Next Article in Journal
Seasonal Length–Weight Relationships of European Sea Bass (Dicentrarchus labrax) in Two Aquaculture Production Systems
Next Article in Special Issue
Characterization of SNX5 in Orange-Spotted Grouper (Epinephelus coioides) during In Vitro Viral Infection
Previous Article in Journal
Identification of Keystone Species in Ecological Communities in the East China Sea
Previous Article in Special Issue
Cinnamaldehyde Decreases the Pathogenesis of Aeromonas hydrophila by Inhibiting Quorum Sensing and Biofilm Formation
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Fishes
Volume 8
Issue 5
10.3390/fishes8050225
fishes-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Identification of Mycobacterium chelonae from Lined Seahorse Hippocampus erectus and Histopathological Analysis

by
Xiaohui Bai
1,2,
Shuang Hao
2,
Jianping Fu
3,
Hanchang Sun
4,* and
Zhang Luo
1,2,*
1
Tianjin Key Lab of Aqua-Ecology and Aquaculture, College of Fisheries, Tianjin Agricultural University, Tianjin 300384, China
2
Tianjin Fishery Research Institute, 442 Jiefangnan Road, Tianjin 300221, China
3
College of Life Science, Jiangxi Normal University, Nanchang 330022, China
4
College of Landscape Architecture and Life Science, Chongqing University of Arts and Sciences, Chongqing 402160, China
*
Authors to whom correspondence should be addressed.
Fishes 2023, 8(5), 225; https://doi.org/10.3390/fishes8050225
Submission received: 15 March 2023 / Revised: 11 April 2023 / Accepted: 21 April 2023 / Published: 25 April 2023
(This article belongs to the Special Issue Interactions between Fish and Pathogens in Aquaculture)
Browse Figures
Review Reports Versions Notes

Abstract

:
The lined seahorse (Hippocampus erectus) is an aquacultural species in China and has important economic and ornamental value. However, the species is affected by disease, which restricts their large-scale cultivation. In 2021, a disease was observed in cultured seahorses in Tianjin, China, with a cumulative mortality rate of 20%. The symptoms observed in the moribund seahorse included a weak swimming capacity, discolored body surface, enlarged liver and kidneys, and numerous white nodules in the parenchymatous organs. The strains HM-2021-1 and HM-2021-2 were isolated from diseased seahorses and were identified as being responsible for the disease. It demonstrated the potential to infect seahorse, and the cumulative mortalities of the seahorses artificially infected with strains HM-2021-1 and HM-2021-2 were 93.3% and 90.0%. The pathogen was identified as Mycobacterium chelonae based on physiological and biochemical tests, and 16S rDNA, rpoB, and Hsp65 gene sequence analysis. To our knowledge, this study is the first report of M. chelonae associated with diseased seahorses in China.
Keywords:
seahorse; Hippocampus erectus; histopathology; Mycobacterium chelonae
Key Contribution: This is the first report of a seahorse disease caused by Mycobacterium chelonae in China.

Graphical Abstract

1. Introduction

Seahorses (Family Syngnathidae; genus Hippocampus) are so named because their head resembles that of a horse [1]. They are valuable sources of traditional Chinese medicine with significant therapeutic effects [2]. They have strict survival requirements and narrow habitats, but their natural resources have declined sharply in recent years as a result of ecological damage and predatory fishing in coastal waters. Thus, seahorses are now protected by the World Nature Conservation Union and the Convention on International Trade in Endangered Species of Wild Fauna and Flora [3].
Seahorses are ovoviviparous fish with low reproductive rates, which makes the recovery of their populations very slow. The artificial breeding and farming of seahorses are important means of restoring seahorse resources. Hippocampus erectus, Hippocampus trimaculatus, and Hippocampus kuda are currently the three main aquacultural species in China [4]. However, a low survival rate, often resulting from disease, is the main bottleneck to the successful artificial breeding of seahorses. Compared with other fish species, seahorses appear to be unsuitable for culture in high density and are prone to infection. This may be a consequence of their habit of using their tails to anchor themselves, which can cause interference among conspecifics at higher densities [5].
Several pathogenic diseases observed in seahorse farms have been reported, with Vibrio spp., such as Vibrio fortis, Vibrio alginolyticus, Vibrio splendidus, Vibrio harveyi, Vibrio rotiferianus, Vibrio tubiashii, and Vibrio parahaemolyticus, being the most common [4,6,7,8,9,10,11]. In addition to Vibrio spp., other bacterial pathogens, such as Mycobacterium spp. and Nocardia nova; parasites, such as Uronema spp.; and marine leeches and fungi, have also been reported [12,13,14,15,16,17].
In June and July 2021, a disease outbreak occurred in seahorse at two different fish farms located in the Tianjin Municipality in northern China. The disease had a daily mortality rate of 0.5%, but its causative agent was unknown. Thus, the current study used morphological and biochemical characteristics, and phylogenetic analysis of 16S rDNA, rpoB, and hsp60 gene sequences to determine the cause of the disease.

2. Materials and Methods

2.1. Fish

In June and July 2021, epizootic disease outbreaks in seahorses were reported from two near farms in the Binhai New Area, Tianjin. The cumulative mortality rates were approximately 15% and 20% within 30 days, respectively. The water temperature, salinity, pH, and dissolved oxygen were 25–27 °C, 28–29‰, 7.4–7.6, and 6.8–7.5 mg L−1, respectively. Ten diseased seahorses (9–12 cm) were collected from different fish farms and sent immediately to laboratories for diagnosis and pathogen isolation. Healthy seahorses (8–10 cm) without any signs of disease were bought from a marine fishery in Zhanjiang City, Guangdong Province, China.

2.2. Parasite Check and Bacterial Isolation

Samples of the fins, gills, eyes, mucus, and visceral tissue from five diseased seahorses were examined for parasites under a microscope. After anesthetizing with MS222, the surface of another five diseased seahorses was wiped with 75% alcohol cotton and dissected under aseptic conditions. Small samples from the kidney, liver, and spleen were taken and streaked on Brain Heart Infusion (BHI) agar, thiosulfate–citrate–bile salts–sucrose agar (TCBS), and 7H10 agar supplemented with oleic acid, albumin, dextrose, and catalase (OADC) media and incubated for 7 days at 28 °C. Single colonies of the dominant bacteria were selected for further purification. Two strains were isolated and tentatively named HM-2021-1 and HM-2021-2, respectively.

2.3. Bacterial Identification

2.3.1. Morphological, Physiological, and Biochemical Features of the Isolated Pathogens

Purified single colonies were inoculated on 7H10 plates to observe the colony morphology. Physiological and biochemical assays were performed using standard methods [18], including Gram- and Ziehl–Neelsen (Z&N) staining, Tween-80 hydrolysis, growth on 5% NaCl, and detection of nitrate reductase, arylsulfatase, urease, and catalase activity at 68 °C. Mycobacterium marinum strain myco001 and Mycobacterium ulcerans strain BS123 isolated previously were used as controls [19,20].

2.3.2. 16S rDNA, Hsp65, and RpoB Sequences and Phylogenetic Analysis

Genomic DNA extracted from HM-2021-1 and HM-2021-2 were used as the PCR template, and the 16S rRNA, rpoB, and hsp65 sequences were amplified using different primers according to previously published methods (Table 1) [21]. The purified PCR products were ligated into a PMD-18T vector and transferred to Escherichia coli (TOP10)-competent cells. Positive clones were sequenced by Sangon Biotech (Shanghai, China). BLAST analysis was performed with the reference sequences published in GenBank, and a phylogenetic tree was constructed by using the neighbor-joining method.

2.4. Pathology Slides

To observe the pathological changes in diseased seahorses, kidneys, livers, intestines, and ovaries were collected from dissected diseased and control seahorses and fixed with neutral formaldehyde. The fixed tissues were processed by routine histological procedures, after which 5-μm-thick tissue sections were stained with hematoxylin and eosin (H&E) and Z&N. The sections were examined and photographed with a light microscope to analyze any pathological changes. Tissues from healthy seahorses were used as controls.

2.5. Pathogenicity

Ninety-nine healthy seahorses were acclimated in the laboratory for 2 weeks. Nine seahorses were then randomly selected for detection of Mycobacterium spp. by nested PCR methods [22], with negative results (Table 1). Moreover, bacteriological examination was conducted by streaking on an LB plate, and the parasites were checked with a light microscope. The result was negative. Thus, the remaining 90 seahorses were randomly divided into three groups (n = 30 each) and placed in 100 L aquaria containing 75 L dechlorinated artificial seawater. The water temperature, salinity, and dissolved oxygen were 25–28 °C, 30 and 7.2–9.1 mg/L, respectively. During the trial period, the seahorses were fed three times daily with frozen Mysis spp., with a daily feeding rate of 2.0% of their body weight. The strains HM-2021-1 and HM-2021-2 were cultured in 7H9 for 3 days at 28 °C with shaking at 150 rpm. The bacteria were collected by centrifugation at 6000× g for 10 min. Their concentration was then adjusted using sterile PBS. The seahorses in test group 1 and group 2 were injected intraperitoneally with 0.05 mL of a 4.9 × 107 CFU/mL of HM-2021-1 and a 4.7 × 107 CFU/mL of HM-2021-2 suspension, respectively. The control groups were injected with the same volume of sterile PBS. The seahorses were closely observed for 28 days. Any moribund seahorses were removed immediately, subjected to isolation, and then tested for the presence of mycobacteria by nested PCR.

3. Results

3.1. Clinical Signs and Pathological Features

In the beginning, the diseased seahorses showed lethargy, a weak swimming capacity, and appeared unresponsive and anorexic. With the development of the disease, the seahorses gradually lost buoyancy, swam with no sense of direction, began to float at the water surface, were unable to attach onto holdfasts, and stopped eating. In the later phase, their bodies were swollen, and the body surface was discolored from the original black to brown or even gray (Figure 1A). The intestinal wall was almost transparent, and there was no food in the intestine. The liver and kidneys were enlarged and contained numerous white nodules, 50–300 µm in diameter (Figure 1B,C).
The pathological sections showed large round or oval nodules in the liver and kidney and small nodules in the intestine of the diseased seahorses (Figure 2C,D,I,K). In the liver, there was granulomatous tissue that had calcified and was encapsulated by fibroblasts (Figure 2D). The venous sinus was clotted with blood cells, and hepatocytes were steatotic and even necrotic (Figure 2B,C). In the kidney, granular degeneration of renal tubular epithelial cells and necrosis of renal interstitial cells were observed, and macrophage infiltrates were found (Figure 2F,G). Individual smaller nodules fused into large nodules, and Z&N staining indicated a large number of acid-resistant bacteria in the nodules (Figure 2H,I). In the intestine, the mucosal layer and the muscle layer were separated, and the intestinal villi and intestinal mucosal tissue was rotted and sloughed off (Figure 2K). In the ovary, egg degeneration and necrosis were observed (Figure 2L).

3.2. Isolation and Purification of Pathogenic Bacteria

Except for a few Dactylogyrus flukes in the gill filaments, no other parasites were observed with either the naked eye or under a light microscope. Using the 7H10 culture medium, large morphologically consistent circular, moist, smooth, and opaque white colonies were isolated from the liver and kidney of the diseased seahorses. Strains HM-2021-1 and HM-2021-2 derived from different farms were isolated and purified. The formation of colonies in solid culture media took place after 3–5 days, with the fastest growth occurring in 7H10, slow growth in the BHI, and no growth in the TCBS.

3.3. Identification of the Isolated Strains

The results of the physiological and biochemical tests showed that strains HM-2021-1 and HM-2021-2 were positive for acid-fast staining, catalase at 68 °C, and arylsulfatase and urease reactions but were negative in terms of pigment growth, growth on 5% NaCl, nitrate reductase, and Tween-80 hydrolysis (Table 2).
Partial sequences of 16Sr DNA, rpoB, and Hsp65 from strains HM-2021-1 and HM-2021-2 were obtained by PCR amplification, with fragment sizes of 1415, 700, and 615 bp, respectively (GenBank no. OQ567875, OQ727377, OQ735429, OQ735430, OQ735431, OQ735432). Alignment analysis using the NCBI database revealed that these sequences had the highest similarity to Mycobacterium spp. sequences. By constructing a phylogenetic tree, it was found that the 16Sr DNA gene sequences of HM-2021-1 and HM-2021-2 clustered with Mycobacterium saopaulense and Mycobacterium chelonae, whereas the rpoB and Hsp65 sequences clustered with M. chelonae (Figure 3).

3.4. Artificial Infection Test

Four days after artificial infection, the seahorses in the experimental group showed symptoms of anorexia and lack of buoyancy compared with the control group. From the tenth day after artificial infection, the seahorses began to die. By the 28th day, the cumulative mortalities of the seahorses artificially infected with strains HM-2021-1 and HM-2021-2 were 93.3% and 90.0%, respectively, whereas no death occurred in the control group (Figure 4). The main symptoms of the dead fish were a distended abdomen and numerous white nodules in the kidney, similar to the symptoms of the naturally infected fish. The strain isolated from the nodules had the same physiological and biochemical characteristics and 16S rDNA gene sequence as HM-2021-1.

4. Discussion

Fish mycobacteriosis is a chronic progressive disease caused by several species of nontuberculous Mycobacterium, with Mycobacterium marinum, Mycobacterium fortuitum, and M. chelonae being the most common [23]. The study area, Tianjin, is a coastal city in northern China, where Chinese tongue sole Cynoglossus semilaevis and turbot Scophthalmus maximus are the main marine aquaculture species. Previous work revealed that mycobacteriosis occurs in C. semilaevis and S. maximus in the area, caused by M. marinum and M. ulcerans [19,20]. In the current study, the diseased seahorses showed the symptoms and pathological characteristics of fish mycobacteriosis, including abdominal distension and white nodules in the parenchymal organs, such as the kidney and liver. The pathogenic bacteria isolated from the diseased seahorses differed significantly from M. marinum and M. ulcerans in terms of the physiology and morphology, including a faster growth rate and lack of pigment production. In addition, there were differences in the biochemical reactions from those in M. marinum and M. ulcerans but similarities with those in M. chelonae. The 16S rDNA gene sequence of Mycobacterium registered in GenBank was used for matching and alignment to construct a phylogenetic tree. It was found that the 16S rDNA gene sequence of the isolated strain clustered with M. saopaulense and M. chelonae. Therefore, it was not possible to determine whether the isolated strain belonged to M. saopaulense or to M. chelonae. This might be because of the high similarity of the 16S rDNA gene sequences between M. chelonae and M. abscessus, both of which are members of the M. chelonae–abscessus group [24]. As previously reported, rpoB and Hsp65 of Mycobacterium have better interspecies differentiation [22]. By constructing a phylogenetic tree with these two gene sequences, it was found that the isolated strain first clustered with M. chelonae and then clustered with other members of the M. chelonae-abscessus group, such as M. abscessus and M. saopaulense. This indicates that rpoB and Hsp65 were helpful for distinguishing these isolates from other members of the M. chelonae-abscessus group. Thus, based on the above experimental results, strains HM-2021-1 and HM-2021-2 were identified as M. chelonae.
Artificial infection tests showed that strains HM-2021-1 and HM-2021-2 were pathogenic to seahorses, resulting in the same symptoms as those that occurred following natural infection. Thus, we concluded that M. chelonae was the pathogen responsible for the disease reported in seahorses from Tianjin. M. chelonae infection has also been reported in zebrafish Danio rerio, Japanese pufferfish Takifugu rubripes, Atlantic guitarfish Rhinobatos lentiginosus. Atlantic salmon Salmo salar, Yellow perch Perca flavescens, Yellow stingray Urobatis jamaicensis, and Russian sturgeon Acipenser gueldenstaedtii [25,26,27,28,29,30,31]. Although many fish species can be infected with M. chelonae, studies have shown that there are differences in susceptibility to M. chelonae among different species and even different lines of the same species [32]. Yellow groupers Epinephelus awoara are also reared in seahorse farms but do not become infected with M. chelonae. This suggests that E. awoara has a stronger resistance to M. chelonae compared to seahorses, although further experiments are needed to verify this. Cases of M. chelonae infecting humans are also often reported [33,34,35]. Furthermore, M. chelonae strain 55, M. chelonae strain MCHE08, and M. chelonae strain Myco1, sourced from patients (Table 3), clustered with the M. chelonae strains HM-2021-1 and HM-2021-2 (Figure 3). This implies their close correlation between relatives. Therefore, prevention of infection with M. chelonae is important not only in the aquaculture but also for fish handlers and consumers.
Granuloma is a significant pathological feature of fish infected with Mycobacterium. However, Fogelson et al. found that seahorses rarely form granulomas after being infected with Mycobacterium and speculated that the lack of granulomas might be related to deficiency in the cell-mediated immune response of Syngnathidae [13]. In this study, granulomatous tissue was observed in the kidney, liver, and intestinal pathology sections from the diseased seahorses; in addition, infiltration of macrophages, as a typically cell-mediated immune response, was observed in the kidneys. This is inconsistent with Fogelson et al.’s results, although the reason for this difference remains unclear. It has been reported that the pathological reaction was related to the inoculation dose of M. marinum in goldfish Carassius auratus, with high doses resulting in inflammation, acute tissue necrosis, systemic dissemination of bacteria, and death, whereas lower doses resulted in granulomas and long-term survival [36]. Therefore, future work needs to investigate the relationship between the pathological features seen in seahorses inoculated with different concentrations of M. chelonae. In addition to the liver, kidney, and intestine, ovarian lesions were also observed in diseased seahorses, which means that M. chelonae could affect the reproductive rate of seahorses; similar results were also observed in zebrafish [32].
In general, aquatic animal pathogens are transmitted via vertical transmission, horizontal transmission, or both [37,38]. The mode of transmission was related to the pathogen. Generally, low virulence pathogens were spread through vertical transmission, with high virulence pathogens through horizontal transmission [39]. Fish mycobacteriosis is a chronic progressive disease, and the virulence of mycobacterium spp. was mild. Hence, M. chelonae is more likely to spread through horizontal transmission. Infection of the ovaries can cause contamination of offspring when eggs are released. This inference warrants verification with future experiments. The ovaries, fertilized eggs, and hatched larvae of seahorse need be detected for M. chelonae in future. Currently, there is no effective treatment for mycobacteriosis in fish. Although some drugs have shown activity against M. chelonae, they only reduce the infection intensity, rather than clearing M. chelonae or impacting the prevalence of acid-fast granulomas in zebrafish [40]. In addition, because seahorses have therapeutic value, the effect of using antibiotics on the medicinal value of seahorses requires investigation. Thus, caution should be taken when using drugs. Strict disinfection of aquaculture water and feed organisms and pathogen quarantine before introducing seedlings would be effective ways to prevent mycobacteriosis in seahorses.

5. Conclusions

In conclusion, M. chelonae was isolated from diseased seahorses and is believed to be the pathogenic agent, and the pathologic characteristics of diseased seahorses were observed. This study provides a foundation for further research into the prevention and control of M. chelonae in seahorse in aquacultural settings.

Author Contributions

X.B.: Investigation, Data curation, and Writing—original draft. S.H.: Methodology, Formal analysis. J.F.: Writing—review and editing, Comparative literature dialogue. H.S.: Writing—review and editing, Project administration, and Funding acquisition. Z.L.: Conceptualization, Methodology, Software, Data support and analysis, and Funding acquisition. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the Project for Tianjin Fisheries Innovative Team (ITTFRS2021000, ITTFRS2021000-008) and Projects for Chongqing Technical Innovation and Application Development (cstc2019jscx-gksbX0147).

Institutional Review Board Statement

All animal experiments were approved and conducted in compliance with all experimental practices and standards developed by the Animal Welfare and Research Ethics Committee of Tianjin Agricultural University (Approval Code: 2021002, Approval Date: 20 February 2021).

Data Availability Statement

All the data generated or used during the study appear in the submitted article.

Acknowledgments

Thanks are due to the anonymous reviewers who provided detailed comments that helped to improve the manuscript.

Conflicts of Interest

The authors declare that there are no conflicts of interest regarding the publication of the work described in this manuscript.

References

  1. Lourie, S.A.; Pritchard, J.C.; Casey, S.P.; Truong, S.K.; Hall, H.J.; Vincent, A.C.J. The taxonomy of Vietnam’s exploited seahorse (family Syngnathidae). Biol. J. Linn. So. 1999, 66, 231–256. [Google Scholar] [CrossRef]
  2. Lin, Q.; Lin, J.; Huang, L. Effects of light intensity, stocking density and temperature on the air-bubble disease, survivor-ship and growth of early juvenile seahorse Hippocampus erectus Perry, 1810. Aquac. Res. 2010, 42, 91–98. [Google Scholar] [CrossRef]
  3. Vincent, A.; Foster, S.J.; Koldewey, H.J. Conservation and management of seahorses and other Syngnathidae. J. Fish Biol. 2011, 78, 1681–1724. [Google Scholar] [CrossRef] [PubMed]
  4. Yang, Q.H.; Zheng, L.Y.; Huang, Z.C.; Lin, Q.; Lu, Z.; Zhou, C. Identification and characterization of pathogen Vibrio rotiferianus, a pathogen isolated from Hippocampus erectus with tail-rot disease. J. Fish. Sci. China 2017, 24, 1131–1140. [Google Scholar] [CrossRef]
  5. Zhang, D.; Zhang, Y.H.; Lin, J.D.; Lin, Q. Growth and survival of juvenile lined seahorse, Hippocampus erectus (Perry), at different stocking Densities. Aquac. Res. 2010, 42, 9–13. [Google Scholar] [CrossRef]
  6. Wang, X.; Zhang, Y.; Qin, G.; Luo, W.; Lin, Q. A novel pathogenic bacteria (Vibrio fortis) causing enteritis in cultured seahorses, Hippocampus erectus Perry, 1810. J. Fish Dis. 2016, 39, 765–769. [Google Scholar] [CrossRef] [PubMed]
  7. Balcázar, J.L.; Gallo-Bueno, A.; Planas, M.; Pintado, J. Isolation of Vibrio alginolyticus and Vibrio splendidus from captive-bred seahorse with disease symtoms. Antonie Van Leeuwenhoek 2010, 97, 207–210. [Google Scholar] [CrossRef] [PubMed]
  8. Alcaide, E.; Gil-Sanz, C.; Sanjuán, E.; Esteve, D.; Amaro, C.; Silveira, L. Vibrio harveyi causes disease in seahorse, Hippocampus sp. J. Fish Dis. 2001, 24, 311–313. [Google Scholar] [CrossRef]
  9. Qin, G.; Wang, X.; Tan, S.; Lin, Q. A bacterial infection by Vibrio harveyi causing heavy reduction of cultured lined seahorse Hippocampus erectus. J. Fish Dis. 2017, 40, 601–605. [Google Scholar] [CrossRef] [PubMed]
  10. Tendencia, E.A. The first report of Vibrio harveyi infection in the sea horse Hippocampus kuda Bleekers 1852 in the Philippines. Aquac. Res. 2004, 35, 1292–1294. [Google Scholar] [CrossRef]
  11. Shao, P.; Yong, P.Z.; Wang, X.Y.; Xie, S.D.; Fan, Y.S.; Zang, L.; Cui, L.W.; Sun, J.H. Isolation, identification, and histopathological analysis of Vibrio tubiashii from lined seahorse Hippocampus erectus. Dis. Aquat. Org. 2019, 133, 195–205. [Google Scholar] [CrossRef] [PubMed]
  12. Balcázar, J.L.; Planas, M.; Pintado, J. Mycobacteriosis in seahorses. Emerg. Infect. Dis. 2011, 17, 1770–1772. [Google Scholar] [PubMed]
  13. Fogelson, S.B.; Fast, M.D.; Leary, J.; Camus, A.C. Pathologic features of mycobacteriosis in naturally infected Syngnathidae and novel transcriptome assembly in association with disease. J. Fish Dis. 2017, 40, 1681–1694. [Google Scholar] [CrossRef]
  14. Dill, J.; Sanchez, S.; McDermott, A.; Camus, A. Disseminated nocardiosis associated with the isolation of Nocardia nova in a longsnout seahorse Hippocampus reidi (Ginsburg). J. Fish Dis. 2017, 40, 1235–1239. [Google Scholar] [CrossRef]
  15. Declercq, A.M.; Chiers, K.; Broeck, W.V.; Rekecki, A.; Teerlinck, S.; Adriaens, D.; Haesebrouck, F.; Decosere, A. White necrotic tail tips in estuary seahorses, Hippocampus kuda, Bleeker. J. Fish Dis. 2014, 37, 501–504. [Google Scholar] [CrossRef]
  16. Meng, Q.; Yu, K. A new species of Ciliata, Licnophora hippocampi sp. nov., from the seahorse Hippocampus trimaculatus Leach, with considerations of its control in the host. Acta Zool. Sin. 1985, 31, 65–69. [Google Scholar]
  17. Blazer, S.; Wolke, R.E. An Exophiala-like fungus as the cause of a systemic mycosis of marinefish. J. Fish Dis. 1979, 2, 145–152. [Google Scholar] [CrossRef]
  18. Dong, X.Z.; Cai, M.Y. Manual of Familiar Bacterium Identification; Science Press: Beijing, China, 2001. [Google Scholar]
  19. Luo, Z.; Li, J.; Zhang, Z.G.; Hao, S.; Bai, X.H.; You, H.Z.; Mo, Z.L.; Feng, S.M. Mycobacterium marinum is the causative agent of splenic and renal granulomasin half-smooth tongue sole (Cynoglossus semilaevis Günther) in China. Aquaculture 2018, 490, 203–207. [Google Scholar] [CrossRef]
  20. Luo, Z.; Hao, S.; Bai, X.H.; Zhang, Z.G.; Ma, Y.F.; Feng, S.M.; Zhang, D.F. Isolation, identification, and genomic analysis of Mycobacterium ulcerans ecovar Liflandii from the farmed Chinese tongue sole, Cynoglossus semilaevis Günther. Aquaculture 2022, 548, 737614. [Google Scholar] [CrossRef]
  21. Talaat, A.M.; Reimschuessel, R.; Trucksis, M. Identification of mycobacteria infecting fish to the species level using polymerase chain reaction and rest riction enzyme analysis. Vet. Microbiol. 1997, 58, 229–237. [Google Scholar] [CrossRef]
  22. Zhang, D.F.; Ji, C.; Zhang, X.J.; Li, T.T.; Li, A.H.; Gong, X.N. Mixed mycobacterial infections in farmed sturgeons. Aquac. Res. 2015, 46, 1914–1923. [Google Scholar] [CrossRef]
  23. Gauthier, D.T.; Rhodes, M.W. Mycobacteriosis in fishes: A review. Vet. J. 2009, 180, 33–47. [Google Scholar] [CrossRef]
  24. Kusunoki, S.; Ezaki, T. Proposal of Mycobacterium peregrinum sp. Nov., nom. rev., and elevation of Mycobacterium chelonae subsp. abscessus (Kubica et al.) to species status: Mycobacterium abscessus comb. nov. Int. J. Syst. Bacteriol. 1992, 42, 240–245. [Google Scholar] [CrossRef] [PubMed]
  25. Daoust, P.Y.; Larson, B.E.; Johnson, G.R. Mycobacteriosis in yellow perch (Perca flavescens) from two lakes in Alberta. J. Wildl. Dis. 1989, 25, 31–37. [Google Scholar] [CrossRef] [PubMed]
  26. Bruno, D.W.; Griffiths, J.; Mitchell, C.G.; Wood, B.P.; Fletcher, Z.J.; Drobniewski, F.A.; Hastings, T.S. Pathology attributed to Mycobacterium chelonae infection among farmed and laboratory-infected Atlantic salmon Salmo salar. Dis. Aquat. Organ. 1998, 33, 101–109. [Google Scholar] [CrossRef] [PubMed]
  27. Whipps, C.M.; Matthews, J.L.; Kent, M.L. Distribution and genetic characterization of Mycobacterium chelonae in laboratory zebrafish Danio rerio. Dis. Aquat. Organ. 2008, 82, 45–54. [Google Scholar] [CrossRef]
  28. Clarke, E.O., 3rd; Dorn, B.; Boone, A.; Risatti, G.; Gilbert-Marcheterre, K.; Harms, C.A. Mycobacteriosis, Mycobacterium chelonae, in a captive yellow stingray (Urobatis jamaicensis). J. Zoo Wildl. Med. 2013, 44, 470–474. [Google Scholar] [CrossRef] [PubMed]
  29. Antuofermo, E.; Pais, A.; Nuvoli, S.; Hetzel, U.; Burrai, G.P.; Rocca, S.; Caffara, M.; Giorgi, I.; Pedron, C.; Prearo, M. Mycobacterium chelonae associated with tumor-like skin and oral masses in farmed Russian sturgeons (Acipenser gueldenstaedtii). BMC Vet. Res. 2014, 10, 18. [Google Scholar] [CrossRef]
  30. Tuxbury, K.A.; Young, S.A.; Bradway, D.S.; Marola, J.L.; Salfinger, M.; Garner, M.M. Acute disseminated mycobacteriosis in captive Atlantic guitarfish (Rhinobatos lentiginosus). J. Vet. Diagn. Investig. 2017, 29, 935–938. [Google Scholar] [CrossRef]
  31. Ishii, Y.; Kawakami, H.; Mekata, T.; Sugiyama, A. Histopathological Features of Mycobacterium chelonae infection in two farmed Japanese pufferfish (Takifugu rubripes). J. Comp. Path. 2019, 170, 86–90. [Google Scholar] [CrossRef]
  32. Janik, A.J.; Whipps, C.M. Differences in susceptibility to Mycobacterium chelonae in zebrafish (Danio rerio) lines commonly used in scientific Research. J. Fish Dis. 2022, 45, 435–443. [Google Scholar] [CrossRef] [PubMed]
  33. Nogueira, C.L.; Whipps, C.M.; Matsumoto, C.K.; Chimara, E.; Droz, S.; Tortoli, E.; Freitas, D.; Cnockaert, M.; Palomino, J.C.; Martin, A.; et al. Mycobacterium saopaulense sp nov., a rapidly growing mycobacterium closely related to members of the Mycobacterium chelonae-Mycobacterium abscessus group. Int. J. Syst. Evol. Microbiol. 2015, 65, 4403–4409. [Google Scholar] [CrossRef] [PubMed]
  34. Kim, B.J.; Kim, B.R.; Jeong, J.; Lim, J.H.; Park, S.H.; Lee, S.H.; Kim, C.K.; Kook, Y.H.; Kim, B.J. A description of Mycobacterium chelonae subsp. gwanakae subsp. nov., a rapidly growing mycobacterium with a smooth colony phenotype due to glycopeptidolipids. Int. J. Syst. Evol. Microbiol. 2018, 68, 3772–3780. [Google Scholar] [CrossRef] [PubMed]
  35. Inkster, T.; Peters, C.; Seagar, A.L.; Holden, M.T.G.; Laurenson, I.F. Investigation of two cases of Mycobacterium chelonae infection in haemato-oncology patients using whole-genome sequencing and a potential link to the hospital water supply. J. Hosp. Infect. 2021, 114, 111–116. [Google Scholar] [CrossRef]
  36. Talaat, A.M.; Reimschuessel, R.; Wasserman, S.S.; Trucksis, M. Goldfish, Carassius auratus a novel animal model for the study of Mycobacterium marinum pathogensis. Infect. Immun. 1998, 66, 2938–2942. [Google Scholar] [CrossRef]
  37. Bright, M.; Bulgheresi, S. A complex journey: Transmission of microbial symbionts. Nat. Rev. Microbiol. 2010, 8, 218–230. [Google Scholar] [CrossRef]
  38. Svoboda, J.; Mrugała, A.; Kozubíková-Balcarová, E.; Petrusek, A. Hosts and transmission of the crayfish plague pathogen Aphanomyces astaci: A review. J. Fish Dis. 2017, 40, 127–140. [Google Scholar] [CrossRef]
  39. Alizon, S. Parasite co-transmission and the evolutionary epidemiology of virulence. Evol. Int. J. Org. Evol. 2013, 67, 921–933. [Google Scholar] [CrossRef]
  40. Chang, C.T.; Doerr, K.M.; Whipps, C.M. Antibiotic treatment of zebrafish mycobacteriosis: Tolerance and efficacy of treatments with tigecycline and clarithromycin. J. Fish Dis. 2017, 40, 1473–1485. [Google Scholar] [CrossRef]
Fishes 08 00225 g001 550
Figure 1. Seahorse showing typical symptoms of disease. (A) The body color of the diseased seahorse was faded, the body were swollen; (B,C) loose, empty and translucent intestinal tract (★), swollen liver and kidney, with abundant white granulomas observed in the liver and kidneys (→).
Figure 1. Seahorse showing typical symptoms of disease. (A) The body color of the diseased seahorse was faded, the body were swollen; (B,C) loose, empty and translucent intestinal tract (★), swollen liver and kidney, with abundant white granulomas observed in the liver and kidneys (→).
Fishes 08 00225 g001
Fishes 08 00225 g002 550
Figure 2. Histological sections of the organs of diseased seahorses. (A,E,J) Liver, kidney, and intestinal tract of a disease-free seahorse for comparison. (B) Liver, showing a large number of hepatocytes replaced by adipocytes (→), hepatocyte necrosis (★), and accumulation of red blood cells (Fishes 08 00225 i001). (C) Liver, showing hepatocyte necrosis (★) and granuloma (Fishes 08 00225 i001). (D) Liver, showing granulomatous tissue that had calcified and was encapsulated by fibroblasts (Fishes 08 00225 i001). (F) Kidney, showing necrosis (★), and the epithelial cells of the renal tubule with granule denaturation (→). (G) Kidney, showing macrophage infiltrates. (H) Kidney, showing a large number of acid-fast bacilli within granuloma (Ziehl–Neelsen staining). (I) Kidney, showing coalescing granuloma (Fishes 08 00225 i001). (K) Intestine, showing the mucosal layer and the muscle layer were separated (→), the intestinal villi and intestinal mucosal tissue rotted and falling off (★), and small granuloma (Fishes 08 00225 i001) (L) ovary, showing egg degeneration and necrosis.
Figure 2. Histological sections of the organs of diseased seahorses. (A,E,J) Liver, kidney, and intestinal tract of a disease-free seahorse for comparison. (B) Liver, showing a large number of hepatocytes replaced by adipocytes (→), hepatocyte necrosis (★), and accumulation of red blood cells (Fishes 08 00225 i001). (C) Liver, showing hepatocyte necrosis (★) and granuloma (Fishes 08 00225 i001). (D) Liver, showing granulomatous tissue that had calcified and was encapsulated by fibroblasts (Fishes 08 00225 i001). (F) Kidney, showing necrosis (★), and the epithelial cells of the renal tubule with granule denaturation (→). (G) Kidney, showing macrophage infiltrates. (H) Kidney, showing a large number of acid-fast bacilli within granuloma (Ziehl–Neelsen staining). (I) Kidney, showing coalescing granuloma (Fishes 08 00225 i001). (K) Intestine, showing the mucosal layer and the muscle layer were separated (→), the intestinal villi and intestinal mucosal tissue rotted and falling off (★), and small granuloma (Fishes 08 00225 i001) (L) ovary, showing egg degeneration and necrosis.
Fishes 08 00225 g002
Fishes 08 00225 g003a 550Fishes 08 00225 g003b 550
Figure 3. Phylogenetic tree constructed for strains HM-2021-1 and HM-2021-2 based on the 16S rDNA (A), Hsp65 (B), and rpoB (C) genes sequences of related mycobacterium spp. The phylogenetic tree was constructed with the neighbor-joining method (MEGA v.4.1 software). The bootstrap values (>50%) of 1000 simulations are indicated at the branches. The bar indicates the percentage difference.
Figure 3. Phylogenetic tree constructed for strains HM-2021-1 and HM-2021-2 based on the 16S rDNA (A), Hsp65 (B), and rpoB (C) genes sequences of related mycobacterium spp. The phylogenetic tree was constructed with the neighbor-joining method (MEGA v.4.1 software). The bootstrap values (>50%) of 1000 simulations are indicated at the branches. The bar indicates the percentage difference.
Fishes 08 00225 g003aFishes 08 00225 g003b
Fishes 08 00225 g004 550
Figure 4. Cumulative mortalities of the healthy seahorses experimentally infected by isolate HM-2021-1 (test group 1) and HM-2021-2 (test group 2).
Figure 4. Cumulative mortalities of the healthy seahorses experimentally infected by isolate HM-2021-1 (test group 1) and HM-2021-2 (test group 2).
Fishes 08 00225 g004
Table
Table 1. PCR primers used in this study.
Table 1. PCR primers used in this study.
PrimerSequence (5′→3′)Length (bp)Application
T39GCGAACGGGTGAGTAACACG936Test Mycobacteria sp by nested PCR
T13TGCACACAGGCCACAAGGGA
preT43AATGGGCGCAAGCCTGATG300–312
T531ACCGCTACACCAGGAAT
27FAGAGTTTGATCMTGGCTCAG1480–1494Clone 16S rDNA gene
1492RTACGGYTACCTTGTTACGACTT
Myco-FGGCAAGGTCACCCCGAAGGG752–761Clone rpoB gene
Myco-RAGCGGCTGCTGGGTGATCATC
Hsp-FATCGCCAAGGAGATCGAGCT644Clone hsp65 gene
Hsp-RAAGGTGCCGCGGATCTTGTT
Table
Table 2. Key biochemical characteristics of strains HM-2021-1 and HM-2021-2.
Table 2. Key biochemical characteristics of strains HM-2021-1 and HM-2021-2.
TestsMycobacterium chelonaeMycobacterium marinum Strain myco001Mycobacterium ulcerans Strain BS123HM-2021-1HM-2021-2
Pigmentation production-photochromogenicphotochromogenic--
5% NaCl growth-----
Nitrate reductase activity-----
Tween-80 hydrolysis-++--
Urease+++++
Catalase at 68 °C+++++
Arylsulfatase activity +++++
Rate of growthrapidslowslowrapidrapid
Table
Table 3. Part of the bacterial strains used for phylogenetic tree construction.
Table 3. Part of the bacterial strains used for phylogenetic tree construction.
OrganismNCBI No.SourceGeographic
Location
M. saopaulense FMS-15MK396591-Korea
M. saopaulense P9-C11MK318570-China
M. saopaulense EPM10906 NR145859patientBrazil
M. chelonae M77CP041150cowIndia
M. chelonae ATCC 19237 AY457082-France
M. chelonae 55 OP899898patientIran
M. chelonae CIP 104535T AY457072-France
M. abscessus subsp. massiliense XM358 ON194488-China
M. abscessus subsp. massiliense XA75 ON194450-China
M. chelonae MCHE08CP058976patientSwitzerland
M. chelonae Myco1CP050223patientUSA
Note: “-” indicate unknown.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Bai, X.; Hao, S.; Fu, J.; Sun, H.; Luo, Z. Identification of Mycobacterium chelonae from Lined Seahorse Hippocampus erectus and Histopathological Analysis. Fishes 2023, 8, 225. https://doi.org/10.3390/fishes8050225

AMA Style

Bai X, Hao S, Fu J, Sun H, Luo Z. Identification of Mycobacterium chelonae from Lined Seahorse Hippocampus erectus and Histopathological Analysis. Fishes. 2023; 8(5):225. https://doi.org/10.3390/fishes8050225

Chicago/Turabian Style

Bai, Xiaohui, Shuang Hao, Jianping Fu, Hanchang Sun, and Zhang Luo. 2023. "Identification of Mycobacterium chelonae from Lined Seahorse Hippocampus erectus and Histopathological Analysis" Fishes 8, no. 5: 225. https://doi.org/10.3390/fishes8050225

Article Metrics

Back to TopTop