Transcriptomic Analysis Provides Insights into the Energetic Metabolism and Immune Responses in Litopenaeus vannamei Challenged by Photobacterium damselae subsp. damselae
Abstract
1. Introduction
2. Materials and Methods
2.1. Animals and Bacterial Infection
2.2. RNA Extraction, Library Construction, and Sequencing
2.3. Data Assembly and Functional Annotation
2.4. RT-qPCR Analysis
2.5. Measurement of TAG and Trehalose Concentrations in the Hemolymph Samples of the Infected Shrimp
2.6. Measurement of the Activities of PO, TPS, Lysozyme, CAT, and GSH-PX in the Infected Shrimp
2.7. Assay of the Protein Concentration
2.8. Data Analysis
3. Results
3.1. Illumina Sequencing and Quality Assessment
3.2. Annotation Analysis of the New Gene Function and Analysis of the DEGs
3.3. Transcriptomic Analysis Revealed That the Infection Selectively Strengthened the Expression of Energetic Metabolism- and Immune Response-Related Genes
3.4. qPCR Analysis of the Energetic Metabolism- and Immune Response-Related Genes in the Infected L. vannamei
3.5. The Variations in TAG and Trehalose Concentrations and Activities of PO, TPS, Lysozyme, CAT, and GSH-PX in the Infected L. vannamei Hemolymph Samples
4. Discussion
4.1. The Effect of Pathogen Infection on the Energetic Metabolism of L. vannamei
4.2. The Effect of Pathogen Infection on the Immune Responses of L. vannamei
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Conflicts of Interest
References
- Alfiansah, Y.R.; Peters, S.; Harder, J.; Hassenrück, C.; Gärdes, A. Structure and co-occurrence patterns of bacterial communities associated with white faeces disease outbreaks in Pacific white-leg shrimp Penaeus vannamei aquaculture. Sci. Rep. 2020, 10, 11980. [Google Scholar] [CrossRef] [PubMed]
- De Schryver, P.; Defoirdt, T.; Sorgeloos, P. Early mortality syndrome outbreaks: A microbial management issue in shrimp farming? PLoS Pathog. 2014, 10, e1003919. [Google Scholar] [CrossRef] [PubMed]
- Soto-Rodriguez, S.A.; Gomez-Gil, B.; Lozano-Olvera, R.; Betancourt-Lozano, M.; Morales-Covarrubias, M.S. Field and experimental evidence of Vibrio parahaemolyticus as the causative agent of acute hepatopancreatic necrosis disease of cultured shrimp (Litopenaeus vannamei) in Northwestern Mexico. Appl. Environ. Microbiol. 2015, 81, 1689–1699. [Google Scholar] [CrossRef]
- Defoirdt, T.; Boon, N.; Sorgeloos, P.; Verstraete, W.; Bossier, P. Alternatives to antibiotics to control bacterial infections: Luminescent vibriosis in aquaculture as an example. Trends Biotechnol. 2007, 25, 472–479. [Google Scholar] [CrossRef]
- Rungrassamee, W.; Klanchui, A.; Maibunkaew, S.; Karoonuthaisiri, N. Bacterial dynamics in intestines of the black tiger shrimp and the Pacific white shrimp during Vibrio harveyi exposure. J. Invertebr. Pathol. 2016, 133, 12–19. [Google Scholar] [CrossRef] [PubMed]
- Zhang, X.H.; He, X.; Austin, B. Vibrio harveyi: A serious pathogen of fish and invertebrates in mariculture. Mar. Life Sci. Technol. 2020, 2, 231–245. [Google Scholar] [CrossRef] [PubMed]
- Yin, X.; Zhuang, X.; Liao, M.; Huang, L.; Cui, Q.; Liu, C.; Dong, W.; Wang, F.; Liu, Y.; Wang, W. Transcriptome analysis of Pacific white shrimp (Litopenaeus vannamei) hepatopancreas challenged by Vibrio alginolyticus reveals lipid metabolic disturbance. Fish Shellfish Immunol. 2022, 123, 238–247. [Google Scholar] [CrossRef]
- Li, L.; Meng, H.; Gu, D.; Li, Y.; Jia, M. Molecular mechanisms of Vibrio parahaemolyticus pathogenesis. Microbiol. Res. 2019, 222, 43–51. [Google Scholar] [CrossRef]
- Dong, X.; Wang, H.; Xie, G.; Zou, P.; Guo, C.; Liang, Y.; Huang, J. An isolate of Vibrio campbellii carrying the pirVP gene causes acute hepatopancreatic necrosis disease. Emerg. Microbes Infec. 2017, 6, 1–3. [Google Scholar]
- Kumar, S.; Kumar, C.B.; Rajendran, V.; Abishaw, N.; Anand, P.S.; Kannapan, S.; Nagaleekar, V.K.; Vijayan, V.K.; Alavandi, S.V. Delineating virulence of Vibrio campbellii: A predominant luminescent bacterial pathogen in Indian shrimp hatcheries. Sci. Rep. 2021, 11, 15831. [Google Scholar] [CrossRef]
- Goarant, C.; Ansquer, D.; Herlin, J.; Domalain, D.; Imbert, F.; De Decker, S. “Summer Syndrome” in Litopenaeus stylirostris in New Caledonia: Pathology and epidemiology of the etiological agent, Vibrio nigripulchritudo. Aquaculture 2006, 253, 105–113. [Google Scholar] [CrossRef]
- Walling, E.; Vourey, E.; Ansquer, D.; Beliaeff, B.; Goarant, C. Vibrio nigripulchritudo monitoring and strain dynamics in shrimp pond sediments. J. Appl. Microbiol. 2010, 108, 2003–2011. [Google Scholar]
- Goarant, C.; Merien, F. Quantification of Vibrio penaeicida, the etiological agent of Syndrome 93 in New Caledonian shrimp, by real-time PCR using SYBR Green I chemistry. J. Microbiol. Methods 2006, 67, 27–35. [Google Scholar] [CrossRef]
- Maningas, M.B.B.; Kondo, H.; Hirono, I.; Saito-Taki, T.; Aoki, T. Essential function of transglutaminase and clotting protein in shrimp immunity. Mol. Immunol. 2008, 45, 1269–1275. [Google Scholar] [CrossRef] [PubMed]
- Horowitz, A.; Horowitz, S. Disease control in shrimp aquaculture from a microbial ecology perspective. In The New Wave, Proceedings of the Special Session on Sustainable Shrimp Culture, Aquaculture; World Aquaculture Society: Sorrento, LA, USA, 2001; pp. 199–218. [Google Scholar]
- Beijerinck, M.W. Le Photobacterium luminosum, Bactérie lumineuse de la Mer du Nord. Arch. Néerl. des Sci. Exact. et Nat. 1889, 23, 401–427. [Google Scholar]
- Gram, L.; Melchiorsen, J.; Bruhn, J.B. Antibacterial activity of marine culturable bacteria collected from a global sampling of ocean surface waters and surface swabs of marine organisms. Mar. Biotechnol. 2010, 12, 439–451. [Google Scholar] [CrossRef] [PubMed]
- Urbanczyk, H.; Ast, J.C.; Dunlap, P.V. Phylogeny, genomics, and symbiosis of Photobacterium. FEMS Microbiol. Rev. 2011, 35, 324–342. [Google Scholar] [CrossRef] [PubMed]
- Gomez-Gil, B.; Roque, A.; Rotllant, G.; Peinado, L.; Romalde, J.L.; Doce, A.; Cabanillas-Beltránla, H.; Chimetto, L.A.; Thompson, F.L. Photobacterium swingsii sp. nov., isolated from marine organisms. Int. J. Syst. Evol. Microbiol. 2011, 61, 315–319. [Google Scholar] [CrossRef]
- Enciso-Ibarra, J.; González-Castillo, A.; Soto-Rodriguez, S.A.; Enciso-Ibarra, K.; Bolán-Mejia, C.; Gomez-Gil, B. Photobacterium lucens sp. nov., Isolated from a Cultured Shrimp Penaeus vannamei. Curr. Microbiol. 2020, 77, 1111–1116. [Google Scholar] [CrossRef]
- Bjornsdottir-Butler, K.; McCarthy, S.A.; Dunlap, P.V.; Benner, R.A., Jr. Photobacterium angustum and Photobacterium kishitanii, psychrotrophic high-level histamine-producing bacteria indigenous to tuna. Appl. Environ. Microbiol. 2016, 82, 2167–2176. [Google Scholar] [CrossRef]
- Wang, X.; Li, Y.; Xue, C.X.; Li, B.; Zhou, S.; Liu, L.; Zhang, X.H. Photobacterium chitinilyticum sp. nov., a marine bacterium isolated from seawater at the bottom of the East China Sea. Int. J. Syst. Evol. Microbiol. 2019, 69, 1477–1483. [Google Scholar] [CrossRef]
- Vaseeharan, B.; Sundararaj, S.; Murugan, T.; Chen, J.C. Photobacterium damselae ssp. damselae associated with diseased black tiger shrimp Penaeus monodon Fabricius in India. Lett. Appl. Microbiol. 2007, 45, 82–86. [Google Scholar]
- Wang, Z.; Shi, C.; Wang, H.; Wan, X.; Zhang, Q.; Song, X.; Li, G.; Gong, M.; Ye, S.; Xie, G.; et al. A novel research on isolation and characterization of Photobacterium damselae subsp. damselae from Pacific white shrimp, Penaeus vannamei, displaying black gill disease cultured in China. J. Fish Dis. 2020, 43, 551–559. [Google Scholar]
- Nadala, E.C.B., Jr.; Tapay, L.M.; Cao, S.; Loh, P.C. Detection of yellowhead virus and Chinese baculovirus in penaeid shrimp by the Western blot technique. J. Virol. Methods 1997, 69, 39–44. [Google Scholar] [CrossRef] [PubMed]
- Chen, S.; Zhou, Y.; Chen, Y.; Gu, J. fastp: An ultra-fast all-in-one FASTQ preprocessor. Bioinformatics 2018, 34, i884–i890. [Google Scholar] [CrossRef] [PubMed]
- Kim, D.; Langmead, B.; Salzberg, S.L. HISAT: A fast spliced aligner with low memory requirements. Nat. Methods 2015, 12, 357–360. [Google Scholar] [CrossRef] [PubMed]
- Manzoor, A.; UlAbdin, Z.; Webb, B.A.; Arif, M.J.; Jamil, A. De novo sequencing and transcriptome analysis of female venom glands of ectoparasitoid Bracon hebetor (Say.) (Hymenoptera: Braconidae). Comp. Biochem. Physiol. Part D Genom. Proteom. 2016, 20, 101–110. [Google Scholar] [CrossRef]
- Mortazavi, A.; Williams, B.A.; McCue, K.; Schaeffer, L.; Wold, B. Mapping and quantifying mammalian transcriptomes by RNA-Seq. Nat. Methods 2008, 5, 621–628. [Google Scholar] [CrossRef]
- Wang, L.; Feng, Z.; Wang, X.; Wang, X.; Zhang, X. DEGseq: An R package for identifying differentially expressed genes from RNA-seq data. Bioinformatics 2010, 26, 136–138. [Google Scholar] [CrossRef]
- Audic, S.; Claverie, J.M. The significance of digital gene expression profiles. Genome Res. 1997, 7, 986–995. [Google Scholar] [CrossRef]
- Ashburner, M.; Ball, C.A.; Blake, J.A.; Botstein, D.; Butler, H.; Cherry, J.M.; Davis, A.P.; Dolinski, K.; Dwight, S.S.; Eppig, J.T.; et al. Gene ontology: Tool for the unification of biology. Nat. Genet. 2000, 25, 25–29. [Google Scholar] [CrossRef]
- Wu, J.; Mao, X.; Cai, T.; Luo, J.; Wei, L. KOBAS server: A web-based platform for automated annotation and pathway identification. Nucleic Acids Res. 2006, 34, W720–W724. [Google Scholar] [CrossRef]
- Xie, C.; Mao, X.; Huang, J.; Ding, Y.; Wu, J.; Dong, S.; Kong, L.; Gao, G.; Li, C.; Wei, L. KOBAS 2.0: A web server for annotation and identification of enriched pathways and diseases. Nucleic Acids Res. 2011, 39, W316–W322. [Google Scholar] [CrossRef] [PubMed]
- Chen, C.; Chen, H.; Zhang, Y.; Thomas, H.R.; Frank, M.H.; He, Y.; Xia, R. TBtools: An integrative toolkit developed for interactive analyses of big biological data. Mol. Plant 2020, 13, 1194–1202. [Google Scholar] [CrossRef]
- Chen, K.; Song, J.; Song, Q.; Dou, X.; Wang, Y.; Wei, Y.; Chen, J.; Wang, L.; Alradi, M.F.; Liu, X.; et al. Transcriptomic analysis provides insights into the immune responses and nutrition in Ostrinia furnacalis larvae parasitized by Macrocentrus cingulum. Arch. Insect Biochem. Physiol. 2022, 109, e21863. [Google Scholar] [CrossRef] [PubMed]
- Shi, W.; Wang, P.; Hu, R.; Wan, X.; Shen, H.; Li, H.; Wang, L.; Qiao, Y.; Jiang, G.; Cheng, J.; et al. Transcriptome analysis reveals hub genes in the hepatopancreas of Exopalaemon carinicauda in response to hypoxia and reoxygenation. Aquac. Int. 2021, 29, 1785–1811. [Google Scholar] [CrossRef]
- Schmittgen, T.D.; Livak, K.J. Analyzing real-time PCR data by the comparative CT method. Nat. Protoc. 2008, 3, 1101–1108. [Google Scholar] [CrossRef]
- Wang, L.; Liu, X.; Han, Z.; Li, S.; Feng, C. Selective strengthening of lipid metabolism and the rapid immune response of Ostrinia furnacalis larvae parasitized by Macrocentrus cingulum. J. Asia Pac. Èntomol. 2024, 27, 102194. [Google Scholar] [CrossRef]
- Bradford, M.M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 1976, 72, 248–254. [Google Scholar] [CrossRef]
- Kirti, N.; Tekade, S.P.; Tagade, A.; Sawarkar, A.N. Pyrolysis of pigeon pea (Cajanus cajan) stalk: Kinetics and thermodynamic analysis of degradation stages via isoconversional and master plot methods. Bioresour. Technol. 2022, 347, 126440. [Google Scholar] [CrossRef]
- Zhao, T.; Ma, A.; Huang, Z.; Liu, Z.; Sun, Z.; Zhu, C.; Yang, J.; Li, Y.; Wang, Q.; Qiao, X.; et al. Transcriptome analysis reveals that high temperatures alter modes of lipid metabolism in juvenile turbot (Scophthalmus maximus) liver. Comp. Biochem. Physiol. Part D Genom. Proteom. 2021, 40, 100887. [Google Scholar] [CrossRef]
- de Souza Valente, C.; Wan, A.H.L. Vibrio and major commercially important vibriosis diseases in decapod crustaceans. J. Invertebr. Pathol. 2021, 181, 107527. [Google Scholar] [CrossRef]
- Bachère, E. Anti-infectious immune effectors in marine invertebrates: Potential tools for disease control in larviculture. Aquaculture 2003, 227, 427–438. [Google Scholar] [CrossRef]
- Thitamadee, S.; Prachumwat, A.; Srisala, J.; Jaroenlak, P.; Salachan, P.V.; Sritunyalucksana, K.; Flege, T.W.; Itsathitphaisarn, O. Review of current disease threats for cultivated penaeid shrimp in Asia. Aquaculture 2016, 452, 69–87. [Google Scholar] [CrossRef]
- Ina-Salwany, M.Y.; Al-saari, N.; Mohamad, A.; Mursidi, F.A.; Mohd-Aris, A.; Amal, M.N.A.; Kasai, H.; Mino, S.; Sawabe, T.; Zamri-Saad, M. Vibriosis in fish: A review on disease development and prevention. J. Aquat. Anim. Health 2019, 31, 3–22. [Google Scholar] [CrossRef] [PubMed]
- Goulden, E.F.; Hall, M.R.; Bourne, D.G.; Pereg, L.L.; Høj, L. Pathogenicity and infection cycle of Vibrio owensii in larviculture of the ornate spiny lobster (Panulirus ornatus). Appl. Environ. Microbiol. 2012, 78, 2841–2849. [Google Scholar] [CrossRef]
- Kumar, T.S.; Vidya, R.; Kumar, S.; Alavandi, S.V.; Vijayan, K.K. Zoea-2 syndrome of Penaeus vannamei in shrimp hatcheries. Aquaculture 2017, 479, 759–767. [Google Scholar] [CrossRef]
- Olguín-León, P.; Enríquez-Espinoza, T.; Mendoza-Cano, F.; Encinas-García, T.; Sánchez-Paz, A. Transcriptional profile of pyruvate kinase and pancreatic lipase encoding mRNA s of the Pacific whiteleg shrimp Penaeus vannamei during Pst DV-1 infection. Aquac. Res. 2017, 48, 5587–5594. [Google Scholar] [CrossRef]
- Kuo, Y.C.; Chen, I.Y.; Chang, S.C.; Wu, S.C.; Hung, T.M.; Lee, P.H.; Shimotohno, K.; Chang, M.F. Hepatitis C virus NS 5A protein enhances gluconeogenesis through upregulation of Akt-/JNK-PEPCK signalling pathways. Liver Int. 2014, 34, 1358–1368. [Google Scholar] [CrossRef]
- Parvaiz, F.; Manzoor, S.; Iqbal, J.; Sarkar-Dutta, M.; Imran, M.; Waris, G. Hepatitis C virus NS5A promotes insulin resistance through IRS-1 serine phosphorylation and increased gluconeogenesis. World J. Gastroenterol. 2015, 21, 12361–12369. [Google Scholar] [CrossRef]
- Stuck, K.C.; Stuck, L.M.; Overstreet, R.M.; Wang, S.Y. Relationship between BP (Baculovirus penaei) and energy reserves in larval and postlarval Pacific white shrimp Penaeus vannamei. Dis. Aquat. Organ. 1996, 24, 191–198. [Google Scholar] [CrossRef]
- Parvy, J.P.; Napal, L.; Rubin, T.; Poidevin, M.; Perrin, L.; Wicker-Thomas, C.; Montagne, J. Drosophila melanogaster Acetyl-CoA-carboxylase sustains a fatty acid-dependent remote signal to waterproof the respiratory system. PLoS Genet. 2012, 8, e1002925. [Google Scholar] [CrossRef] [PubMed]
- Hossain, M.I.; Roulston, C.L.; Stapleton, D.I. Molecular basis of impaired glycogen metabolism during ischemic stroke and hypoxia. PLoS ONE 2014, 9, e97570. [Google Scholar] [CrossRef] [PubMed]
- Garrido, D.; Rubin, T.; Poidevin, M.; Maroni, B.; Rouzic, A.L.; Parvy, J.P.; Montagne, J. Fatty acid synthase cooperates with glyoxalase 1 to protect against sugar toxicity. PLoS Genet. 2015, 11, e1004995. [Google Scholar] [CrossRef]
- Tunnacliffe, A.; Lapinski, J. Resurrecting Van Leeuwenhoek’s rotifers: A reappraisal of the role of disaccharides in anhydrobiosis. Philos. Trans. R. Soc. B Biol. Sci. 2003, 358, 1755–1771. [Google Scholar] [CrossRef]
- MacRae, T.H. Stress tolerance during diapause and quiescence of the brine shrimp, Artemia. Cell Stress Chaperones 2016, 21, 9–18. [Google Scholar] [CrossRef]
- Wang, B.; Li, F.H.; Dong, B.; Zhang, X.; Zhang, C.; Xiang, J. Discovery of the Genes in Response to White Spot Syndrome Virus (WSSV) Infection in Fenneropenaeus chinensis through cDNA Microarray. Mar. Biotechnol. 2006, 8, 491–500. [Google Scholar] [CrossRef]
- Gross, P.S.; Bartlett, T.C.; Browdy, C.L.; Chapman, R.W.; Warr, G.W. Immune gene discovery by expressed sequence tag analysis of hemocytes and hepatopancreas in the Pacific White Shrimp, Litopenaeus vannamei, and the Atlantic White Shrimp. L. setiferus. Dev. Comp. Immunol. 2001, 25, 565–577. [Google Scholar] [CrossRef]
- Li, F.; Xiang, J. Signaling pathways regulating innate immune responses in shrimp. Fish Shellfish Immunol. 2013, 34, 973–980. [Google Scholar] [CrossRef]
- Lei, K.; Li, F.; Zhang, M.; Yang, H.; Luo, T.; Xu, X. Difference between hemocyanin subunits from shrimp Penaeus japonicus in anti-WSSV defense. Dev. Comp. Immunol. 2008, 32, 808–813. [Google Scholar] [CrossRef]
- Burmester, T. Evolution of respiratory proteins across the Pancrustacea. Integr. Comp. Biol. 2015, 55, 792–801. [Google Scholar] [CrossRef]
- Boonchuen, P.; Jaree, P.; Tassanakajon, A.; Somboonwiwat, K. Hemocyanin of Litopenaeus vannamei agglutinates Vibrio parahaemolyticus AHPND (VPAHPND) and neutralizes its toxin. Dev. Comp. Immunol. 2018, 84, 371–381. [Google Scholar] [CrossRef] [PubMed]
- Amparyup, P.; Charoensapsri, W.; Tassanakajon, A. Two prophenoloxidases are important for the survival of Vibrio harveyi challenged shrimp Penaeus monodon. Dev. Comp. Immunol. 2009, 33, 247–256. [Google Scholar] [CrossRef] [PubMed]
- Charoensapsri, W.; Amparyup, P.; Hirono, I.; Aoki, T.; Tassanakajon, A. PmPPAE2, a new class of crustacean prophenoloxidase (proPO)-activating enzyme and its role in PO activation. Dev. Comp. Immunol. 2011, 35, 115–124. [Google Scholar] [CrossRef]
- Amparyup, P.; Promrungreang, K.; Charoensapsri, W.; Sutthangkul, J.; Tassanakajon, A. A serine proteinase PmClipSP2 contributes to prophenoloxidase system and plays a protective role in shrimp defense by scavenging lipopolysaccharide. Dev. Comp. Immunol. 2013, 41, 597–607. [Google Scholar] [CrossRef]
- Niere, M.; Dettloff, M.; Maier, T.; Ziegler, M.; Wiesner, A. Insect immune activation by apolipophorin III is correlated with the lipid-binding properties of this protein. Biochemistry 2001, 40, 11502–11508. [Google Scholar] [CrossRef]
- Contreras, E.; Rausell, C.; Real, M.D. Tribolium castaneum apolipophorin-III acts as an immune response protein against Bacillus thuringiensis Cry3Ba toxic activity. J. Invertebr. Pathol. 2013, 113, 209–213. [Google Scholar] [CrossRef] [PubMed]
- Wen, D.; Wang, X.; Shang, L.; Huang, Y.; Li, T.; Wu, C.; Zhang, R.; Zhang, J. Involvement of a versatile pattern recognition receptor, apolipophorin-III in prophenoloxidase activation and antibacterial defense of the Chinese oak silkworm, Antheraea pernyi. Dev. Comp. Immunol. 2016, 65, 124–131. [Google Scholar] [CrossRef]
- Gorowara, S.; Sapru, S.; Ganguly, N.K. Role of intracellular second messengers and reactive oxygen species in the pathophysiology of V. cholera O139 treated rabbit ileum. Biochim. Biophys. Acta Mol. Basis Dis. 1998, 1407, 21–30. [Google Scholar] [CrossRef]
- Pajares, M.A.; Pérez-Sala, D. Betaine homocysteine S-methyltransferase: Just a regulator of homocysteine metabolism? Cell. Mol. Life Sci. 2006, 63, 2792–2803. [Google Scholar] [CrossRef]
- Ji, C.; Shinohara, M.; Kuhlenkamp, J.; Chan, C.; Kaplowitz, N. Mechanisms of protection by the betaine-homocysteine methyltransferase/betaine system in HepG2 cells and primary mouse hepatocytes. Hepatology 2007, 46, 1586–1596. [Google Scholar] [CrossRef] [PubMed]
- Wrońska, A.K.; Boguś, M.I. Heat shock proteins (HSP 90, 70, 60, and 27) in Galleria mellonella (Lepidoptera) hemolymph are affected by infection with Conidiobolus coronatus (Entomophthorales). PLoS ONE 2020, 15, e0228556. [Google Scholar] [CrossRef] [PubMed]
- Bendena, W.G.; Ayme-Southgate, A.; Garbe, J.C.; Pardue, M.L. Expression of heat-shock locus hsr-omega in nonstressed cells during development in Drosophila melanogaster. Dev. Biol. 1991, 144, 65–77. [Google Scholar] [CrossRef] [PubMed]
- Wojda, I.; Jakubowicz, T. Humoral immune response upon mild heat-shock conditions in Galleria mellonella larvae. J. Insect Physiol. 2007, 53, 1134–1144. [Google Scholar] [CrossRef]
- Liu, Q.N.; Liu, Y.; Xin, Z.Z.; Zhu, X.Y.; Ge, B.M.; Li, C.F.; Wang, D.; Bian, X.G.; Yang, L.; Chen, L.; et al. A small heat shock protein 21 (sHSP21) mediates immune responses in Chinese oak silkworm Antheraea pernyi. Int. J. Biol. Macromol. 2018, 111, 1027–1031. [Google Scholar] [CrossRef]
- Qi, C.; Wang, L.; Liu, M.; Jiang, K.; Wang, M.; Zhao, W.; Wang, B. Transcriptomic and morphological analyses of Litopenaeus vannamei intestinal barrier in response to Vibrio paraheamolyticus infection reveals immune response signatures and structural disruption. Fish Shellfish Immunol. 2017, 70, 437–450. [Google Scholar] [CrossRef]
- Rao, R.; Bing Zhu, Y.; Alinejad, T.; Tiruvayipati, S.; Lin Thong, K.; Wang, J.; Bhassu, S. RNA-seq analysis of Macrobrachium rosenbergii hepatopancreas in response to Vibrio parahaemolyticus infection. Gut Pathog. 2015, 7, 6. [Google Scholar] [CrossRef]







| Gene ID | Primer | Sequence (5′~3′) |
|---|---|---|
| ncbi_113815027 | APO-F | TGCCAGATTTACTACACCAGACC |
| APO-R | TCTCCTACGACGGGTACTCC | |
| ncbi_113807145 | TPS-F | TTCTGCGCACACTATTTGGC |
| TPS-R | ACCCACTTGAGCATGGTGAG | |
| ncbi_113810715 | Mttp-F | TTTGTGTGTGTGTGATGCGG |
| Mttp-R | AAGGCATACTGGACATCCTGAG | |
| ncbi_113813342 | Lipl-F | CTTTCGAACATGCGCGGAAA |
| Lipl-R | CAATGCTCGCAGGAACATCG | |
| ncbi_113800366 | Serpin2-F | GGACCTTAAGCCTTGGGGTT |
| Serpin2-R | CATCCACAAGGCCTTCGTCG | |
| ncbi_113829534 | MAPK-F | CGGACTTCAGTATCCTGTGCA |
| MAPK-R | TTCGCAAATGGTGAAATATGCA | |
| MSTRG.8004 | GPX-F | AACTGCGGCTTCACTCAAGA |
| GPX-R | GTCTCGCCCGAAGAGGAATT | |
| ncbi_113829896 | CAT-F | GGGATCCTATTCTGTTCCCATCC |
| CAT-R | TGACAAGCTTGGAAGTACGAGA | |
| β actin | β actin-F | GCATCACCAGGGCTACAT |
| β actin-R | GTCGCCACGAGAAGTCAA |
| Sample | Clean Reads | Clean Data (bp) | GC Content (%) | Q30 (%) | Mapped (%) |
|---|---|---|---|---|---|
| NS-1 | 39,264,566 | 5,865,190,605 | 49.63 | 90.25 | 87.32 |
| NS-2 | 36,038,402 | 5,382,295,989 | 47.87 | 89.63 | 86.58 |
| NS-3 | 35,945,808 | 5,368,259,437 | 48.09 | 89.83 | 86.24 |
| DS-1 | 38,381,842 | 5,739,457,811 | 47.44 | 89.77 | 86.91 |
| DS-2 | 36,176,640 | 5,407,108,460 | 48.20 | 90.90 | 88.46 |
| DS-3 | 35,943,364 | 5,364,241,157 | 48.14 | 89.76 | 87.19 |
| Item | Number of Unigenes | Percentage (%) |
|---|---|---|
| Nr | 387 | 32.3 |
| KEGG | 214 | 17.9 |
| GO | 595 | 49.8 |
| Total unigenes | 1196 | 100 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, L.; Xu, Q.; Yu, Z.; Hu, Z.; Li, H.; Shi, W.; Wan, X. Transcriptomic Analysis Provides Insights into the Energetic Metabolism and Immune Responses in Litopenaeus vannamei Challenged by Photobacterium damselae subsp. damselae. Fishes 2024, 9, 350. https://doi.org/10.3390/fishes9090350
Wang L, Xu Q, Yu Z, Hu Z, Li H, Shi W, Wan X. Transcriptomic Analysis Provides Insights into the Energetic Metabolism and Immune Responses in Litopenaeus vannamei Challenged by Photobacterium damselae subsp. damselae. Fishes. 2024; 9(9):350. https://doi.org/10.3390/fishes9090350
Chicago/Turabian StyleWang, Libao, Qiuwen Xu, Zhijun Yu, Zhenxin Hu, Hui Li, Wenjun Shi, and Xihe Wan. 2024. "Transcriptomic Analysis Provides Insights into the Energetic Metabolism and Immune Responses in Litopenaeus vannamei Challenged by Photobacterium damselae subsp. damselae" Fishes 9, no. 9: 350. https://doi.org/10.3390/fishes9090350
APA StyleWang, L., Xu, Q., Yu, Z., Hu, Z., Li, H., Shi, W., & Wan, X. (2024). Transcriptomic Analysis Provides Insights into the Energetic Metabolism and Immune Responses in Litopenaeus vannamei Challenged by Photobacterium damselae subsp. damselae. Fishes, 9(9), 350. https://doi.org/10.3390/fishes9090350
