Effects of Stocking Density of the River Shrimp Cryphiops caementarius on Physiological and Performance Responses in a Biofloc System

Abstract

This study aimed to evaluate and compare the effects of biofloc technology (BFT) and clear water (CW) on water quality physiological and productive performance of juvenile freshwater Northern River shrimp, Cryphiops caementarius under three stocking densities (100, 200, and 400 shrimp m⁻²). Shrimp with an initial body weight of 0.44 ± 0.07 g were stocked in 18 rectangular fiberglass tanks with a water volume 150 L for 290 days. During the experiment, water quality parameters stayed within acceptable ranges for shrimp growth. The highest survival rate was recorded in BFT treatments; however, the growth performance of shrimp in the treatments with the lowest stocking density was higher than that with the highest stocking density, regardless of whether BFT or CW was used. Transcriptional levels of heat shock protein (Hsp70) and superoxide dismutase (SOD) showed significant differences (p < 0.05) between treatments, particularly in BFT. These results indicate that an initial stocking density of 200 shrimp m⁻² appears to be appropriate for shrimp juveniles cultured in a BFT system. Thus, this technology emerges as an effective tool for river shrimp farmers looking to increase their stocking densities and improve the efficiency of their production systems in arid zones.

1. Introduction

The shrimp farming model has undergone drastic changes over the past decade, shifting from extensive systems with low production and large ponds to intensive systems with smaller ponds that offer greater control and biosecurity [1]. In shrimp production intensification, the density of the shrimp population remains the most important parameter [2,3,4]. The ideal stocking density can vary depending on factors such as species, life stage, culture system, management practices, and environmental parameters [5,6]. High density is often employed in commercial farming systems to optimize the use of available space, achieve maximum production rates, and minimize rearing expenses [7]. However, while increasing stocking densities can enhance productivity, excessively high densities can create a stressful environment for the shrimp, affecting their performance due to reduced space, limited food availability, cannibalism, increased susceptibility to pathogen outbreaks, water quality degradation, and accumulation of organic matter in the tanks [8,9,10,11,12,13,14]. Conversely, densities below optimal levels can reduce overall productivity by not utilizing all available space [15]. Increasing stocking density in an intensive aquaculture system necessitates the use of advanced aquaculture techniques and technologies to address these challenges [16]. In recent years, special attention has been given to the biofloc culture system, also known as biofloc technology (BFT), as a promising tool for sustainable shrimp aquaculture [17,18]. BFT has been widely applied worldwide to reduce environmental impact and production cost through a well-managed heterogeneous mixture of heterotrophic bacteria, microalgae, food, fecal remnants, exoskeletons, zooplankton into grown flocs and its ability to maintain good water quality [19,20]. The fundamental principle of BFT is to recycle waste nutrients, particularly inorganic nitrogen resulting from uneaten feed and feces, into microbial biomass by steering high the Carbon:Nitrogen ratio of the water through the modification of carbohydrate content in feed or by adding a carbon source to the water [21,22,23]. This process improves water quality and enhances water use efficiency by minimizing water turnover, among other benefits such as complementary feeds to the formulated diet, increased biosecurity, growth and survival [24,25,26,27,28]. BFT is considered one of the best aquaculture systems for intensive shrimp culture [29,30]. Additionally, BFT provides several immunological enhancements in penaeid shrimp due to its probiotic effects improving the non-specific immune system and resistance against infections and stress [31,32,33,34]. In BFT systems, shrimp stocking density can be increased beyond that of clear water systems [35,36,37,38]; thus, under higher stocking density conditions compared to clear water, shrimp welfare is not adversely affected, and they can still grow well [39,40,41].

Growing interest in sustainable production emphasizes the need to develop native species for aquaculture [42]. The native palaemonid species Cryphiops caementarius, known as the “Northern River shrimp”, is a subtropical freshwater species [43,44]. The geographical distribution of this South American caridean spans the rivers along west coast of Peru and Chile from the Taymi River in Peru (6 °S) to the Maipo River in Chile (33 °S) [45,46]. C. caementarius has market recognition due to its consistent exploitation through artisanal fishing in Chile and Peru [44,47,48]. However, its populations have significantly declined due to pollution, destruction of natural ecosystems, and anthropogenic activities such as mining and fishing pressure [49,50]. C. caementarius has been listed as vulnerable by the Ministerio de Medio Ambiente of Chile [51] and has been included in the red list of threatened species (https://www.iucnredlist.org, accessed on 12 May 2024). The rearing of C. caementarius is an alternative not only for conservation purposes but also for production purposes, making it a candidate for aquaculture diversification in semi-desert regions of northern Chile. In addition, BFT is relevant for implementing land-based aquaculture systems for C. caementarius that are more environmentally friendly and reduce water use [52,53].

In BFT, optimizing stocking density is a crucial factor that should be carefully studied. The appropriate stocking density varies for each species based on its feeding patterns, growth rate, management practices, and stress tolerance [6,54,55]. Moreover, maintaining an appropriate stocking density is essential for biofloc dynamics, as it ensures an adequate nutrient supply to support the formation of bioflocs and the microbial community responsible for water quality management and nutrient cycling [28,37]. Stocking density significantly affects the metabolism, immune function, growth, hematology, and stress levels of aquatic organisms [56,57,58,59]. Hence, the objectives of this study were to investigate the effects of stocking density on water quality, physiological responses, and production performance of C. caementarius cultured at different densities and to determine the optimal stocking density for shrimp culture.

2. Materials and Methods

2.1. Experimental Design and Conditions

The experiment was carried out from January to November 2020 (290 days) at the Crustacean laboratory at the Universidad Católica del Norte, Coquimbo, Chile (29°57′ S 71″57′ S–71°21′ W). The experiment was applied in a 2 × 3 factorial design consisting of two treatment systems, Biofloc (B) and clear water (CW), and three stocking densities (100, 200, and 400 shrimp m⁻²). Three replicate tanks were randomly assigned to each treatment. The juveniles used in this research came from naturally spawned domesticated shrimp broodstock in the laboratory. The shrimp were acclimatized to local rearing conditions for one week prior to the start of the experiment. The shrimp were stocked at an initial mean weight of 0.44 ± 0.07 g. and randomly distributed into eighteen fiberglass rectangular tanks (107 × 63 × 45 cm) with a water effective volume of 150 L. A hydraulic aeration pipe was connected to a Sweetwater brand 2.5 HP blower, and two rubber/polyethylene (Aero-tube™ Colorite Aero-Tube, Ridgefield, CT, USA) air diffuser hoses were placed in each of the rearing tanks. The culture water temperature was controlled with submersible 200-watt heaters (Whale VK-1000, Zhongshan Enjoyroyal Appliance Co., Ltd., Guangdong, China) set to maintain the temperature at 23 ± 1 °C. The BFT culture system was composed of 3 experimental units that independently interconnected to a 250 L reserve circular tank (90 diameter × 80 cm) and fiberglass rectangular settling tanks (90 × 55 × 47 cm), equipped with one aquarium pump (Submersible Pump, Atman model AT-105, Guangzhou Ample Technology Co., Ltd., Zhongshan, China) to circulate the water (Qmax. 3000 L h⁻¹) with the objective of maintaining both the water quality and the quali-quantitative profile of the planktonic community equally in all experimental units, avoiding the negative influence of these factors in the experiment [60,61]. Each experimental unit BFT was inoculated with 150 L of a biofloc solution taken from another BFT tank, which was already mature. The organic carbon source (liquid molasses, 30% carbon) was added daily to maintain a 15:1 C:N ratio [21,62]. The carbon source was mixed with tank water in a beaker and evenly distributed throughout each of the selected tanks. In clear water groups, a regular water exchange at a level of 80% of the total volume was performed once a week, whereas in BFT groups, clean freshwater was only added to replace loss due to evaporation. The water used was collected from the municipal water supply network, remaining for 24 h with continuous aeration to complete the dechlorination process. In both systems, six to ten PVC pipe shelters (10 cm × 32 inches) were placed in each tank.

The shrimp were fed with a commercial rainbow trout feed (BioMar, Puerto Montt, Chile) twice a day (09:00 and 16:00 h) at 5% biomass. The nutritional composition of the commercial diet consisted of 48.5% crude protein, 18.5% crude lipid, 1.9% crude fiber, 12% ash, and 10% moisture.

2.2. Water Quality Parameters

The dissolved oxygen concentration, temperature, and pH were monitored daily using a HACH multiparameter model HQ40d. Total ammonia as nitrogen (TAN), nitrate as nitrogen, nitrite as nitrogen, phosphorus, total suspended solids (TSS), biofloc volumes (FV), and total alkalinity were monitored once a week. TAN measurements were carried out by method 8155(salicylate method, 0.01 to 0.50 mg L⁻¹ NH₃−N), nitrite as nitrogen by method 8507 (Diazotization method, 0 to 0.300 mg L⁻¹ NO₂−N), nitrate as nitrogen by method 8039 (Cadmium Reduction Method, 0 to 30.0 mg L⁻¹ NO₃−N) and phosphorus (Ascorbic Acid Method 0.02 to 3.00 mg L⁻¹ PO₄⁻³) with reagents purchased from Hach Company. Water samples were quantified for TAN, nitrite-N, nitrate-N, and phosphorus on a Hach DR 3900 Spectrophotometer using the Hach program: 385 (wavelength 655 Nm), 355 (Wavelength 500 Nm), 371 (Wavelength 507 Nm) and 485 (Wavelength 530 Nm) respectively [63]. Concerning the solids analyses, the method 2540-D described by the American Public Health Association [64] was used for TSS, and for the biofloc volume (FV), a sample of 1 L of water with bioflocs was taken directly from the rearing tanks and poured into Imhoff cones (1000-0010 Vitlab, Grossostheim, Germany). Then, it was left to stand still for 20–30 min, and after this period, the volume of the settled plug was read [65]. Total alkalinity was determined using the titration method Bromophenol blue, with the HI3811 alkalinity kit (Hanna Instruments, Smithfield, RI, USA). Solids control was done weekly, always maintaining the ranges described as suitable for shrimp culture.

2.3. Shrimp Performance

Biometrics were performed every two months to monitor the growth of the shrimp under each density treatment throughout the study (n = 30 shrimp per tank), using a digital scale with two decimal places (Mettler PJ3600 DeltaRange). Excess moisture was removed from each organism with paper before weighing. The average weight of the shrimp was calculated, and the amount of feed supplied was adjusted. At the end of the experiment, the following performance parameters were evaluated: Specific growth rate (SGR) = (lnTW₂ — lnTW₁) × 100/(T₂ —T₁); were TW₁ and TW₂ are total weight at days T₁ (start of the experiment) and T₂ (after 290 days); survival rate (SR%) = final shrimp number/initial shrimp number) × 100; feed conversion ratio (FCR) = offered feed (g)/(final biomass (g)—initial biomass (g)); Final mean weight (g): ∑ final weight of live animals (g)/total number of animals; total biomass (g): ∑ final weight of all live animals (g).

2.4. Total RNA Extraction and Gene Expression Analysis by qPCR

Twelve shrimp were randomly collected from each density at the end of the experiment, and gill tissue collected from each animal was placed in 2 mL eppendorf tubes and stored at −80 °C. Total RNA was separately extracted using a Trizol^® reagent kit (Ambion, Austin, TX, USA) according to the manufacturer’s instructions. Obtained RNA concentration and purity were verified by measuring absorbances at 260 and 280 nm by spectrophotometry using an Epoch microplate spectrophotometer (Biotek, Winooski, VT, USA), and the integrity was assessed by agarose gel electrophoresis. cDNA was obtained using 0.8 μg of total RNA and PrimeScript™ RT reagent Kit with gDNA Eraser (Takara, San Jose, CA, USA), following the manufacturer’s indications. The obtained cDNA was stored at −20 °C until further use.

The expression levels of genes, including heat shock protein 70 (Hsp70), superoxide dismutase (SOD), and elongation factor (ELF₁), were measured by RT-qPCR using the Real-Time PCR System Agilent Technologies (Stratagene MX3000P, La Jolla, CA, USA). The primers used for qPCR are shown in

Table 1. List of primers sequences used to study mRNA expression of the gene in river shrimp (Criphiops caementarius) by RT-qPCR.

Genes	Forward Primer (5′-3′)	Reverse Primer (5′-3′)
ELF1	TGCGGTGGTATTGACAAGAGA	GAACCCTTGCCCATTTCACTG
Hsp70	GGTGGTGTAATGACTGCCCTTA	GAATAGGTGGTGAAGGTCTGGG
SOD	CCTACGTTGCCAGCATCACT	AGTCGTACTTCAGGGAGGAA

. RT-qPCR was performed using 20 μL of reaction volume containing 2 μL of cDNA, 0.6 μL of each primer (10 mM), and 10 μL of Takyon Low ROX SYBR 2× (Nalgene, Rochester, NY, USA). Samples were tested in triplicate. Initial denaturing time was 3 min at 95 °C, 40 cycles at 95 °C (15 s) and 60 °C (30 s), and an extension of 15 s at 95 °C, 15 s at 55 °C, and 15 s at 95 °C. The elongation factor (ELF₁) was used as a housekeeping gene [66]. The analysis of gene expression was performed by comparative threshold cycle method 2ΔΔct [67].

2.5. Statistical Analysis

The results of water quality, survival, and gene expression were analyzed using a two-way ANOVA, followed by a Tukey’s test. Before analyses, data were assessed for normality and homogeneity of variance with the Shapiro-Wilk test and Fligner-Killeen test, respectively [68]. For growth, a non-parametric Kruskal-Wallis test was performed, followed by the Wilcoxon test. For the analysis of Hsp70 and SOD gene expression, the data were transformed to square root and log base 10, respectively. Survival data were arcsine transformed. The level of significance was (p < 0.05). The data was expressed as means ± standard error (X ± SE). The free computer package RStudio, Inc. (Version 1.1.442) was used for the analyses [69].

3. Results

3.1. Water Quality

The results of the water quality of the physicochemical parameters in the culture systems with their respective densities are shown in

Table 2. Water quality parameters of river shrimp (Criphiops caementarius) in biofloc system (B) and clear wáter (CW) with different densities during the experimental period.

	Biofloc (B)			Clear-Water (CW)
Parameters	Stocking Density (Shrimp m−2)
	100	200	400	100	200	400
Temperature °C	22.68 ± 0.06	22.23 ± 0.06	22.54 ± 0.06	22.31 ± 0.06	22.52 ± 0.06	22.69 ± 0.06
OD (mg L −1)	8.71 ± 0.02	8.73 ± 0.02	8.70 ± 0.02	8.76 ± 0.02	8.73 ± 0.02	8.67 ± 0.02
pH	8.57 ± 0.01	8.50 ± 0.01	8.29 ± 0.01	8.45 ± 0.01	8.41 ± 0.01	8.38 ± 0.01
TAN (NH3−N mg L −1)	0.08 ± 0.01	0.06 ± 0.01	0.09 ± 0.01	0.04 ± 0.01	0.06 ± 0.01	0.06 ± 0.01
Nitrite (NO2−N mg L −1)	0.03 ± 0.01	0.04 ± 0.01	0.03 ± 0.01	0.01 ± 0.01	0.01 ± 0.01	0.02 ± 0.01
Nitrate (NO3−N mg L −1)	73.52 ± 2.60 a	68.98 ± 3.13 a	71.69 ± 4.04 a	4.30 ± 0.02 b	5.01 ± 0.03 b	7.12 ± 0.12 b
Phosphate (PO4−3mg L−1)	4.86 ± 0.49 b	6.16 ± 0.74 a	7.21 ± 0.92 a	2.76 ± 0.79 c	3.91 ± 0.58 b	4.34 ± 0.71 b
Alkalinity (CaCO3 mg L−1)	253 ± 4.64 a	234 ± 6.56 a	165 ± 4.78 b	167 ± 5.02 b	174 ± 3.58 b	173 ± 3.87 b
FV (mL L−1)	12.52 ± 0.66 b	12.68 ± 0.86 b	15.09 ± 0.73 a	2.64 ± 0.69 c	3.59 ± 1.34 c	6.87 ± 1.64 c
TSS (mg L−1)	154 ± 8.53 c	189 ± 5.63 b	295 ± 12. 31 a	11.43 ± 1.24 e	11.54 ± 0.26 e	34.21 ± 0.24 d
VSS (mg L−1)	109 ± 5.63 c	141 ± 2.18 b	161 ± 5.52 a	7.98 ± 0.17 e	9.76 ± 0.16 e	21.02 ± 0.23 d

The different letters indicate significant differences (p < 0.05) among treatments in the same row as the Tukey test. OD, dissolved oxygen; TAN, total ammonia nitrogen; FV, Floc volume; TSS, total suspended solids; VSS, volatile suspended solids.

. Temperature, oxygen, pH, TAN, and nitrite did not present significant differences between technologies and their different densities (p > 0.05). The temperature was kept at 22.49 ± 0.06 °C, and oxygen was maintained higher than 6.62 mg L⁻¹ pH ranged between 8.44 ± 0.02, TAN kept around 0.07 ± 0.01 mg L⁻¹ and nitrite 0.03 ± 0.01 mg L⁻¹. Nitrate, phosphorus, alkalinity, FV, SST, and SSV showed significant differences between the culture technologies (p < 0.05). A higher concentration of nitrate was observed in the BFT in all their densities, but there were no significant differences between them (p > 0.05). Phosphorus, VF, SST, and SSV, the highest levels, were found at the density of 400 shrimp m⁻² with BFT and the lowest at the density of 100 shrimp m⁻² of CW.

3.2. Zootechnical Performance Responses

At the start of the experiment, there was no difference in shrimp performance between juveniles from different treatments (p > 0.05).

Table 3. Performance parameters of river shrimp (Criphiops caementarius) in biofloc system (B) and clear water (CW) with different densities during the experimental period.

	Biofloc (B)			Clear-Water (CW)
Parameters	Stocking Density (Shrimp m−2)
	100	200	400	100	200	400
Initial weight (g)	0.44 ± 0.07	0.44 ± 0.07	0.44 ± 0.07	0.44 ± 0.07	0.44 ± 0.07	0.44 ± 0.07
Final weight (g)	4.18 ± 0.43 a	2.15 ± 0.26 b	1.51 ± 0.24 c	3.91 ± 0.40 a	2.08 ± 0.33 b	1.36 ± 0.26 c
Initial biomass (g)	20.52 ± 0.13 c	41.93 ± 0.31 b	76.18 ± 0.76 a	20.11 ± 0.23 c	42.52 ± 0.16 b	75.63 ± 0.77 a
Final biomass (g)	34.84 ± 3.11 c	62.57 ± 2.44 b	75.73 ± 4.92 a	18.24 ± 3.7 d	36.14 ± 4.24 c	58.12 ± 3.45 b
SR (%)	25.67 ± 1.45 b	37.67 ± 1.33 a	28.00 ± 4.34 b	16.66 ± 3.32 c	15.33 ± 2.12 c	15.76 ± 0.73 c
SGR (% d−1)	0.80 ± 0.07 a	0.56 ± 0.09 b	0.48 ± 0.10 c	0.78 ± 0.09 a	0.55 ± 0.11 b	0.44 ± 0.15 c
FCR	8.94 ± 0.27 b	10.06 ± 0.24 a	UD	UD	UD	UD

The different letters indicate significant differences (p < 0.05) among treatments in the same row as the Tukey test. SR, Survival rate; SGR, Specific growth rate; FCR, feed conversion ratio; UD; undetermined.

shows the improvements in mean growth performance resulting from various treatments. However, significant differences in survival, weight gain, specific growth rate, and feed conversion rate were noted between culture technologies and shrimp densities at the experiment’s end (p < 0.05). Survival was a crucial factor influencing the determination of productive indices, reducing the power to establish final values and determine significant differences between treatments. Nonetheless, results suggest that BFT technology positively affects growth, specific growth rate, and feed conversion factor of juvenile C. caementarius. In general, survival was significantly higher in shrimp from biofloc treatments across all stocking densities compared to CW groups (p < 0.05). The survival rate of B200 was (p < 0.05) higher (37.67%) than other groups 28.00%, (B400); 25.67% (B100) compared to the CW groups (16.66–15.33%). The mean weight of shrimp in the treatments with the lowest stocking density was higher than that with the highest stocking density, independently from BFT and CW in the system. Values SGR were reduced significantly (p < 0.05) in shrimp reared at a high stocking rate (400 shrimp m⁻²) when compared with other groups.

3.3. Expression of Genes

The heat shock protein 70 KDa (Hsp70) exhibited similar patterns across the 100, 200, and 400 shrimp m⁻² BFT-treated tanks. Notably, gene expression in the high-density CW group (400 shrimp m⁻²) was significantly higher than in the low (100 shrimp m⁻²) and medium (200 shrimp m⁻²) density group in both culture systems (p < 0.05) (Figure 1A). Conversely, superoxide dismutase (SOD) levels decreased with increasing CW culture density, reaching the lowest levels in the high-density group. Specifically, the SOD gene showed higher expression in the 100 m⁻² shrimp treatment in CW (0.89 ± 0.26), significantly differing from other culture densities (p < 0.05) (Figure 1B).

4. Discussion

It is well known that while increasing population density can negatively affect water quality [12,70,71,72]. In our study, the water quality parameters did not affect the zootechnical performance of the shrimp during the experiment. Water quality parameters remained stable and within the optimal values for the development of C. caementarius in both culture conditions [48,73,74,75,76]. Regarding the biofloc system, the ammonia levels were kept under control in the system, both through assimilation by heterotrophic bacteria and by oxidation of this compound by nitrifying bacteria, as indicated by the accumulation of nitrate [77,78,79]. In addition, nitrate is relatively non-toxic to aquatic organisms, unlike nitrite or ammonia [80]. In the present study, nitrite levels were lower than the recommended levels of less than 0.5 mg L⁻¹ in shrimp farms [81]. Nitrate was below the levels of 75 mg L⁻¹, which is considered to affect the welfare and growth of the farmed animal [82]. The mean dissolved oxygen (DO) content in all the treatments was above 5 mg L⁻¹, which is the optimum recommended for shrimp culture and required for bacteria for the nitrification process [83,84]. It also plays a dominant role in the growth of heterotrophic bacteria [62]. The pH present in the BFT culture systems with different densities was in the range of 7.0 to 9.0, which favors the growth of heterotrophic and nitrifying bacteria [85]. In addition, pH values lower than 6.0 or higher than 10 could be harmful to shrimp gills [86]. Alkalinity was above 150 mg CaCO₃ L⁻¹ which is a recommended value in closed systems because the process of ammonium oxidation to nitrate consumes alkalinity [62]. These high alkalinity levels prevented pH fluctuations, and favored biofloc formation and the development of nitrifying bacteria [87,88]. Phosphorus concentration was at higher levels in the BFT than in the CW; this is because it tends to accumulate in these systems [89]. Within the BFT culture, an increase of this compound is observed in the systems that have a higher density, probably because a greater amount of food was added to these systems, which is the main source of this compound, and to the decomposition of the excreta of the animals [90,91].

In the BFT systems, the FV was around 15 mL L⁻¹ which is the recommended value for shrimp by Hargreaves [78]. Higher levels of bioflocs might lead to clogging gills and result in the death of the organisms [92]. Regarding TSS, the optimal range for shrimp should be between 200–500 mg L⁻¹ [93,94]; values exceeding 500 mg L⁻¹ can interfere with water quality parameters and shrimp production rates [77], while values below 200 mg L⁻¹ result in decreased ammonia removal due to slow nitrification by autotrophic bacteria [95]. The difference in TSS and SSV in BFTs is probably due to a higher number of heterotrophic bacteria, which assimilate ammonia nitrogen and utilize molasses as an energy source to build cell biomass and protein [77,96], leading to an accumulation of solids in the water column [97]. In contrast, the water parameters in the clear water ponds were kept low mainly by a constant water replacement strategy [98].

It has been widely documented that the stocking density in shrimp farming affects the productive indices of the animals [92,99,100,101,102,103]. Since this is a potential source of chronic stress that can affect the health and behavior of farmed organisms, it is a critical factor in intensive aquaculture management [8,9]. In general, it has been described that shrimp farming in BFT conditions improves productivity, average body weight, survival, and low FCR compared to CW. However, as stocking density increases, growth would decrease even under BFT [89,104]. Results from the current study reconfirmed the growth was affected significantly only by the stocking density (p < 0.05). The highest growth values were observed in shrimp reared in treatments with the lowest density, indicating that as stocking density increases, the growth and welfare of juvenile shrimp are negatively affected [4,105,106]. Regarding culture density, it has been suggested that higher population densities generally result in a lower survival rate [25,106,107,108]. In our case, this trend is not very marked, but significant differences are observed in the density of 200 shrimp m⁻² in BFT. Our results showed lower SR compared with other shrimp species, and this may be attributed to the fact that C. camentarius exhibits territorialism and cannibal behavior [109,110], similar to other territorial species such as M. rosenbergii [111,112,113], Cherax quadricarinatus and P. semisulcatus [114,115]. This demonstrates that high stocking densities affect survival due to competition and cannibalism. In addition, the fact of sharing the same space, different social mechanisms could have regulated growth, causing a combination of the following effects: Aggressiveness and social hierarchy; aggressive interactions and established hierarchies; hyperactivity of subordinate individuals: mechanisms of social control; molt loss: molt deprivation and early sexual maturation: non-dominant males stop their somatic growth [116,117,118,119,120,121,122].

In the present study, differences in survival were observed between the BFT and CW treatments throughout the culture period. Organisms in the BFT treatment showed the highest SR (25–37%), while the CW treatments showed the lowest survival rates (15–16%) at the end of the experiment. The positive effect of BFT on survival compared to CW has also been described in other shrimp species, including L. vannamei (BFT: 87.1%, CW: 74.2%), L. stylirostris (BFT: 93.5%, CW: 64.2%), M. rosembergii (BFT: 86.52%, CW: 78.22%), Penaeus indicus (BFT: 92%, CW: 81%), P. monodon (BFT: 81.87%, CW: 65.73%), P. semisulcatus (BFT: 87.78%, CW: 76.67%) and Marsupenaeus japonicus (BFT: 65.7%, CW: 52.3%) [33,123,124,125,126,127,128]. The possible explanation for the higher SR in BFT may be that the flocs create a turbid condition in the water, which may help to decrease the physical interaction between the shrimp and possibly the perception of the density stressor stimulus [129]. Additionally, flocs represent a food source that is available in situ 24 h a day, offering a rich source of proteins and lipids [130].

The conversion factor parameters are called “apparent” efficiency and are more of practical information than of biological significance, as the actual consumption of diets could not be monitored in biofloc-based tanks, nor could the impact of cannibalism and biofloc consumption be directly evaluated [131]. It has been reported that the FCR for the BFT was significantly lower than the CW culture [132]. An FCR of 1.61 is considered good for shrimp [133,134]. Additionally, FCR is strongly linked to survival, as the calculation of the daily food ration is estimated based on the biomass measured at each sampling, potentially leading to an underestimation of this parameter [135]. In this study, the FCR could not be determined in the three densities of clear water and in the density of B400 because the final biomass was lower than the initial biomass, all due to low survival. The high FCR values (8.94 ± 0.27, 10.06 ± 0.24 recorded may be attributed to the type of feed supplied, which was not specifically formulated for shrimp, potentially leading to inadequate digestibility of the ration [136].

Previous studies indicate that the Hsp70 heat shock protein can be used as a biomarker because it plays an important role in protecting fish, shrimp, and mollusks against abiotic and biotic stress [137,138,139,140,141,142]. When the organism is exposed to environmental stress, the Hsp expression level increases significantly [143,144]. Hsp70 expression in our experiment increased with increasing stocking density in CW conditions compared to BFT, highlighting that it was stressful for shrimp under high stocking density conditions in CW [145]. Our results coincide with those reported by Nath and Haldar [146], who found that increasing stocking density induced the expression of stress-related protein Hsp70 in shrimps. In prawns, Macrobrachium nipponense, and crayfish Astacus leptodactylus found increasing stocking density elevated Hsp70 [147,148], and in fish, such as rainbow trout and tilapia, an increase in density, increases the expression level of Hsp70 [149,150,151,152].

The stress response can increase reactive oxygen species (ROS), and the first line of defense against ROS is antioxidant enzymes, including superoxide dismutase (SOD), which converts the superoxide radical (O₂^•−) to peroxide (H₂O₂) [153,154]. SOD has been described as an important biomarker of oxidative stress and antioxidant capacity in aquatic organisms [155]. In the present study, SOD expression was similar at all densities under BTF conditions of C. camentarius juveniles. These similarities can suggest that the oxidant/antioxidant balance in shrimp was not altered despite the stress condition [156]. This effect on the antioxidant activity of BFT could be related to the contribution of bioactive compounds that have antioxidant effects, such as carotenoids, polysaccharides, phytosterols, taurine, chlorophylls, vitamin C, and essential fatty acids [157,158,159]. Furthermore, it has been shown that some microbial communities present in biofloc can influence the redox state of shrimp [160,161]. All these compounds can be absorbed by shrimp through biofloc consumption, contributing to a healthy state, increasing stress tolerance, and helping activate antioxidant activity in farmed shrimp [90,162,163,164]. It is possible that with this background, the molecules contained in biofloc are antioxidants and that they act directly on the oxygen free radicals (which are a substrate for SOD) produced in metabolic processes; therefore, the expression of SOD is greater with respect to shrimp that are in clear water. Therefore, using exogenous antioxidants can help preserve energy reserves and endogenous antioxidant responses by improving resistance against pro-oxidant situations [165].

Another important factor is the reduction of water needed compared to CW systems. In BFT, it is only necessary to compensate for water loss due to evaporation [166]. However, the recovery and reuse of fresh water must be studied. In our study, we managed to conserve around 90% of the water resource, a figure close to the values found in the study by Huang et al. [167], which reports a conservation of 93.6% of the water resource. This is particularly beneficial in areas with limited water resources, like northern Chile, where the endemic river shrimp C. caementarius is being cultivated.

5. Conclusions

This study demonstrated that BFT positively impacts both water quality and the metabolic response of C. caementarius. Water quality remained within suitable ranges for the species, with no significant treatment effects, suggesting that productivity differences were due to technology and stocking density. The BFT system supports higher stocking densities compared to traditional CW systems and has proven to improve the resilience and survival of shrimp. Based on these results, an optimal stocking density of 200 shrimp/m² is recommended for biofloc systems to enhance survival, growth, physiological responses, and feed efficiency. Therefore, BFT is an effective tool for river shrimp farmers to increase stocking density and production efficiency, especially in arid regions.