Next Article in Journal
Human Defensin 5 Inhibits Plasmodium yoelii Development in Anopheles stephensi by Promoting Innate Immune Response
Previous Article in Journal
Using a Knowledge and Awareness Survey to Engage and Inform a Community-Based Tuberculosis Intervention among Nomads in Adamawa State, Nigeria
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
TropicalMed
Volume 9
Issue 8
10.3390/tropicalmed9080168
tropicalmed-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Molecular Characterization of Leptospira Species among Patients with Acute Undifferentiated Febrile Illness from the Municipality of Villeta, Colombia

by
Carlos Ramiro Silva-Ramos
1,*,
J. Manuel Matiz-González
1,2,
Juliana Gil-Mora
1,
Heidy-C. Martínez Díaz
1,
Álvaro A. Faccini-Martínez
3,4,5,
Claudia Cuervo
1,
Peter C. Melby
6,7,
Patricia V. Aguilar
7,8,
Miguel M. Cabada
6,7,
Juan David Rodas
9 and
Marylin Hidalgo
1,*
1
Grupo de Enfermedades Infecciosas, Departamento de Microbiología, Facultad de Ciencias, Pontificia Universidad Javeriana, Bogotá 110231, Colombia
2
Molecular Genetics and Antimicrobial Resistance Unit, Universidad El Bosque, Bogotá 110121, Colombia
3
Servicio de Infectología, Hospital Militar Central, Bogotá 110110, Colombia
4
Facultad de Medicina, Universidad Militar Nueva Granada, Bogotá 110111, Colombia
5
Servicios y Asesorías en Infectología—SAI, Bogotá 110110, Colombia
6
Division of Infectious Diseases, Department of Internal Medicine, University of Texas Medical Branch, Galveston, TX 77555, USA
7
Center for Tropical Diseases, University of Texas Medical Branch, Galveston, TX 77555, USA
8
Department of Pathology, University of Texas Medical Branch, Galveston, TX 77555, USA
9
Grupo de Investigación en Ciencias Veterinarias Centauro, Universidad de Antioquia, Medellín 050010, Colombia
*
Authors to whom correspondence should be addressed.
Trop. Med. Infect. Dis. 2024, 9(8), 168; https://doi.org/10.3390/tropicalmed9080168
Submission received: 31 May 2024 / Revised: 22 July 2024 / Accepted: 23 July 2024 / Published: 25 July 2024
(This article belongs to the Section Neglected and Emerging Tropical Diseases)
Browse Figure
Versions Notes

Abstract

:
Leptospira is a bacterial genus that includes several pathogenic species related to leptospirosis. In Colombia, leptospirosis is a mandatorily reported disease, widely distributed across the country. In the Villeta municipality, leptospirosis has been identified as an important cause of febrile illness; however, to date, no studies have been performed to identify the circulating species. A genus-specific qualitative qPCR was performed on DNA extracted from febrile patients’ acute-phase whole-blood samples targeting a fragment of the rrs gene. Positive qPCR samples were further amplified for the adk, icdA, LipL32, LipL41, rrs, and secY genes through conventional PCR for sequencing. All high-quality obtained sequences were further assessed through concatenated phylogenetic analysis. A total of 25% (14/56) of febrile patients’ acute blood samples were positive for Leptospira spp. High-quality sequences were obtained for only five genes, and analysis through concatenated phylogeny identified that all sequences clustered within the P1/pathogenic clade; some of them formed a robustly supported clade with Leptospira santarosai, and others were closely related with other Leptospira species but exhibited considerable genetic divergence. We describe the presence of pathogenic Leptospira species among febrile patients from the Villeta municipality and identify L. santarosai and other Leptospira species as causative agents of leptospirosis in the region.

1. Introduction

Leptospira spp. (order: Spirochaetales, family: Leptospiraceae) is a bacterial genus that comprises long, thin, and flexible Gram-negative spirochetes, some of which are pathogenic to a great number of animal species, including humans [1,2]. More than 66 Leptospira species have been officially recognized, of which at least 25 are well-known pathogens related to human and animal diseases [3]. Pathogenic Leptospira species are maintained in nature among a wide range of animal species such as rodents, canines, ruminants, and chiropterans. These animals develop persistent kidney colonization and shed the bacteria through the urine, acting as reservoirs [4,5,6]. Traditionally classified into pathogenic and saprophytic species [7], advances in molecular and phylogenetic analysis have rearranged Leptospira spp. into pathogenic, intermediate, and saprophytic groups [8]. Recently, the genus has been arranged into P1, P2, S1, and S2 clades to avoid a virulence assumption of novel Leptospira species [3]. Both classifications are currently being used with Leptospira spp. known to be pathogenic clustered within the P1/pathogenic clade [3,8].
Pathogenic Leptospira spp. cause leptospirosis, a neglected zoonotic infectious disease widely distributed across the world and one of the main public health problems in tropical and subtropical regions, mainly in developing and underdeveloped countries [1,9,10]. Leptospirosis is one of the etiologies of acute undifferentiated febrile illness (AUFI), and in some regions, it represents even a higher concern in comparison with other outstanding febrile illnesses such as malaria and dengue as a result of its high burden of disease [11]. The global average incidence of human leptospirosis is approximately 1.9 cases per 100,000 individuals. Its prevalence ranges between 11% and 30%, being more prevalent in tropical and subtropical regions of developing and underdeveloped countries [12]. It usually affects rural inhabitants whose economic activities are related to livestock production and agriculture [13,14]. Other practices such as eco-tourism, along with environmental modifications such as accelerated urbanization and climate change, have favored greater contact with wildlife and the re-emergence of leptospirosis [15]. Leptospirosis is usually a mild and self-limiting disease characterized by a sudden onset of fever accompanied by non-specific symptomatology (e.g., headaches, muscle pain, chills). However, some patients can develop severe and fulminant forms of the disease, which are life threatening if the disease is not promptly recognized and treated. Severe cases may result in renal and liver failure, usually known as Weil’s disease, or multiple-organ damage associated with sepsis [16,17].
At least 85% of the Colombian national territory is composed of tropical and subtropical ecosystems, which highlights the relevance of tropical diseases for the country’s population and visiting foreigners [18,19]. Since 2007, leptospirosis has been considered a mandatorily reported disease for the Colombian National Public Health Surveillance System (SIVIGILA), and novel cases are continuously being reported from several regions of the country [20]. In Colombia, few studies have been performed to, among other contributions, clarify the epidemiology of the disease, establish previous exposure to Leptospira spp., try to identify potential animal reservoirs, or determine the circulating Leptospira serovars and species [21,22,23,24]. In the department of Cundinamarca (Colombian Andean region), only two studies have been performed in the municipality of Villeta, where leptospirosis was identified as the first and second cause of AUFI in 2017 and 2023, respectively. Some of the circulating serovars have been identified as causes of human illness [25,26]. However, besides these two studies, no additional information is available despite the great relevance of leptospirosis as a frequent and significant cause of AUFI in the region. Thus, to contribute to the local knowledge and data on the circulating pathogenic Leptospira species, we conducted a molecular characterization of Leptospira strains among febrile patients from the Villeta municipality.

2. Materials and Methods

2.1. Ethical Consideration

The protocol and informed consent were approved by the institutional review board (IRB) of the “Pontificia Universidad Javeriana”. Each of the recruited patients provided written informed consent voluntarily. For patients younger than 6 years old and those in critical condition, written informed consent was provided by the parents or the legal guardians. For patients older than 6 years old but younger than 18 years old, a minor assent was also obtained before parents or legal guardians signed the written informed consent form. All the information provided was treated anonymously using numerical codes for each recruited patient. All the management, procedures, and conservation of biological samples obtained from febrile patients were carried out following the norms established in the resolution No. 8430 of 1993 of the Colombian Ministry of Health and the declaration of Helsinki for ethical and medical research in human subjects.

2.2. Study Area

The study was performed in the municipality of Villeta (5°00′46″ N, 74°28′23″ W), located in the Gualivá province, department of Cundinamarca. The Villeta municipality comprises a total area of 140 km2, which is distributed across 22 villages. Geographically, it is located 84 km from Bogotá D.C. and at 850 m above sea level. Villeta has an annual mean temperature of 26 °C and a relative humidity ranging from 80% to 97%, and its economic activity depends mainly on agriculture, principally sugarcane crop and “panela” production, which is a Colombian typical natural sweetener obtained from the evaporation, concentration, and crystallization of undistilled sugar cane juice, and more recently eco-tourism for local populations as well as for international travelers (https://www.villeta-cundinamarca.gov.co/Paginas/default.aspx accessed on 31 May 2024). According to the 2018 national population and housing census of the “Departamento Administrativo Nacional de Estadística (DANE)”, Villeta has a total population of 25,957 inhabitants, of which 17,751 live in the urban area, 743 live in suburban settlements, and 7463 live in rural areas (https://www.dane.gov.co accessed on 31 May 2024).

2.3. Febrile Patient Recruitment

Between September and December 2021, an active surveillance of febrile patients was conducted at “Salazar de Villeta” hospital, located in the main urban area of the Villeta municipality [26]. Male and female patients older than 2 years old who presented to the emergency department due to a non-specific febrile illness of less than fourteen days of evolution without an evident source of infection were included in the study. Each patient was recruited after voluntarily accepting participation in the study and having signed a informed consent form by themselves or through parents or legal tutors when appropriate. Whole-blood samples were collected upon admission from each recruited patient (acute-phase sample) and stored at −20 °C at the “Laboratorio de Bacteriología Especial” of the Faculty of Sciences of the “Pontificia Universidad Javeriana”, Bogotá D.C., Colombia, until further processing.

2.4. DNA Extraction

DNA was extracted from 100 µL of febrile patients’ acute-phase whole-blood samples using the DNeasy® Blood & Tissue Kit (Qiagen®, Hilden, Germany) following the manufacturer’s instructions. After each extraction procedure, DNA purity, to rule out the presence of inhibitors, and quantity were evaluated using a NanoDrop 2000 instrument (Thermo Scientific, Wilmington, DE, USA). DNA integrity was evaluated by performing a conventional PCR targeting a 289 base pair (bp) fragment of the β-actin (ACTB) gene using the primers Actin-FWD (CGGAACCGCTCATTGCC) and Actin-REV (GCTCACTCAGTGTGGCAAAG) according to previously reported procedures [27]. The PCR protocol was performed through 40 amplification cycles in a 96-well T100 PCR thermal cycler using the GoTaq® Green Master Mix (Promega Corporation, WI, USA) and employing the volumes and concentrations of Master Mix, primers, and DNA suggested by the Master Mix manufacturer’s instructions for a 10 μL reaction volume. Positive (genomic human DNA) and negative (molecular-grade water) controls were included in all amplification procedures. All amplified products were subsequently visualized on a 1% agarose gel stained with SYBRTM Safe DNA Gel Stain (Invitrogen, Waltham, MA, USA). Samples positive for the ACTB gene were further screened for the presence of Leptospira spp.

2.5. Detection of Leptospira spp.

For detecting the presence of Leptospira spp. DNA, a genus-specific qualitative real-time PCR (qPCR) was performed on DNA extracted from the blood samples of febrile patients during the acute phase. The qPCR test targeted a 331 bp fragment of the 16S rRNA- encoding gene (rrs) using the primers Lep1 (GGCGGCGCGTCTTAAACATG) and Lep2 (TTCCCCCCATTGAGCAAGATT) [28]. The PowerUpTM SYBRTM Green Master Mix (Applied Biosystems, Austin, TX, USA) was used to set up all reactions.
qPCR samples positive for the leptospiral rrs gene were further amplified using a conventional PCR method with the same set of primers for sequencing procedures. The PCR protocol was also performed through 40 amplification cycles in a 96-well T100 PCR thermal cycler using the GoTaq® Green Master Mix and following the recommendations for a 10 μL reaction volume. Amplicons were also evaluated in a 1% agarose gel run by electrophoresis and stained with SYBRTM Safe DNA Gel Stain. For both procedures, a positive control, Leptospira interrogans serovar Icterohaemmorhagiae DNA, and a negative control, molecular-grade water, were employed for all amplification reactions. All obtained amplicons from the Leptospira rrs protocol were purified using a Wizard® DNA Clean-Up System Kit (Promega, Madison, WI, USA), and then bi-directionally sequenced employing a 3500 Genetic Analyzer (Applied Biosystems, Foster City, CA, USA).

2.6. Identification of Leptospira spp.

To identify the Leptospira strains detected from febrile patient samples, a multi-locus sequence typing (MLST) approach was performed through conventional PCR on all DNA from febrile patients’ acute-phase blood samples that were positive for the leptospiral rrs gene, targeting five different genes: a 531 bp fragment of the adenylate kinase-encoding gene (adk), a 674 bp fragment of the isocitrate dehydrogenase-encoding gene (icdA), a 474 bp fragment of the major outer membrane lipoprotein lipL32-encoding gene (LipL32), a 520 bp fragment of the outer membrane lipoprotein lipL41-encoding gene (LipL41), and a 549 bp fragment of the pre-protein translocase-encoding gene (secY), using the sets of primers reported elsewhere [29]. The same positive and negative controls used in the Leptospira rrs screening protocol were also used for all five complementary gene amplification procedures. The PCR protocol was also performed through 40 amplification cycles in a 96-well T100 PCR thermal cycler using the GoTaq® Green Master Mix and following the recommendations for a 10 μL reaction volume. PCR products were also evaluated by electrophoresis in a 1% agarose gel stained with SYBRTM Safe DNA and then purified and bi-directionally sequenced, similarly to the amplicons obtained from the Leptospira rrs screening protocol. All six sequenced amplified molecular markers (adk, icdA, LipL32, LipL41, rrs, and secY) were used for further concatenated phylogenetic analyses.

2.7. Phylogenetic Analyses

The forward and reverse sequences were assembled and/or edited using SnapGene® Viewer 6.0.5 software and then compared with the NCBI GenBank sequence database using the BLASTn server. Leptospira reference sequences were retrieved from all Leptospira species available in the NCBI nucleotide sequence repository for all the six molecular markers (adk, icdA, LipL32, LipL41, rrs, and secY) analyzed in the present study.
For each individual marker, the successfully sequenced Leptospira-positive samples and reference sequences were aligned with the ClustalW algorithm [30], and then the alignment matrices were concatenated using the MEGA X software version 10.0.5 [31]. A maximum-likelihood (ML) tree was built with the consensus matrix in Randomized Axelerated Maximum Likelihood (RAxML) [32] using the GTR+GAMMA evolutionary model, which was identified as the best model according to the Bayesian information criterion, and a branch-support analysis of 1000 bootstrap replicates.

3. Results

3.1. Detection of Leptospira spp. in Febrile Patients

DNA extraction was performed on 56 febrile patients’ acute blood samples. The ACTB gene was successfully amplified in all processed samples, as expected. A total of 25% (14/56) of febrile patients’ acute blood samples were positive based on the qPCR screening targeting the leptospiral rrs gene. All amplified samples had Ct values ranging from 27.36 to 32.67 and melting temperatures (Tm) oscillating between 77.84 and 85.62. An expected amplicon of 331 bp was obtained in all 14 positive samples through conventional PCR targeting the same gene.
All 14 qPCR-amplified samples were tested for the five selected complementary genes, of which 9 were amplified for the leptospiral secY gene, 5 for the leptospiral LipL32 gene, 4 each for the leptospiral adk and icdA genes, and only 1 for the leptospiral LipL41 gene.
The detection of Leptospira spp. was more frequent in male patients [33.3% (10/30)] and among children 3-12 years of age [83.3% (5/6)]. Most Leptospira spp.-positive patients lived in rural areas [44.4% (4/9)] and were recruited during October [71.4% (5/7)] and September [66.7% (4/6)]. Detailed information is provided in Table 1. In five of the fourteen positive febrile patients, positive serological results were obtained previously [26] through the detection of IgM antibodies in acute and/or convalescent serum samples; and in one of them, seroconversion to serovars Brastislava and Hardjo was evidenced (Table 2).

3.2. Molecular Identification of Leptospira spp. in Febrile Patients

In order to identify the species involved in human leptospirosis in the municipality of Villeta, a maximum-likelihood phylogeny of Leptospira spp. was generated using an MLST profile. All obtained Leptospira rrs amplicons were sequenced, and 13/14 had high enough quality to be further analyzed through phylogenetic analysis. Regarding the other five selected complementary genes, all obtained amplicons were also sequenced, but high-quality sequences were only obtained for four of them: icdA (2/4), LipL32 (3/5), LipL41 (1/1), and secY (4/9); thus, reference sequences of the Leptospira adk gene were excluded from further analyses. High-quality obtained sequences belonged to four different patients’ samples as follows: COV009 (icdA and secY), COV013 (secY, LipL32, and LipL41), COV021 (icdA, secY, and LipL32), and COV023 (secY and LipL32). All of them were further analyzed through phylogeny using the obtained Leptospira spp. reference sequences for the icdA, LipL32, LipL41, and secY genes (Table S1).
All acquired sequences were clustered within the Leptospira P1/pathogenic clade (Figure 1). The analyzed sequences were closely related to specific Leptospira species: seven sequences (COV009, COV011, COV012, COV013, COV014, COV021, COV023) grouped with Leptospira santarosai, including those with more than one successfully identified sequence molecular marker (COV009, COV013, COV021, COV023), forming a robustly supported clade and indicating a close relationship with the reference species due to the short branch distances (Figure 1). Five sequences (COV001, COV004, COV005, COV006, and COV024) clustered together, forming a clade closely related to Leptospira noguchii, Leptospira kirschneri, and Leptospira interrogans but exhibiting considerable genetic divergence from these three reference species (Figure 1). Finally, an additional sequence (COV015) formed a clade with Leptospira borgpetersenii, also showing a notably high branch distance (Figure 1).
Furthermore, a BLAST analysis was also performed on all good-quality sequences obtained in the present study. The BLAST analysis of Leptospira rrs sequences showed that all of them had a high similarity to sequences of recognized human-pathogenic Leptospira species (L. borgpetersenii, L. interrogans, L. kirschneri, L. noguchii, and L. santarosai). In some cases, a sequence obtained from febrile patients presented high similarity with sequences from more than one Leptospira species. The BLAST analysis of all Leptospira icdA, LipL32, LipL41, and secY sequences showed a high percentage of identity only with sequences of L. santarosai. More information can be observed in Table 2.

4. Discussion

The municipality of Villeta has been recognized for several years as an endemic region for spotted fever group rickettsiosis, where Rickettsia rickettsii is actively circulating [33,34]. However, two studies performed in the region that aimed to characterize the etiology of AUFI have identified other diseases such as dengue and leptospirosis as important causes of febrile illnesses [25,26]. Despite the importance of spotted fever group rickettsiosis, in one of these studies, leptospirosis was identified as the main and most frequent cause of AUFI [25], which highlights the importance of this zoonotic disease in the region. However, despite the surveillance performed by the Colombian national surveillance system, nothing is known regarding the circulating Leptospira strains associated with human leptospirosis in the region. The present study fills this gap by assessing the presence of pathogenic Leptospira species among febrile patients recruited in the municipality of Villeta and identifying them as L. santarosai and other species closely related to recognized human-pathogenic Leptospira species as causes of leptospirosis in the region.
Throughout the world, in several tropical and subtropical regions, leptospirosis has been recognized as one of the most important and frequent causes of febrile illness, as well as the most widespread zoonosis worldwide. It has also gained great relevance due to its re-emergence in several regions of different countries, becoming a major public health problem [10,35]. Since 2007, leptospirosis has been a mandatorily reported disease for the Colombian National Surveillance System (SIVIGILA) due to the unusual increase in reported cases throughout the national territory [36]. Cases of leptospirosis have been reported in all 32 departments of Colombia since 2007 until 2023; however, the largest number of cases was concentrated and reported in the department of Antioquia (https://www.ins.gov.co accessed on 30 May 2024), including municipalities from the Urabá gulf region, which is the most important and main endemic region for leptospirosis in Colombia [37]. Regarding the department of Cundinamarca, a total of 8.5% of the reported cases of leptospirosis by the national surveillance system between 2015 and 2020 came from this region [20]. In the year 2023, a total of 202 suspected cases were reported in the department of Cundinamarca, representing the 2.9% of cases reported throughout the country. For the first four epidemiological weeks of 2024, 65 suspected cases were already reported, which represent the 2.7% of all reported cases in the country, suggesting an increase in suspected cases of leptospirosis in the department of Cundinamarca (http://www.ins.gov.co/buscador-eventos/Informesdeevento accessed on 30 May 2024).
Despite the available data from the national surveillance system, few studies have been performed in regions in which leptospirosis has been identified as an important cause of AUFI. In the department of Valle Del Cauca, leptospirosis was confirmed in 20.6% (31/150) of suspected cases reported between 2003 and 2006 by different healthcare centers of the public network of the department [38]. In the Urabá region of the department of Antioquia, leptospirosis was identified as the cause of AUFI in 14.1% (31/220) of febrile patients recruited from three different municipalities [39]. In the Córdoba department, leptospirosis was identified as the etiology in 39.1% (27/69) of recruited AUFI patients from a main hospital of the region [40], and more recently, acute leptospirosis was confirmed in 19.8% (67/339) of suspected cases from two health service provider institutions of the department [24].
In the municipality of Villeta, Cundinamarca, leptospirosis was identified as the cause of AUFI in 24% (25/104) and 21.4% (12/56) of recruited patients in 2017 and 2023, respectively [25,26]. In the last study, only five of the twelve identified cases were detected through conventional PCR. Considering the recommendations published elsewhere [41], and considering that the use of qPCR is a more sensitive method than its conventional variant [42], in the present study, we decided to use a qualitative qPCR screening method on the same samples to reduce the underreporting of cases. We detected the presence of Leptospira spp. in fourteen febrile patients’ acute blood samples, of which five reported cases were already diagnosed through conventional PCR and one reported case through ELISA IgM and confirmed with seroconversion [26], yielding a total of eight more cases that were initially unreported.
Furthermore, through sequencing analyses performed on these samples, thirteen high-quality sequences were obtained for the Leptospira rrs gene, which were greatly similar to L. borgpetersenii, L. noguchii, L. kirschneri, and L. santarosai. Furthermore, in a second step using an MLST approach targeting five complementary genes, good-quality sequences were obtained from four processed samples, and through phylogenetic analyses, L. santarosai was identified as the infectious species in these samples. Previous studies have shown that by far the most studied species in terms of virulence, epidemiology, and other characteristics was L. interrogans, probably due to its widespread distribution, leaving behind other Leptospira species that are more geographically restricted, for which little is known to date [43]. One of these species is L. santarosai, described in 1987 and named in honor of Carlos A. Santa Rosa, a Brazilian veterinary microbiologist and pioneer in the study of leptospirosis in that country, and is a recognized pathogenic species associated with both human and animal leptospirosis [44,45,46]. Although L. santarosai has been recognized as an important agent of leptospirosis in several countries in Central and South America [47], its presence has also been reported in a few regions outside the American continent, such as Sri Lanka, India, and Taiwan [48,49,50]. This suggests that this Leptospira sp. is more widespread than what is known to date. Available information has revealed that L. santarosai has been isolated from a few domestic and wild animal species such as dogs and capybaras [51,52]. However, ruminant species such as bovines and goats appear to be the most important hosts of this Leptospira sp. [53,54,55], representing a high risk of exposure for populations that work with cattle. In Colombia, this species has already been described as an agent of human and canine leptospirosis [56,57].
The remaining nine additional positive Leptospira rrs samples in which a sequence was obtained (COV001, COV004, COV005, COV006, COV011, COV012, COV014, COV015, and COV024) could not be amplified for any complementary gene; however, through phylogenetic analyses, three of them also showed a strong relationship with L. santarosai and probably belong to that species. Of the remaining six sequences, five formed a clade within L. interrogans, L. kirschneri, and L. noguchii species, all of which have already been recognized as pathogenic species associated with human and animal leptospirosis [7,58,59,60]. One last sequence formed a clade related with L. borgpetersenii, a well-known pathogenic species associated with the intensification of agriculture patches and animal farms [6,61,62]. However, considering that these isolated sequences exhibited considerable genetic divergence and a notably high branch distance from reference sequences, in addition to only being amplified for a single targeted gene, it was not possible to identify the specific Leptospira species. It is probable that these sequences belong to novel, unrecognized species highly related to human-pathogenic Leptospira species. Atypical genomic features have been identified among a few human-pathogenic Leptospira species, which suggests an ongoing evolution of this group of leptospires and a diversification of lineages that also impacts in their pathogenicity. Therefore, specific genetic determinants that have undergone positive selection during Leptospira evolution not only favor their diversification into novel species and strains but also contribute directly to their virulence [3,63]. Thus, understanding the eco-epidemiology of leptospirosis and its transmission dynamics [64] in endemic areas is a crucial step in creating prevention and control measures.

5. Conclusions

The present study described the presence of pathogenic Leptospira spp. among febrile patients from the Villeta municipality of Cundinamarca, Colombia. It also identified L. santarosai as one of the causative agents of leptospirosis in the region, as well as two different Leptospira strains closely related to recognized human-pathogenic Leptospira species, which are probably novel species. These data reinforce the importance of leptospirosis as one of the common causes of AUFI, highlight the importance of L. santarosai as perhaps the main Leptospira species associated with human leptospirosis in this region, and provide preliminary evidence of other Leptospira species associated with human disease that are not yet officially recognized. Further studies are needed in the region to better understand the epidemiology of leptospirosis associated with L. santarosai and other Leptospira species in the region and create appropriate preventive and control measurements to avoid infection.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/tropicalmed9080168/s1: Table S1: Database used for the concatenated phylogenetic analysis performed on Leptospira obtained sequences from patients with febrile patients from the Villeta municipality, Cundinamarca department, Colombia.

Author Contributions

Conceptualization, C.R.S.-R., Á.A.F.-M., C.C. and M.H.; Methodology, C.R.S.-R., Á.A.F.-M., C.C. and M.H.; Validation, Á.A.F.-M., C.C. and M.H.; Formal analysis, C.R.S.-R.; Investigation, C.R.S.-R., J.M.M.-G. and J.G.-M.; Resources, Á.A.F.-M., C.C., P.C.M., P.V.A., M.M.C., J.D.R. and M.H.; Data Curation: C.R.S.-R. and J.M.M.-G.; Writing—Original Draft, C.R.S.-R. and J.M.M.-G.; Writing—Review & Editing, J.G.-M., H.-C.M.D., Á.A.F.-M., C.C., P.C.M., P.V.A., M.M.C., J.D.R. and M.H.; Visualization, J.M.M.-G.; Supervision, Á.A.F.-M., C.C. and M.H.; Project administration, J.D.R. and M.H.; Funding acquisition, P.C.M., P.V.A., M.M.C., J.D.R. and M.H. All authors have read and agreed to the published version of the manuscript.

Funding

This study was supported as part of the GIDRN—Global Infectious Disease Research Network, with funding from the Center for Tropical Diseases (CTD) and Division of Infectious Diseases at the University of Texas Medical Branch (UTMB); by Minciencias, through grant # 111584467514, Project name: “Caracterización etiológica del sindrome febril agudo indiferenciado (SFAI) en dos regiones de Colombia”; and by a Minigrant 6 No. 8714-2023 financed by the Fogarty program, grant code D43-TW010331, University Texas Medical Branch (UTMB). This work forms part of the original results obtained from the Ph.D. program of Carlos Ramiro Silva-Ramos, whose training was provided by the program “Fortalecimiento de los programas de doctorado apoyos financieros para estudiantes de programas de doctorado convocatoria-2021”, financed by a 2021 grant from the Academic Vice-Rector’s Office of the “Pontificia Universidad Javeriana”, Bogotá D.C., Colombia.

Institutional Review Board Statement

The study was conducted in accordance with the Declaration of Helsinki, and approved by the Institutional Review Board (or Ethics Committee) of Pontificia Universidad Javeriana (protocol code No. 7 from May 2th 2019). The study procedures, management, conservation of biological specimens, and technical-administrative procedures adhere to health research regulations as stated in resolution 8430 of the Ministry of Health of Colombia from 1993 and declaration of Helsinki for ethical and medical research in human subjects.

Informed Consent Statement

Informed consent was obtained from all subjects involved in the study.

Data Availability Statement

The data generated and analyzed during the current study are not publicly available, but they can be shared upon request to the corresponding authors.

Acknowledgments

We would like to thank the health authorities at the “Salazar de Villeta” hospital in the municipality of Villeta, Cundinamarca department, Colombia, for their collaboration, as well as the patients who voluntarily agreed to participate in the study. We also thank GIDRN—Global Infectious Disease Research Network and Minciencias for the financial support provided to obtain the samples processed in the present study. Members of the GIDRN—Global Infectious Diseases Research Network that are included in the present study as authors are Peter C. Melby, Patricia V. Aguilar, Miguel M. Cabada, Juan David Rodas, and Marylin Hidalgo. Other members of the GIDRN—Global Infectious Diseases Research Network are Antonio Ortega-Pacheco, David H. Walker, Eugenia S. Gonzalez-Diaz, Francisco J. Diaz, Karen Mozo, Margarita Arboleda, Mathew M. Dacso, Matilde Jimenez-Coello, Robert Paulino-Ramirez, and Scott C. Weaver.

Conflicts of Interest

The authors declare no conflicts of interest. All authors have read and approved the submitted manuscript. The authors declare that the article has not received prior publication and is not under consideration for publication elsewhere. On behalf of all co-authors, the corresponding authors shall bear full responsibility for the submission.

References

  1. Adler, B.; de la Peña Moctezuma, A. Leptospira and leptospirosis. Vet. Microbiol. 2010, 140, 287–296. [Google Scholar] [CrossRef] [PubMed]
  2. Picardeau, M. Virulence of the zoonotic agent of leptospirosis: Still terra incognita? Nat. Rev. Microbiol. 2017, 15, 297–307. [Google Scholar] [CrossRef] [PubMed]
  3. Vincent, A.T.; Schiettekatte, O.; Goarant, C.; Neela, V.K.; Bernet, E.; Thibeaux, R.; Ismail, N.; Khalid, M.K.N.M.; Amran, F.; Masuzawa, T.; et al. Revisiting the taxonomy and evolution of pathogenicity of the genus Leptospira through the prism of genomics. PLoS Negl. Trop. Dis. 2019, 13, e0007270. [Google Scholar] [CrossRef] [PubMed]
  4. Ellis, W.A. Animal Leptospirosis. In Leptospira and Leptospirosis; Adler, B., Ed.; Springer: Berlin/Heidelberg, Germany, 2015; pp. 99–137. [Google Scholar] [CrossRef]
  5. Cilia, G.; Bertelloni, F.; Fratini, F. Leptospira Infections in Domestic and Wild Animals. Pathogens 2020, 9, 573. [Google Scholar] [CrossRef] [PubMed]
  6. Cilia, G.; Bertelloni, F.; Albini, S.; Fratini, F. Insight into the Epidemiology of Leptospirosis: A Review of Leptospira Isolations from “Unconventional” Hosts. Animals 2021, 11, 191. [Google Scholar] [CrossRef] [PubMed]
  7. Stimson, A.M. Note on an organism found in yellow-fever tissue. Public Health Rep. 1907, 22, 541. [Google Scholar] [CrossRef]
  8. Perolat, P.; Chappel, R.J.; Adler, B.; Baranton, G.; Bulach, D.M.; Billinghurst, M.L.; Letocart, M.; Merien, F.; Serrano, M.S. Leptospira fainei sp. nov., isolated from pigs in Australia. Int. J. Syst. Bacteriol. 1998, 48, 851–858. [Google Scholar] [CrossRef] [PubMed]
  9. Costa, F.; Hagan, J.E.; Calcagno, J.; Kane, M.; Torgerson, P.; Martinez-Silveira, M.S.; Stein, C.; Abela-Ridder, B.; Ko, A.I. Global Morbidity and Mortality of Leptospirosis: A Systematic Review. PLoS Negl. Trop. Dis. 2015, 9, e0003898. [Google Scholar] [CrossRef] [PubMed]
  10. Karpagam, K.B.; Ganesh, B. Leptospirosis: A neglected tropical zoonotic infection of public health importance-an updated review. Eur. J. Clin. Microbiol. Infect. Dis. 2020, 39, 835–846. [Google Scholar] [CrossRef] [PubMed]
  11. Halliday, J.E.; Carugati, M.; Snavely, M.E.; Allan, K.J.; Beamesderfer, J.; Ladbury, G.A.; Hoyle, D.V.; Holland, P.; Crump, J.A.; Cleaveland, S.; et al. Zoonotic causes of febrile illness in malaria endemic countries: A systematic review. Lancet Infect Dis. 2020, 20, e27–e37. [Google Scholar] [CrossRef]
  12. Browne, E.S.; Pereira, M.; Barreto, A.; Zeppelini, C.G.; de Oliveira, D.; Costa, F. Prevalence of human leptospirosis in the Americas: A systematic review and meta-analysis. Rev. Panam. Salud Publica 2023, 47, e126. [Google Scholar] [CrossRef]
  13. Viroj, J.; Claude, J.; Lajaunie, C.; Cappelle, J.; Kritiyakan, A.; Thuainan, P.; Chewnarupai, W.; Morand, S. Agro-Environmental Determinants of Leptospirosis: A Retrospective Spatiotemporal Analysis (2004-2014) in Mahasarakham Province (Thailand). Trop. Med. Infect. Dis. 2021, 6, 115. [Google Scholar] [CrossRef]
  14. Yupiana, Y.; Wilson, P.R.; Weston, J.F.; Vallée, E.; Collins-Emerson, J.M.; Benschop, J.; Scotland, T.; Heuer, C. Epidemiological investigation of Leptospira spp. in a dairy farming enterprise after the occurrence of three human leptospirosis cases. Zoonoses Public Health 2019, 66, 470–479. [Google Scholar] [CrossRef]
  15. Hassell, J.M.; Begon, M.; Ward, M.J.; Fèvre, E.M. Urbanization and Disease Emergence: Dynamics at the Wildlife-Livestock-Human Interface. Trends Ecol. Evol. 2017, 32, 55–67. [Google Scholar] [CrossRef] [PubMed]
  16. Rajapakse, S. Leptospirosis: Clinical aspects. Clin. Med. 2022, 22, 14–17. [Google Scholar] [CrossRef]
  17. Sykes, J.E.; Reagan, K.L.; Nally, J.E.; Galloway, R.L.; Haake, D.A. Role of Diagnostics in Epidemiology, Management, Surveillance, and Control of Leptospirosis. Pathogens 2022, 11, 395. [Google Scholar] [CrossRef]
  18. Villegas Vélez, Á.A.; Castrillón Gallego, C. Territorio, enfermedad y población en la producción de la geografía tropical colombiana, 1872–1934. Hist. Crit. 2006, 32, 94–117. [Google Scholar] [CrossRef]
  19. Silva-Ramos, C.R.; Faccini-Martínez, Á.A.; Serna-Rivera, C.C.; Mattar, S.; Hidalgo, M. Etiologies of Zoonotic Tropical Febrile Illnesses That Are Not Part of the Notifiable Diseases in Colombia. Microorganisms 2023, 11, 2154. [Google Scholar] [CrossRef] [PubMed]
  20. Barrera, E.L.P.; Reales-González, J.; Salas, D.; Santamaría, E.R.; Bello, S.; Rico, A.; Pardo, L.; Parra, E.; Rodriguez, K.; Alarcon, Z.; et al. Fatal acute undifferentiated febrile illness among clinically suspected leptospirosis cases in Colombia, 2016–2019. PLoS Negl. Trop. Dis. 2023, 17, e0011683. [Google Scholar] [CrossRef]
  21. Calderón, A.; Rodríguez, V.; Máttar, S.; Arrieta, G. Leptospirosis in pigs, dogs, rodents, humans, and water in an area of the Colombian tropics. Trop. Anim. Health Prod. 2014, 46, 427–432. [Google Scholar] [CrossRef]
  22. Ensuncho-Hoyos, C.; Rodríguez-Rodríguez, V.; Pérez-Doria, A.; Vergara, O.; Calderón-Rangel, A. Epidemiology behavior of leptospirosis in Ciénaga de Oro, Córdoba (Colombia). Trop. Anim. Health Prod. 2017, 49, 1345–1351. [Google Scholar] [CrossRef] [PubMed]
  23. Quintero-Vélez, J.C.; Rodas, J.D.; Rojas, C.A.; Ko, A.I.; Wunder, E.A. Leptospira Infection in Rural Areas of Urabá Region, Colombia: A Prospective Study. Am. J. Trop. Med. Hyg. 2022, 107, 1267–1277. [Google Scholar] [CrossRef] [PubMed]
  24. Rodríguez-Rodríguez, V.; Castro-Cordero, A.; Calderón-Rangel, A.; Martínez-Ibarra, E.; Yasnot, M.; Agudelo-Flórez, P.; Monroy, F.P. Acute human leptospirosis in a Caribbean region of Colombia: From classic to emerging risk factors. Zoonoses Public Health 2024, 71, 107–119. [Google Scholar] [CrossRef] [PubMed]
  25. Faccini-Martínez, Á.A.; Ramírez-Hernández, A.; Barreto, C.; Forero-Becerra, E.; Millán, D.; Valbuena, E.; Sánchez-Alfonso, A.C.; Imbacuán-Pantoja, W.O.; Cortés-Vecino, J.A.; Polo-Terán, L.J.; et al. Epidemiology of Spotted Fever Group Rickettsioses and Acute Undifferentiated Febrile Illness in Villeta, Colombia. Am. J. Trop. Med. Hyg. 2017, 97, 782–788. [Google Scholar] [CrossRef] [PubMed]
  26. Silva-Ramos, C.R.; Gil-Mora, J.; Serna-Rivera, C.C.; Martínez Díaz, H.C.; Restrepo-López, N.; Agudelo-Flórez, P.; Arboleda, M.; Díaz, F.J.; Faccini-Martínez, Á.A.; Hidalgo, M.; et al. Etiological characterization of acute undifferentiated febrile illness in Apartadó and Villeta municipalities, Colombia, during COVID-19 pandemic. Infez. Med. 2023, 31, 517–532. [Google Scholar] [CrossRef] [PubMed]
  27. du Breuil, R.M.; Patel, J.M.; Mendelow, B.V. Quantitation of beta-actin-specific mRNA transcripts using xeno-competitive PCR. PCR Methods Appl. 1993, 3, 57–59. [Google Scholar] [CrossRef] [PubMed]
  28. Bessa, T.A.; Spichler, A.; Chapola, E.G.; Husch, A.C.; de Almeida, M.F.; Sodré, M.M.; Mouriz Savani, E.S.M.; Veiga Sacramento, D.R.; Vinetz, J.M. The contribution of bats to leptospirosis transmission in Sao Paulo City, Brazil. Am. J. Trop. Med. Hyg. 2010, 82, 315–317. [Google Scholar] [CrossRef] [PubMed]
  29. Ahmed, N.; Devi, S.M.; De los Á Valverde, L.; Vijayachari, P.; Machang’u, R.S.; Ellis, W.A.; Hartskeerl, R.A. Multilocus sequence typing method for identification and genotypic classification of pathogenic Leptospira species. Ann. Clin. Microbiol. Antimicrob. 2006, 5, 28. [Google Scholar] [CrossRef]
  30. Thompson, J.D.; Higgins, D.G.; Gibson, T.J.; Clustal, W. Improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 1994, 22, 4673–4680. [Google Scholar] [CrossRef]
  31. Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular Evolutionary Genetics Analysis across Computing Platforms. Mol. Biol. Evol. 2018, 35, 1547–1549. [Google Scholar] [CrossRef]
  32. Stamatakis, A. RAxML version 8: A tool for phylogenetic analysis and post-analysis of large phylogenies. Bioinformatics 2014, 30, 1312–1313. [Google Scholar] [CrossRef] [PubMed]
  33. Patino, L.; Afanador, A.; Paul, J.H. A spotted fever in Tobia, Colombia. Preliminary report. Am. J. Trop. Med. Hyg. 1937, 17, 639–653. [Google Scholar] [CrossRef]
  34. Hidalgo, M.; Orejuela, L.; Fuya, P.; Carrillo, P.; Hernandez, J.; Parra, E.; Keng, C.; Small, M.; Olano, J.P.; Bouyer, D.; et al. Rocky Mountain spotted fever, Colombia. Emerg. Infect. Dis. 2007, 13, 1058–1060. [Google Scholar] [CrossRef] [PubMed]
  35. Bharti, A.R.; Nally, J.E.; Ricaldi, J.N.; Matthias, M.A.; Diaz, M.M.; Lovett, M.A.; Levett, P.N.; Gilman, R.H.; Willig, M.R.; Gotuzzo, E.; et al. Leptospirosis: A zoonotic disease of global importance. Lancet Infect. Dis. 2003, 3, 757–771. [Google Scholar] [CrossRef] [PubMed]
  36. Gutiérrez, J.D.; Martínez-Vega, R.A. Spatiotemporal dynamics of human leptospirosis and its relationship with rainfall anomalies in Colombia. Trans. R. Soc. Trop. Med. Hyg. 2018, 112, 115–123. [Google Scholar] [CrossRef]
  37. Gutiérrez, J.D.; Martínez-Vega, R.A.; Botello, H.; Ruiz-Herrera, F.J.; Arenas-López, L.C.; Hernandez-Tellez, K.D. Environmental and socioeconomic determinants of leptospirosis incidence in Colombia. Cad. Saude Publica 2019, 35, e00118417. [Google Scholar] [CrossRef]
  38. Astudillo Hernández, M.; González Rodríguez, A.; Batista Santiesteban, N.; Mirabal Sosa, M.; Menéndez Hernández, J. Estudio seroepidemiológico de la leptospirosis humana en el departamento del Valle del Cauca, Colombia. Rev. Cubana Med. Trop. 2009, 61, 1–10. [Google Scholar]
  39. Arroyave, E.; Londoño, A.F.; Quintero, J.C.; Agudelo-Flórez, P.; Arboleda, M.; Díaz, F.J.; Rodas, J.D. Etiología y caracterización epidemiológica del síndrome febril no palúdico en tres municipios del Urabá antioqueño, Colombia. Biomedica 2013, 33, 99–107. [Google Scholar] [PubMed]
  40. Mattar, S.; Tique, V.; Miranda, J.; Montes, E.; Garzon, D. Undifferentiated tropical febrile illness in Cordoba, Colombia: Not everything is dengue. J. Infect. Public Health 2017, 10, 507–512. [Google Scholar] [CrossRef]
  41. Arboleda, M.; Mejía-Torres, M.; Posada, M.; Restrepo, N.; Ríos-Tapias, P.; Rivera-Pedroza, L.A.; Calle, D.; Sánchez-Jiménez, M.M.; Marín, K.; Agudelo-Flórez, P. Molecular Diagnosis as an Alternative for Public Health Surveillance of Leptospirosis in Colombia. Microorganisms 2023, 11, 2759. [Google Scholar] [CrossRef]
  42. Waggoner, J.J.; Pinsky, B.A. Molecular diagnostics for human leptospirosis. Curr. Opin. Infect. Dis. 2016, 29, 440–445. [Google Scholar] [CrossRef] [PubMed]
  43. Guglielmini, J.; Bourhy, P.; Schiettekatte, O.; Zinini, F.; Brisse, S.; Picardeau, M. Genus-wide Leptospira core genome multilocus sequence typing for strain taxonomy and global surveillance. PLoS Negl. Trop. Dis. 2019, 13, e0007374. [Google Scholar] [CrossRef] [PubMed]
  44. Yasuda, P.H.; Steigerwalt, A.G.; Sulzer, K.R.; Kaufmann, A.F.; Rogers, F.; Brenner, D.J. Deoxyribonucleic acid relatedness between serogroups and serovars in the family Leptospiraceae with proposals for seven new Leptospira species. Int. J. Syst. Evol. Microbiol. 1987, 37, 407–415. [Google Scholar] [CrossRef]
  45. Kallel, H.; Bourhy, P.; Mayence, C.; Houcke, S.; Hommel, D.; Picardeau, M.; Caro, V.; Matheus, S. First report of human Leptospira santarosai infection in French Guiana. J. Infect. Public Health 2020, 13, 1181–1183. [Google Scholar] [CrossRef] [PubMed]
  46. Aymée, L.; Nogueira Di Azevedo, M.I.; de Souza Pedrosa, J.; Loria de Melo, J.D.S.; Carvalho-Costa, F.A.; Lilenbaum, W. The role of Leptospira santarosai serovar Guaricura as agent of Bovine Genital Leptospirosis. Vet. Microbiol. 2022, 268, 109413. [Google Scholar] [CrossRef] [PubMed]
  47. Chinchilla, D.; Nieves, C.; Gutiérrez, R.; Sordoillet, V.; Veyrier, F.J.; Picardeau, M. Phylogenomics of Leptospira santarosai, a prevalent pathogenic species in the Americas. PLoS Negl. Trop. Dis. 2023, 17, e0011733. [Google Scholar] [CrossRef] [PubMed]
  48. Naotunna, C.; Agampodi, S.B.; Agampodi, T.C. Etiological agents causing leptospirosis in Sri Lanka: A review. Asian Pac. J. Trop. Med. 2016, 9, 390–394. [Google Scholar] [CrossRef]
  49. Lata, K.S.; Vaghasia, V.; Bhairappanavar, S.B.; Kumar, S.; Ayachit, G.; Patel, S.; Das, J. Whole genome sequencing and de novo assembly of three virulent Indian isolates of Leptospira. Infect. Genet. Evol. 2020, 85, 104579. [Google Scholar] [CrossRef] [PubMed]
  50. Wang, H.K.; Lee, M.H.; Chen, Y.C.; Hsueh, P.R.; Chang, S.C. Factors associated with severity and mortality in patients with confirmed leptospirosis at a regional hospital in northern Taiwan. J. Microbiol. Immunol. Infect. 2020, 53, 307–314. [Google Scholar] [CrossRef]
  51. Miotto, B.A.; Moreno, L.Z.; Guilloux, A.G.A.; de Sousa, G.O.; Loureiro, A.P.; Moreno, A.M.; Lilenbaum, W.; Vasconcellos, S.A.; Heinemann, M.B.; Hagiwara, M.K. Molecular and serological characterization of the first Leptospira santarosai strain isolated from a dog. Acta Trop. 2016, 162, 1–4. [Google Scholar] [CrossRef]
  52. Moreno, L.Z.; Miraglia, F.; Marvulo, M.F.V.; Silva, J.C.R.; Paula, C.D.; Costa, B.L.P.; Morais, Z.M.; Ferreira, F.; Neto, J.S.F.; Dellagostin, O.A.; et al. Characterization of Leptospira santarosai Serogroup Grippotyphosa Serovar Bananal Isolated from Capybara (Hydrochaeris hydrochaeris) in Brazil. J. Wildl. Dis. 2016, 52, 688–693. [Google Scholar] [CrossRef]
  53. Kremer, F.S.; Eslabão, M.R.; Provisor, M.; Woloski, R.D.S.; Ramires, O.V.; Moreno, L.Z.; Moreno, A.M.; Hamond, C.; Lilenbaum, W.; Dellagostin, O.A. Draft Genome Sequences of Leptospira santarosai Strains U160, U164, and U233, Isolated from Asymptomatic Cattle. Genome Announc. 2015, 3, e00910-15. [Google Scholar] [CrossRef]
  54. Lilenbaum, W.; Kremer, F.; Ristow, P.; Dellagostin, O.; Bourhy, P.; Hartskeerl, R.; Vasconcellos, S. Molecular characterization of the first leptospires isolated from goats in Brazil. Braz. J. Microbiol. 2015, 45, 1527–1530. [Google Scholar] [CrossRef] [PubMed]
  55. Hamond, C.; Dirsmith, K.L.; LeCount, K.; Soltero, F.V.; Rivera-Garcia, S.; Camp, P.; Anderson, T.; Hicks, J.A.; Galloway, R.; Sutherland, G.; et al. Leptospira borgpetersenii serovar Hardjo and Leptospira santarosai serogroup Pyrogenes isolated from bovine dairy herds in Puerto Rico. Front. Vet. Sci. 2022, 9, 1025282. [Google Scholar] [CrossRef]
  56. Peláez Sanchez, R.G.; Lopez, J.Á.; Pereira, M.M.; Arboleda Naranjo, M.; Agudelo-Flórez, P. Genetic diversity of Leptospira in northwestern Colombia: First report of Leptospira santarosai as a recognised leptospirosis agent. Mem. Inst. Oswaldo Cruz. 2016, 111, 737–744. [Google Scholar] [CrossRef] [PubMed]
  57. Perez-Garcia, J.; Monroy, F.P.; Agudelo-Florez, P. Canine Leptospirosis in a Northwestern Region of Colombia: Serological, Molecular and Epidemiological Factors. Pathogens 2022, 11, 1040. [Google Scholar] [CrossRef]
  58. Silva, E.F.; Cerqueira, G.M.; Seyffert, N.; Seixas, F.K.; Hartwig, D.D.; Athanazio, D.A.; Pinto, L.S.; Queiroz, A.; Ko, A.I.; Brod, C.S.; et al. Leptospira noguchii and human and animal leptospirosis, Southern Brazil. Emerg. Infect. Dis. 2009, 15, 621–623. [Google Scholar] [CrossRef]
  59. Philip, N.; Affendy, N.B.; Ramli, S.N.A.; Arif, M.; Raja, P.; Nagandran, E.; Renganathan, P.; Taib, N.M.; Masri, S.N.; Yuhana, M.Y.; et al. Leptospira interrogans and Leptospira kirschneri are the dominant Leptospira species causing human leptospirosis in Central Malaysia. PLoS Negl. Trop. Dis. 2020, 14, e0008197. [Google Scholar] [CrossRef] [PubMed]
  60. Soares, P.M.; Gomes, D.O.; Macedo, F.P.; Soares, M.M.; Lemes, K.R.; Jaeger, L.H.; Lilenbaum, W.; Lima, A.M. Serological and molecular characterization of Leptospira kirschneri serogroup Grippotyphosa isolated from bovine in Brazil. Microb. Pathog. 2020, 138, 103803. [Google Scholar] [CrossRef]
  61. Bandara, A.G.N.M.K.; Kalaivarny, G.; Perera, N.; Indrakumar, J. Aseptic meningitis as the initial presentation of Leptospira borgpetersenii serovar Tarassovi: Two case reports and a literature review. BMC Infect. Dis. 2021, 21, 488. [Google Scholar] [CrossRef]
  62. Moinet, M.; Wilkinson, D.A.; Aberdein, D.; Russell, J.C.; Vallée, E.; Collins-Emerson, J.M.; Heuer, C.; Benschop, J. Of Mice, Cattle, and Men: A Review of the Eco-Epidemiology of Leptospira borgpetersenii Serovar Ballum. Trop. Med. Infect. Dis. 2021, 6, 189. [Google Scholar] [CrossRef] [PubMed]
  63. Giraud-Gatineau, A.; Nieves, C.; Harrison, L.B.; Benaroudj, N.; Veyrier, F.J.; Picardeau, M. Evolutionary insights into the emergence of virulent Leptospira spirochetes. bioRxiv 2024. [Google Scholar] [CrossRef] [PubMed]
  64. Barragan, V.; Chiriboga, J.; Miller, E.; Olivas, S.; Birdsell, D.; Hepp, C.; Hornstra, H.; Schupp, J.M.; Morales, M.; Gonzalez, M.; et al. High Leptospira Diversity in Animals and Humans Complicates the Search for Common Reservoirs of Human Disease in Rural Ecuador. PLoS Negl. Trop. Dis. 2016, 10, e0004990. [Google Scholar] [CrossRef] [PubMed]
Tropicalmed 09 00168 g001
Figure 1. Maximum-likelihood phylogeny of Leptospira spp. based on concatenated sequences (rrs, icdA, secY, LipL32, or LipL41) detected in patients with leptospirosis from Villeta municipality. Sequences are signaled by human icons, and Leptospira groups are indicated by colored boxes as follows: blue—P1 or pathogenic Leptospira spp.; green—P2 or intermediate Leptospira spp.; orange—S1/S2 or non-pathogenic Leptospira spp. Clades with Leptospira sequences obtained from febrile patients from the municipality of Villeta mixed with or related to Leptospira species reference sequences are denoted by dashed boxes. Only bootstraps higher than 70% are shown. A more extensive description of the sequences used for each human sample or Leptospira reference genome can be found in Table S1.
Figure 1. Maximum-likelihood phylogeny of Leptospira spp. based on concatenated sequences (rrs, icdA, secY, LipL32, or LipL41) detected in patients with leptospirosis from Villeta municipality. Sequences are signaled by human icons, and Leptospira groups are indicated by colored boxes as follows: blue—P1 or pathogenic Leptospira spp.; green—P2 or intermediate Leptospira spp.; orange—S1/S2 or non-pathogenic Leptospira spp. Clades with Leptospira sequences obtained from febrile patients from the municipality of Villeta mixed with or related to Leptospira species reference sequences are denoted by dashed boxes. Only bootstraps higher than 70% are shown. A more extensive description of the sequences used for each human sample or Leptospira reference genome can be found in Table S1.
Tropicalmed 09 00168 g001
Table 1. Detection of Leptospira spp. considering the demographic characteristics of recruited febrile patients in the municipality of Villeta.
Table 1. Detection of Leptospira spp. considering the demographic characteristics of recruited febrile patients in the municipality of Villeta.
Demographic Characteristicn (%)Leptospira spp. Detection (%)
No. of patients56 (100)14 (25)
Gender
  Male30 (53.6)10 (33.3)
  Female26 (46.4)4 (15.3)
Age groups
  Children (3–12)6 (10.7)5 (83.3)
  Adolescents (13–16)4 (7.1)1 (25)
  Young adults (17–29)21 (37.5)4 (19)
  Middle-aged adults (30–44)12 (21.5)2 (16.7)
  Older adults (above 45)13 (23.2)2 (15.4)
Origin
  Urban area47 (83.9)10 (21.3)
  Rural area9 (16.1)4 (44.4)
Sampling month
  September6 (10.7)4 (66.7)
  October7 (12.5)5 (71.4)
  November10 (17.9)4 (40)
  December33 (58.9)1 (3)
Table 2. Description of the BLASTn results using Leptospira rrs, secY, LipL32, LipL41, and icdA sequences obtained from febrile patients’ samples and their relations with previously reported serological results.
Table 2. Description of the BLASTn results using Leptospira rrs, secY, LipL32, LipL41, and icdA sequences obtained from febrile patients’ samples and their relations with previously reported serological results.
Sample IDGeneBLASTn ResultsSerological Results
from Silva-Ramos et al. 2023 [26]
OrganismIdentity (%)Coverage (%)e-ValueGenBank ID
COV001rrsL. noguchii96.3%100.0%1 × 10−91CP091936.1Positive IgM in acute and convalescent samples
Seroconversion to serovar Bratislava
Seroconversion to serovar Hardjo
COV004rrsL. noguchii96.7%100.0%4 × 10−91CP091936.1
COV005rrsL. noguchii96.4%100.0%4 × 10−96CP091936.1
COV006rrsL. noguchii96.4%100.0%3 × 10−82CP091967.1
COV009rrsL. santarosai100.0%100.0%2 × 10−88MH801931.1Positive IgM in convalescent sample
L. interrogans *100.0%100.0%2 × 10−88MH686123.1
secYL. santarosai100.0%100.0%6 × 10−169MK315145.1
icdAL. santarosai99.7%99.0%4 × 10−175KC492816.1
COV011rrsL. santarosai100.0%100.0%9 × 10−103MH801931.1
L. interrogans *100.0%100.0%9 × 10−103MH686123.1
COV012rrsL. santarosai100.0%100.0%9 × 10−103MH801931.1
L. interrogans *100.0%100.0%9 × 10−103MH686123.1
COV013rrsL. santarosai100.0%100.0%9 × 10−103MH801931.1Positive IgM in convalescent sample
L. interrogans *100.0%100.0%9 × 10−103MH686123.1
secYL. santarosai99.7%100.0%0EU358050.1
LipL32L. santarosai100.0%100.0%9 × 10−116PP554251.1
LipL41L. santarosai99.5%100.0%0AY461959.1
COV014rrsL. santarosai100.0%100.0%5 × 10−90MH801931.1Positive IgM in convalescent sample
L. interrogans *100.0%100.0%5 × 10−90MH686123.1
COV015rrsL. borgpetersenii94.7%100.0%3 × 10−66CP047520.1
COV021rrsL. santarosai100.0%100.0%9 × 10−103MH801931.1
L. interrogans *100.0%100.0%9 × 10−103MH686123.1
secYL. santarosai100.0%100.0%6 × 10−148MK315143.1
LipL32L. santarosai100.0%100.0%7 × 10−117AY461928.1
icdAL. santarosai100.0%100.0%0CP028377.1
COV023rrsL. santarosai100.0%100.0%1 × 10−96MH801931.1Positive IgM in convalescent sample
L. interrogans *100.0%100.0%1 × 10−96MH686123.1
secYL. santarosai100.0%100.0%0MK315138.1
LipL32L. santarosai100.0%100.0%7 × 10−153PP554251.1
COV024rrsL. kirschneri98.1%99.0%1 × 10−96CP125672.1
L. interrogans98.1%99.0%1 × 10−96KP211707.1
* MH686123.1 was the only L. interrogans sequence in the NCBI nucleotide database that matched through BLASTn analysis with the selected sequences listed in the present study. MH686123.1 is not linked to any published manuscript that allows for validation of the methodology used.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Silva-Ramos, C.R.; Matiz-González, J.M.; Gil-Mora, J.; Martínez Díaz, H.-C.; Faccini-Martínez, Á.A.; Cuervo, C.; Melby, P.C.; Aguilar, P.V.; Cabada, M.M.; Rodas, J.D.; et al. Molecular Characterization of Leptospira Species among Patients with Acute Undifferentiated Febrile Illness from the Municipality of Villeta, Colombia. Trop. Med. Infect. Dis. 2024, 9, 168. https://doi.org/10.3390/tropicalmed9080168

AMA Style

Silva-Ramos CR, Matiz-González JM, Gil-Mora J, Martínez Díaz H-C, Faccini-Martínez ÁA, Cuervo C, Melby PC, Aguilar PV, Cabada MM, Rodas JD, et al. Molecular Characterization of Leptospira Species among Patients with Acute Undifferentiated Febrile Illness from the Municipality of Villeta, Colombia. Tropical Medicine and Infectious Disease. 2024; 9(8):168. https://doi.org/10.3390/tropicalmed9080168

Chicago/Turabian Style

Silva-Ramos, Carlos Ramiro, J. Manuel Matiz-González, Juliana Gil-Mora, Heidy-C. Martínez Díaz, Álvaro A. Faccini-Martínez, Claudia Cuervo, Peter C. Melby, Patricia V. Aguilar, Miguel M. Cabada, Juan David Rodas, and et al. 2024. "Molecular Characterization of Leptospira Species among Patients with Acute Undifferentiated Febrile Illness from the Municipality of Villeta, Colombia" Tropical Medicine and Infectious Disease 9, no. 8: 168. https://doi.org/10.3390/tropicalmed9080168

APA Style

Silva-Ramos, C. R., Matiz-González, J. M., Gil-Mora, J., Martínez Díaz, H. -C., Faccini-Martínez, Á. A., Cuervo, C., Melby, P. C., Aguilar, P. V., Cabada, M. M., Rodas, J. D., & Hidalgo, M. (2024). Molecular Characterization of Leptospira Species among Patients with Acute Undifferentiated Febrile Illness from the Municipality of Villeta, Colombia. Tropical Medicine and Infectious Disease, 9(8), 168. https://doi.org/10.3390/tropicalmed9080168

Article Metrics

Back to TopTop