Identification of Dominant Microbes and Functional Analysis of Sourdough Starters Made of Dried Longan and Raisin †
Abstract
:1. Introduction
2. Materials and Methods
2.1. Preparing Sourdough Starters with Dried Fruit
2.2. Observation of Sourdough Starters
2.3. Organic Acid Analysis
2.4. Bacterial Identification
2.5. Identification of Bacteriocin Genes
2.6. Fermentation Efficacy Test
3. Results
3.1. Observation of Sourdough Starters Made of Dried Longan and Raisin
3.2. Change in pH of Sourdough Starters
3.3. Organic Acid
3.4. Bacterial Identification
3.5. Identification of Bacteriocin Genes
3.6. Fermentation Efficacy
4. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Ribet, L.; Dessalles, R.; Lesens, C.; Brusselaers, N.; Durand-Dubief, M. Nutritional benefits of sourdoughs: A systematic review. Adv. Nutr. 2023, 14, 22–29. [Google Scholar] [CrossRef] [PubMed]
- Faria-Oliveira, F.; Diniz, R.; Godoy Santos, F.; Mezadri, H.; Castro, I.; Brandão, R. The Role of Yeast and Lactic Acid Bacteria in the Production of Fermented Beverages in South America; IntechOpen: London, UK, 2015; pp. 107–135. [Google Scholar]
- Negash, A.W.; Tsehai, B.A. Current Applications of Bacteriocin. Int. J. Microbiol. 2020, 2020, 4374891. [Google Scholar] [CrossRef] [PubMed]
- Macwana, S.J.; Muriana, P.M. A ‘bacteriocin PCR array’ for identification of bacteriocin-related structural genes in lactic acid bacteria. J. Microbiol. Methods 2012, 88, 197–204. [Google Scholar] [CrossRef] [PubMed]
- CNS 12635; Method of Test for Fruit and Vegetable Juices and Drinks—Determination of Organic Acids. CNS: Taipei, Taiwan, 2004.
- Walsh, P.S.; Metzger, D.A.; Higushi, R. Chelex 100 as a medium for simple extraction of DNA for PCR-based typing from forensic material. Biotechniques 2013, 54, 134–139. [Google Scholar] [CrossRef] [PubMed]
- Hasannejad Bibalan, M.; Eshaghi, M.; Rohani, M.; Pourshafie, M.R.; Talebi, M. Determination of Bacteriocin Genes and Antibacterial Activity of Lactobacillus Strains Isolated from Fecal of Healthy Individuals. Int. J. Mol. Cell. Med. 2017, 6, 50–55. [Google Scholar] [PubMed]
- Zommiti, M.; Bouffartigues, E.; Maillot, O.; Barreau, M.; Szunerits, S.; Sebei, K.; Feuilloley, M.; Connil, N.; Ferchichi, M. In vitro Assessment of the Probiotic Properties and Bacteriocinogenic Potential of Pediococcus pentosaceus MZF16 Isolated From Artisanal Tunisian Meat “Dried Ossban”. Front. Microbiol. 2018, 9, 2607. [Google Scholar] [CrossRef] [PubMed]
Primer | Sequence | Amplicon |
---|---|---|
gaaA | GAACAGGTGCACTAATCGGT CAGCTAAGTTAGAAGGGGCT | 800 bp |
Laf A | AGTCGTTGTTGGTGGAAGAAAT TCTTATCTTGCCAAAACCACCT | 184 bp |
pls | GCCTTACCAGCGTAATGCCC CTGGTGATGCAATCGTTAGTTT | 320 bp |
ped | AAAATATCTAACTAATACTTG TAAAAAGATATTTGA CCAAAA | 711 bp |
Organic Acid | Longan (mg/100 mL) | Raisin (mg/100 mL) |
---|---|---|
Acetic acid | 192.14 | 167.42 |
Lactic acid | 260.42 | 89.55 |
Citric acid | 134.44 | 67.12 |
Malic acid | 93.35 | 66.07 |
Succinic acid | 14.50 | 41.25 |
Tartaric acid | 5.44 | 22.29 |
Oxalic acid | 25.19 | 15.59 |
Dried Longan | |
---|---|
Possible Species | Classification |
Torulaspora delbrueckii | Yeast |
Zygosaccharomyces or Lachancea | Yeast |
Saccharomyces cerevisiae | Yeast |
Weissella cibaria | LAB |
Leuconostoc citreum | LAB |
Weissella paramesenteroides | LAB |
Pediococcus pentosaceus | LAB |
Raisin | |
Torulaspora delbrueckii | Yeast |
Candida krusei | Yeast |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Liu, Y.-C.; Wu, P.-S.; Teng, S.-H.; Wu, M.-J. Identification of Dominant Microbes and Functional Analysis of Sourdough Starters Made of Dried Longan and Raisin. Eng. Proc. 2023, 55, 17. https://doi.org/10.3390/engproc2023055017
Liu Y-C, Wu P-S, Teng S-H, Wu M-J. Identification of Dominant Microbes and Functional Analysis of Sourdough Starters Made of Dried Longan and Raisin. Engineering Proceedings. 2023; 55(1):17. https://doi.org/10.3390/engproc2023055017
Chicago/Turabian StyleLiu, Yen-Chih, Pei-Shan Wu, Shih-Hua Teng, and Ming-Jiuan Wu. 2023. "Identification of Dominant Microbes and Functional Analysis of Sourdough Starters Made of Dried Longan and Raisin" Engineering Proceedings 55, no. 1: 17. https://doi.org/10.3390/engproc2023055017