Scholar] [CrossRef]
- Porta, D.; Porta, J.M.; Porta, J.; Andree, K.; Duncan, N. Isolation and Characterization of Microsatellite Loci from Argyrosomus regius (Asso,1801). 2010; Unpublished. Available online: http://www.ncbi.nlm.nih.gov (accessed on 16 November 2021).
- Turner, T.F.; Richardson, L.R.; Gold, J.R. Polymorphic Microsatellite DNA Markers in Red Drum (Sciaenops Ocellatus). Mol. Ecol. 1998, 7, 1771–1773. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.; Cai, M.; Wang, Z.Y.; Guo, W.; Liu, X.; Wang, X.; Ning, Y. Microsatellite-Centromere Mapping in Large Yellow Croaker (Pseudosciaena Crocea) Using Gynogenetic Diploid Families. Mar. Biotechnol. 2008, 10, 83–90. [Google Scholar] [CrossRef] [PubMed]
- Chang, Y.M.; Ding, L.; Wang, W.W.; He, J.G.; Liang, L.Q.; Lei, Q.Q. Isolation and Characterization of 11 Microsatellite Markers for the Large Yellow Croaker, Pseudosciaena crocea. Conserv. Genet. 2009, 10, 1405–1408. [Google Scholar] [CrossRef]
- O’Malley, K.G.; Abbey, C.A.; Ross, K.; Gold, J.R. Microsatellite DNA Markers for Kinship Analysis and Genetic Mapping in Red Drum, Sciaenops Ocellatus (Sciaenidae, Teleostei). Mol. Ecol. Notes 2003, 3, 155–158. [Google Scholar] [CrossRef]
- Nousias, O.; Tsakogiannis, A.; Duncan, N.; Villa, J.; Tzokas, K.; Estevez, A.; Chatziplis, D.; Tsigenopoulos, C.S. Parentage Assignment, Estimates of Heritability and Genetic Correlation for Growth-Related Traits in Meagre Argyrosomus regius. Aquaculture 2020, 518, 734663. [Google Scholar] [CrossRef]
- Nousias, O.; Tzokas, K.; Papaharisis, L.; Ekonomaki, K.; Chatziplis, D.; Batargias, C.; Tsigenopoulos, C.S. Genetic Variability, Population Structure, and Relatedness Analysis of Meagre Stocks as an Informative Basis for New Breeding Schemes. Fishes 2021, 6, 78. [Google Scholar] [CrossRef]
- Soula, M. Estimación de Parámetros Genéticos en Corvina, Argyrosomus regius, Para Caracteres de Crecimiento, Rendimiento y Calidad de la Carne y del pez. Ph.D. Thesis, University of las palmas de gran, Las Palmas de Gran Canaria, Spain, 2012. [Google Scholar]
- Vallecillos, A.; María-Dolores, E.; Villa, J.; Rueda, F.M.; Carrillo, J.; Ramis, G.; Soula, M.; Afonso, J.M.; Armero, E. Phenotypic and Genetic Components for Growth, Morphology, and Flesh-Quality Traits of Meagre (Argyrosomus Regius) Reared in Tank and Sea Cage. Animals 2021, 11, 3285. [Google Scholar] [CrossRef]
- Launey, S.; Krieg, F.; Haffray, P.; Bruant, J.S.; Vannier, A.; Guyomard, R. Twelve New Microsatellite Markers for Gilted Seabream (Sparus Aurata L.): Characterization, Polymorphism and Linkage. Mol. Ecol. Notes 2003, 3, 457–459. [Google Scholar] [CrossRef]
- Navarro, A.; Badilla, R.; Zamorano, M.J.; Pasamontes, V.; Hildebrandt, S.; Sánchez, J.J.; Afonso, J.M. Development of Two New Microsatellite Multiplex PCRs for Three Sparid Species: Gilthead Seabream (Sparus Auratus L.), Red Porgy (Pagrus Pagrus L.) and Redbanded Seabream (P. Auriga, Valenciennes, 1843) and Their Application to Paternity Studies. Aquaculture 2008, 285, 30–37. [Google Scholar] [CrossRef]
- Borrell, Y.J.; Gallego, V.; García-Fernández, C.; Mazzeo, I.; Pérez, L.; Asturiano, J.F.; Carleos, C.E.; Vázquez, E.; Sánchez, J.A.; Blanco, G. Assessment of Parental Contributions to Fast- and Slow-Growing Progenies in the Sea Bream Sparus Aurata L. Using a New Multiplex PCR. Aquaculture 2011, 314, 58–65. [Google Scholar] [CrossRef]
- López, A.; Pardo, B.G.; Planas, M.; Quintas, P.; Martínez, P.; Bouza, C. A Microsatellite Panel for Mating System Analysis and Broodstock Management of Captive Long-Snouted Seahorse Hippocampus guttulatus. Aquaculture 2012, 356–357, 153–157. [Google Scholar] [CrossRef] [Green Version]
- Ren, S.; Mather, P.B.; Tang, B.; Hurwood, D.A. Standardized Microsatellite Panels for Pedigree Management of Farmed White-Leg Shrimp (Penaeus Vannamei) Stocks Validated in a VIE Tagged Family Selection Line. Aquaculture 2022, 551, 737946. [Google Scholar] [CrossRef]
- Dakin, E.E.; Avise, J.C. Microsatellite Null Alleles in Parentage Analysis. Heredity 2004, 93, 504–509. [Google Scholar] [CrossRef] [PubMed]
- van Oosterhout, C.; Hutchinson, W.F.; Wills, D.P.M.; Shipley, P. MICRO-CHECKER: Software for Identifying and Correcting Genotyping Errors in Microsatellite Data. Mol. Ecol. Notes 2004, 4, 535–538. [Google Scholar] [CrossRef]
- Kalinowski, S.T.; Taper, M.L.; Marshall, T.C. Revising How the Computer Program CERVUS Accommodates Genotyping Error Increases Success in Paternity Assignment. Mol. Ecol. 2007, 16, 1099–1106. [Google Scholar] [CrossRef]
- Peakall, R.; Smouse, P.E. GenALEx 6.5: Genetic Analysis in Excel. Population Genetic Software for Teaching and Research-an Update. Bioinformatics 2012, 28, 2537–2539. [Google Scholar] [CrossRef] [Green Version]
- Vandeputte, M.; Mauger, S.; Dupont-Nivet, M. An Evaluation of Allowing for Mismatches as a Way to Manage Genotyping Errors in Parentage Assignment by Exclusion. Mol. Ecol. Notes 2006, 6, 265–267. [Google Scholar] [CrossRef]
- Falconer, D.S. Introduction to Quantitative Genetics, 3rd ed.; Longman: New York, NY, USA, 1989. [Google Scholar]
- Crow, J.F.; Denniston, C. Inbreeding and Variance Effective Population Numbers. Evolution 1988, 42, 482. [Google Scholar] [CrossRef]
- Miquel, C.; Bellemain, E.; Poillot, C.; Bessière, J.; Durand, A.; Taberlet, P. Quality Indexes to Assess the Reliability of Genotypes in Studies Using Noninvasive Sampling and Multiple-Tube Approach. Mol. Ecol. Notes 2006, 6, 985–988. [Google Scholar] [CrossRef]
- Soula, M.; Zamorano, M.J.; Navarro, A.; Sánchez, J.J.; Neil, D.; Alejandro, G.; Afonso López, J.M. Diseño de dos nuevas PCRs múltiplex para corvina (Argyrosomus regius). In Proceedings of the XIII Congreso Nacional de Acuicultura, Barcelona, Spain, 21–24 November 2011. [Google Scholar]
- García-Celdrán, M.; Ramis, G.; María-Dolores, E.; Peñalver, J.; Borrel, Y.J.; Manchado, M.; Estévez, A.; Afonso, J.M.; Armero, E. Genetic assessment of three gilthead sea bream (Sparus aurata L.) populations along the Spanish coast and of three broodstocks managements. Aquacult. Int. 2016, 24, 1409–1420. [Google Scholar] [CrossRef]
- Selkoe, K.A.; Toonen, R.J. Microsatellites for Ecologists: A Practical Guide to Using and Evaluating Microsatellite Markers. Ecol. Lett. 2006, 9, 615–629. [Google Scholar] [CrossRef] [PubMed]
- Vandeputte, M.; Rossignol, M.N.; Pincent, C. From Theory to Practice: Empirical Evaluation of the Assignment Power of Marker Sets for Pedigree Analysis in Fish Breeding. Aquaculture 2011, 314, 80–86. [Google Scholar] [CrossRef] [Green Version]
- Hansen, M.M.; Skaala, Ø.; Jensen, L.F.; Bekkevold, D.; Mensberg, K.L.D. Gene Flow, Effective Population Size and Selection at Major Histocompatibility Complex Genes: Brown Trout in the Hardanger Fjord, Norway. Mol. Ecol. 2007, 16, 1413–1425. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chistiakov, D.A.; Hellemans, B.; Volckaert, F.A.M. Microsatellites and Their Genomic Distribution, Evolution, Function and Applications: A Review with Special Reference to Fish Genetics. Aquaculture 2006, 255, 1–29. [Google Scholar] [CrossRef]
- Blasco, A.; Toro, M.A. A Short Critical History of the Application of Genomics to Animal Breeding. Livest. Sci. 2014, 166, 4–9. [Google Scholar] [CrossRef] [Green Version]
Authors | Species | Loci |
---|---|---|
Porta et al. [13] | Argyrosomus regius | gCT15, gA2B, CA3, CA4, CA6, CA14, CA13, CA10, gA16, gA17 and gA6 |
Archangi et al. [10] | Argyrosomus japonicus | UBA853, UBA54, UBA53, UBA50, UBA6 and UBA5 |
Turner et al. [14] | Sciaenops ocellatus | Soc 011 |
Kathleen et al. [17] | Sciaenops ocellatus | Soc 431 and Soc 405 |
Farias et al. [11] | Cynoscion acoupa | CacMic 14 |
STR Loci | GenBank Accession Number | M | F | Forward Sequence (5′–3′) | Reverse Sequence (5′–3′) | Concentration (μM) | Allele Size Range |
---|---|---|---|---|---|---|---|
gA2B | GU724794 | (CA)26 | 5*NED | AAGTGTGGCGTCATTTCCTCT | GTATTGATGGATAGCAAGTGTCAGA | 0.06 | 86–110 |
UBA50 | EF462924 | (GT)26 | 5*NED | GCACAACTGCATCCCTTAGAT | GTTTAGAAGTGAAGACTGCGGACTG | 0.15 | 128–152 |
gA17 | GU724798 | (GT)12 | 5*6-FAM | CTAGAGAAATTCATCCAGGGAAGTG | GTTTAGAGCAGAGAGTTAGCGGTTGTT | 0.06 | 80–92 |
SOC 405 | AY161014 | (CA)12 | 5*6-FAM | AGCCTTTTGTTTAGTTTCCCTCAT | GGGGTGTAGCAGAACCACAC | 0.06 | 112–124 |
Cacmic 14 | DQ285034 | (CT)12 | 5*PET | ATCTTCTCCCCTCCGTCACT | CTGTGTTGTTAAGGCGCATC | 0.06 | 132–148 |
SOC 431 | AY161032 | (GT)26 | 5*PET | GTGGTAGATGAAAACGTATAAAAGGAG | GTTTCATATATATAGTGTACAGCTCCAGCTTC | 0.08 | 124–148 |
UBA53 | EF462925 | (CA)14 | 5*VIC | TACTTCCTTCTACCCCTAAGTCTGG | GACTTTCCAGTGTAGCTGTCGTTT | 0.08 | 86–114 |
Soc 011 | AF073258 | (GA)11 | 5*VIC | GCCGAGTCACGAAGGAACAGAGAA | TGTCGTCTCATCTATCTCCATCTC | 0.08 | 250–266 |
Maximum Number of Mismatches Allowed | |||||
---|---|---|---|---|---|
Kind of assignment observed | 0 | 1 | 2 | 3 | 4 |
Single pair of parents | 83 | 240 | 399 | 545 | 586 |
Multiple pairs of parents | 0 | 5 | 7 | 1 | 2 |
Unassigned | 533 | 371 | 210 | 70 | 28 |
Meagre STR Loci | No Alleles | Ho | He | PIC | FIS | p-Value HW |
---|---|---|---|---|---|---|
gA2B | 8 | 0.62 | 0.52 | 0.46 | −0.19 | *** |
UBA50 | 13 | 0.97 | 0.81 | 0.80 | −0.21 | *** |
gA17 | 7 | 0.73 | 0.69 | 0.68 | −0.07 | *** |
SOC 405 | 5 | 0.35 | 0.32 | 0.35 | −0.10 | *** |
Cac mic 14 | 8 | 0.79 | 0.72 | 0.70 | −0.09 | *** |
SOC 431 | 8 | 0.61 | 0.50 | 0.57 | −0.22 | *** |
UBA53 | 9 | 0.58 | 0.60 | 0.47 | 0.03 | NS |
Soc 011 | 9 | 0.88 | 0.80 | 0.77 | −0.10 | *** |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Vallecillos, A.; María-Dolores, E.; Villa, J.; Rueda, F.M.; Carrillo, J.; Ramis, G.; Soula, M.; Afonso, J.M.; Armero, E. Development of the First Microsatellite Multiplex PCR Panel for Meagre (Argyrosomus regius), a Commercial Aquaculture Species. Fishes 2022, 7, 117. https://doi.org/10.3390/fishes7030117
Vallecillos A, María-Dolores E, Villa J, Rueda FM, Carrillo J, Ramis G, Soula M, Afonso JM, Armero E. Development of the First Microsatellite Multiplex PCR Panel for Meagre (Argyrosomus regius), a Commercial Aquaculture Species. Fishes. 2022; 7(3):117. https://doi.org/10.3390/fishes7030117
Chicago/Turabian StyleVallecillos, Antonio, Emilio María-Dolores, Javier Villa, Francisco Miguel Rueda, José Carrillo, Guillermo Ramis, Mohamed Soula, Juan Manuel Afonso, and Eva Armero. 2022. "Development of the First Microsatellite Multiplex PCR Panel for Meagre (Argyrosomus regius), a Commercial Aquaculture Species" Fishes 7, no. 3: 117. https://doi.org/10.3390/fishes7030117