Identification of Mycobacterium chelonae from Lined Seahorse Hippocampus erectus and Histopathological Analysis
Abstract
:1. Introduction
2. Materials and Methods
2.1. Fish
2.2. Parasite Check and Bacterial Isolation
2.3. Bacterial Identification
2.3.1. Morphological, Physiological, and Biochemical Features of the Isolated Pathogens
2.3.2. 16S rDNA, Hsp65, and RpoB Sequences and Phylogenetic Analysis
2.4. Pathology Slides
2.5. Pathogenicity
3. Results
3.1. Clinical Signs and Pathological Features
3.2. Isolation and Purification of Pathogenic Bacteria
3.3. Identification of the Isolated Strains
3.4. Artificial Infection Test
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Lourie, S.A.; Pritchard, J.C.; Casey, S.P.; Truong, S.K.; Hall, H.J.; Vincent, A.C.J. The taxonomy of Vietnam’s exploited seahorse (family Syngnathidae). Biol. J. Linn. So. 1999, 66, 231–256. [Google Scholar] [CrossRef]
- Lin, Q.; Lin, J.; Huang, L. Effects of light intensity, stocking density and temperature on the air-bubble disease, survivor-ship and growth of early juvenile seahorse Hippocampus erectus Perry, 1810. Aquac. Res. 2010, 42, 91–98. [Google Scholar] [CrossRef]
- Vincent, A.; Foster, S.J.; Koldewey, H.J. Conservation and management of seahorses and other Syngnathidae. J. Fish Biol. 2011, 78, 1681–1724. [Google Scholar] [CrossRef] [PubMed]
- Yang, Q.H.; Zheng, L.Y.; Huang, Z.C.; Lin, Q.; Lu, Z.; Zhou, C. Identification and characterization of pathogen Vibrio rotiferianus, a pathogen isolated from Hippocampus erectus with tail-rot disease. J. Fish. Sci. China 2017, 24, 1131–1140. [Google Scholar] [CrossRef]
- Zhang, D.; Zhang, Y.H.; Lin, J.D.; Lin, Q. Growth and survival of juvenile lined seahorse, Hippocampus erectus (Perry), at different stocking Densities. Aquac. Res. 2010, 42, 9–13. [Google Scholar] [CrossRef]
- Wang, X.; Zhang, Y.; Qin, G.; Luo, W.; Lin, Q. A novel pathogenic bacteria (Vibrio fortis) causing enteritis in cultured seahorses, Hippocampus erectus Perry, 1810. J. Fish Dis. 2016, 39, 765–769. [Google Scholar] [CrossRef] [PubMed]
- Balcázar, J.L.; Gallo-Bueno, A.; Planas, M.; Pintado, J. Isolation of Vibrio alginolyticus and Vibrio splendidus from captive-bred seahorse with disease symtoms. Antonie Van Leeuwenhoek 2010, 97, 207–210. [Google Scholar] [CrossRef] [PubMed]
- Alcaide, E.; Gil-Sanz, C.; Sanjuán, E.; Esteve, D.; Amaro, C.; Silveira, L. Vibrio harveyi causes disease in seahorse, Hippocampus sp. J. Fish Dis. 2001, 24, 311–313. [Google Scholar] [CrossRef]
- Qin, G.; Wang, X.; Tan, S.; Lin, Q. A bacterial infection by Vibrio harveyi causing heavy reduction of cultured lined seahorse Hippocampus erectus. J. Fish Dis. 2017, 40, 601–605. [Google Scholar] [CrossRef] [PubMed]
- Tendencia, E.A. The first report of Vibrio harveyi infection in the sea horse Hippocampus kuda Bleekers 1852 in the Philippines. Aquac. Res. 2004, 35, 1292–1294. [Google Scholar] [CrossRef]
- Shao, P.; Yong, P.Z.; Wang, X.Y.; Xie, S.D.; Fan, Y.S.; Zang, L.; Cui, L.W.; Sun, J.H. Isolation, identification, and histopathological analysis of Vibrio tubiashii from lined seahorse Hippocampus erectus. Dis. Aquat. Org. 2019, 133, 195–205. [Google Scholar] [CrossRef] [PubMed]
- Balcázar, J.L.; Planas, M.; Pintado, J. Mycobacteriosis in seahorses. Emerg. Infect. Dis. 2011, 17, 1770–1772. [Google Scholar] [PubMed]
- Fogelson, S.B.; Fast, M.D.; Leary, J.; Camus, A.C. Pathologic features of mycobacteriosis in naturally infected Syngnathidae and novel transcriptome assembly in association with disease. J. Fish Dis. 2017, 40, 1681–1694. [Google Scholar] [CrossRef]
- Dill, J.; Sanchez, S.; McDermott, A.; Camus, A. Disseminated nocardiosis associated with the isolation of Nocardia nova in a longsnout seahorse Hippocampus reidi (Ginsburg). J. Fish Dis. 2017, 40, 1235–1239. [Google Scholar] [CrossRef]
- Declercq, A.M.; Chiers, K.; Broeck, W.V.; Rekecki, A.; Teerlinck, S.; Adriaens, D.; Haesebrouck, F.; Decosere, A. White necrotic tail tips in estuary seahorses, Hippocampus kuda, Bleeker. J. Fish Dis. 2014, 37, 501–504. [Google Scholar] [CrossRef]
- Meng, Q.; Yu, K. A new species of Ciliata, Licnophora hippocampi sp. nov., from the seahorse Hippocampus trimaculatus Leach, with considerations of its control in the host. Acta Zool. Sin. 1985, 31, 65–69. [Google Scholar]
- Blazer, S.; Wolke, R.E. An Exophiala-like fungus as the cause of a systemic mycosis of marinefish. J. Fish Dis. 1979, 2, 145–152. [Google Scholar] [CrossRef]
- Dong, X.Z.; Cai, M.Y. Manual of Familiar Bacterium Identification; Science Press: Beijing, China, 2001. [Google Scholar]
- Luo, Z.; Li, J.; Zhang, Z.G.; Hao, S.; Bai, X.H.; You, H.Z.; Mo, Z.L.; Feng, S.M. Mycobacterium marinum is the causative agent of splenic and renal granulomasin half-smooth tongue sole (Cynoglossus semilaevis Günther) in China. Aquaculture 2018, 490, 203–207. [Google Scholar] [CrossRef]
- Luo, Z.; Hao, S.; Bai, X.H.; Zhang, Z.G.; Ma, Y.F.; Feng, S.M.; Zhang, D.F. Isolation, identification, and genomic analysis of Mycobacterium ulcerans ecovar Liflandii from the farmed Chinese tongue sole, Cynoglossus semilaevis Günther. Aquaculture 2022, 548, 737614. [Google Scholar] [CrossRef]
- Talaat, A.M.; Reimschuessel, R.; Trucksis, M. Identification of mycobacteria infecting fish to the species level using polymerase chain reaction and rest riction enzyme analysis. Vet. Microbiol. 1997, 58, 229–237. [Google Scholar] [CrossRef]
- Zhang, D.F.; Ji, C.; Zhang, X.J.; Li, T.T.; Li, A.H.; Gong, X.N. Mixed mycobacterial infections in farmed sturgeons. Aquac. Res. 2015, 46, 1914–1923. [Google Scholar] [CrossRef]
- Gauthier, D.T.; Rhodes, M.W. Mycobacteriosis in fishes: A review. Vet. J. 2009, 180, 33–47. [Google Scholar] [CrossRef]
- Kusunoki, S.; Ezaki, T. Proposal of Mycobacterium peregrinum sp. Nov., nom. rev., and elevation of Mycobacterium chelonae subsp. abscessus (Kubica et al.) to species status: Mycobacterium abscessus comb. nov. Int. J. Syst. Bacteriol. 1992, 42, 240–245. [Google Scholar] [CrossRef] [PubMed]
- Daoust, P.Y.; Larson, B.E.; Johnson, G.R. Mycobacteriosis in yellow perch (Perca flavescens) from two lakes in Alberta. J. Wildl. Dis. 1989, 25, 31–37. [Google Scholar] [CrossRef] [PubMed]
- Bruno, D.W.; Griffiths, J.; Mitchell, C.G.; Wood, B.P.; Fletcher, Z.J.; Drobniewski, F.A.; Hastings, T.S. Pathology attributed to Mycobacterium chelonae infection among farmed and laboratory-infected Atlantic salmon Salmo salar. Dis. Aquat. Organ. 1998, 33, 101–109. [Google Scholar] [CrossRef] [PubMed]
- Whipps, C.M.; Matthews, J.L.; Kent, M.L. Distribution and genetic characterization of Mycobacterium chelonae in laboratory zebrafish Danio rerio. Dis. Aquat. Organ. 2008, 82, 45–54. [Google Scholar] [CrossRef]
- Clarke, E.O., 3rd; Dorn, B.; Boone, A.; Risatti, G.; Gilbert-Marcheterre, K.; Harms, C.A. Mycobacteriosis, Mycobacterium chelonae, in a captive yellow stingray (Urobatis jamaicensis). J. Zoo Wildl. Med. 2013, 44, 470–474. [Google Scholar] [CrossRef] [PubMed]
- Antuofermo, E.; Pais, A.; Nuvoli, S.; Hetzel, U.; Burrai, G.P.; Rocca, S.; Caffara, M.; Giorgi, I.; Pedron, C.; Prearo, M. Mycobacterium chelonae associated with tumor-like skin and oral masses in farmed Russian sturgeons (Acipenser gueldenstaedtii). BMC Vet. Res. 2014, 10, 18. [Google Scholar] [CrossRef]
- Tuxbury, K.A.; Young, S.A.; Bradway, D.S.; Marola, J.L.; Salfinger, M.; Garner, M.M. Acute disseminated mycobacteriosis in captive Atlantic guitarfish (Rhinobatos lentiginosus). J. Vet. Diagn. Investig. 2017, 29, 935–938. [Google Scholar] [CrossRef]
- Ishii, Y.; Kawakami, H.; Mekata, T.; Sugiyama, A. Histopathological Features of Mycobacterium chelonae infection in two farmed Japanese pufferfish (Takifugu rubripes). J. Comp. Path. 2019, 170, 86–90. [Google Scholar] [CrossRef]
- Janik, A.J.; Whipps, C.M. Differences in susceptibility to Mycobacterium chelonae in zebrafish (Danio rerio) lines commonly used in scientific Research. J. Fish Dis. 2022, 45, 435–443. [Google Scholar] [CrossRef] [PubMed]
- Nogueira, C.L.; Whipps, C.M.; Matsumoto, C.K.; Chimara, E.; Droz, S.; Tortoli, E.; Freitas, D.; Cnockaert, M.; Palomino, J.C.; Martin, A.; et al. Mycobacterium saopaulense sp nov., a rapidly growing mycobacterium closely related to members of the Mycobacterium chelonae-Mycobacterium abscessus group. Int. J. Syst. Evol. Microbiol. 2015, 65, 4403–4409. [Google Scholar] [CrossRef] [PubMed]
- Kim, B.J.; Kim, B.R.; Jeong, J.; Lim, J.H.; Park, S.H.; Lee, S.H.; Kim, C.K.; Kook, Y.H.; Kim, B.J. A description of Mycobacterium chelonae subsp. gwanakae subsp. nov., a rapidly growing mycobacterium with a smooth colony phenotype due to glycopeptidolipids. Int. J. Syst. Evol. Microbiol. 2018, 68, 3772–3780. [Google Scholar] [CrossRef] [PubMed]
- Inkster, T.; Peters, C.; Seagar, A.L.; Holden, M.T.G.; Laurenson, I.F. Investigation of two cases of Mycobacterium chelonae infection in haemato-oncology patients using whole-genome sequencing and a potential link to the hospital water supply. J. Hosp. Infect. 2021, 114, 111–116. [Google Scholar] [CrossRef]
- Talaat, A.M.; Reimschuessel, R.; Wasserman, S.S.; Trucksis, M. Goldfish, Carassius auratus a novel animal model for the study of Mycobacterium marinum pathogensis. Infect. Immun. 1998, 66, 2938–2942. [Google Scholar] [CrossRef]
- Bright, M.; Bulgheresi, S. A complex journey: Transmission of microbial symbionts. Nat. Rev. Microbiol. 2010, 8, 218–230. [Google Scholar] [CrossRef]
- Svoboda, J.; Mrugała, A.; Kozubíková-Balcarová, E.; Petrusek, A. Hosts and transmission of the crayfish plague pathogen Aphanomyces astaci: A review. J. Fish Dis. 2017, 40, 127–140. [Google Scholar] [CrossRef]
- Alizon, S. Parasite co-transmission and the evolutionary epidemiology of virulence. Evol. Int. J. Org. Evol. 2013, 67, 921–933. [Google Scholar] [CrossRef]
- Chang, C.T.; Doerr, K.M.; Whipps, C.M. Antibiotic treatment of zebrafish mycobacteriosis: Tolerance and efficacy of treatments with tigecycline and clarithromycin. J. Fish Dis. 2017, 40, 1473–1485. [Google Scholar] [CrossRef]
Primer | Sequence (5′→3′) | Length (bp) | Application |
---|---|---|---|
T39 | GCGAACGGGTGAGTAACACG | 936 | Test Mycobacteria sp by nested PCR |
T13 | TGCACACAGGCCACAAGGGA | ||
preT43 | AATGGGCGCAAGCCTGATG | 300–312 | |
T531 | ACCGCTACACCAGGAAT | ||
27F | AGAGTTTGATCMTGGCTCAG | 1480–1494 | Clone 16S rDNA gene |
1492R | TACGGYTACCTTGTTACGACTT | ||
Myco-F | GGCAAGGTCACCCCGAAGGG | 752–761 | Clone rpoB gene |
Myco-R | AGCGGCTGCTGGGTGATCATC | ||
Hsp-F | ATCGCCAAGGAGATCGAGCT | 644 | Clone hsp65 gene |
Hsp-R | AAGGTGCCGCGGATCTTGTT |
Tests | Mycobacterium chelonae | Mycobacterium marinum Strain myco001 | Mycobacterium ulcerans Strain BS123 | HM-2021-1 | HM-2021-2 |
---|---|---|---|---|---|
Pigmentation production | - | photochromogenic | photochromogenic | - | - |
5% NaCl growth | - | - | - | - | - |
Nitrate reductase activity | - | - | - | - | - |
Tween-80 hydrolysis | - | + | + | - | - |
Urease | + | + | + | + | + |
Catalase at 68 °C | + | + | + | + | + |
Arylsulfatase activity | + | + | + | + | + |
Rate of growth | rapid | slow | slow | rapid | rapid |
Organism | NCBI No. | Source | Geographic Location |
---|---|---|---|
M. saopaulense FMS-15 | MK396591 | - | Korea |
M. saopaulense P9-C11 | MK318570 | - | China |
M. saopaulense EPM10906 | NR145859 | patient | Brazil |
M. chelonae M77 | CP041150 | cow | India |
M. chelonae ATCC 19237 | AY457082 | - | France |
M. chelonae 55 | OP899898 | patient | Iran |
M. chelonae CIP 104535T | AY457072 | - | France |
M. abscessus subsp. massiliense XM358 | ON194488 | - | China |
M. abscessus subsp. massiliense XA75 | ON194450 | - | China |
M. chelonae MCHE08 | CP058976 | patient | Switzerland |
M. chelonae Myco1 | CP050223 | patient | USA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Bai, X.; Hao, S.; Fu, J.; Sun, H.; Luo, Z. Identification of Mycobacterium chelonae from Lined Seahorse Hippocampus erectus and Histopathological Analysis. Fishes 2023, 8, 225. https://doi.org/10.3390/fishes8050225
Bai X, Hao S, Fu J, Sun H, Luo Z. Identification of Mycobacterium chelonae from Lined Seahorse Hippocampus erectus and Histopathological Analysis. Fishes. 2023; 8(5):225. https://doi.org/10.3390/fishes8050225
Chicago/Turabian StyleBai, Xiaohui, Shuang Hao, Jianping Fu, Hanchang Sun, and Zhang Luo. 2023. "Identification of Mycobacterium chelonae from Lined Seahorse Hippocampus erectus and Histopathological Analysis" Fishes 8, no. 5: 225. https://doi.org/10.3390/fishes8050225