Campylobacter Bacteriophage Infection at Refrigeration Temperatures
Abstract
1. Introduction
2. Materials and Methods
2.1. Bacterial Strains and Culture Conditions
2.2. Bacteriophages, Propagation and Titration
2.3. Bacteriophage Infection at 4 and 42 °C
2.4. Fluorescent Cell Staining (Syto9/Propidium Iodide)
2.5. Campylobacter Genomic DNA Extraction
2.6. Bacteriophage Genomic DNA Extraction
2.7. Polymerase Chain Reaction (PCR)
2.8. RNA Extraction
2.9. Quantitative PCR
2.10. Statistical Analysis
3. Results
3.1. Campylobacter Phage Infection at 4 °C
3.2. Microscopic Assessment of Host Cell Integrity and Permeability in the Presence of Bacteriophages at 4 °C
3.3. Bacteriophage Infection upon Transition from 4 °C to 42 °C
3.4. Bacteriophage Transcription at 4 °C
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Kaakoush, N.O.; Castaño-Rodríguez, N.; Mitchell, H.M.; Man, S.M. Global epidemiology of Campylobacter infection. Clin. Microbiol. Rev. 2015, 28, 687–720. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- EFSA and ECDC (European Food Safety Authority and European Centre for Disease Prevention and Control). The European Union One Health 2021 Zoonoses Report. EFSA J. 2022, 20, 7666. [Google Scholar] [CrossRef] [Scilit]
- Tack, D.M.; Marder, E.P.; Griffin, P.M.; Cieslak, P.R.; Dunn, J.; Hurd, S.; Scallan, E.; Lathrop, S.; Muse, A.; Ryan, P.; et al. Preliminary incidence and trends of infections with pathogens transmitted commonly through food—Foodborne Diseases Active Surveillance Network, 10 U.S. sites, 2015–2018. MMWR Morb. Mortal. Wkly. 2019, 68, 369–373. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sahin, O.; Kassem, I.I.; Shen, Z.; Lin, J.; Rajashekara, G.; Zhang, Q. Campylobacter in poultry: Ecology and potential interventions. Avian Dis. 2015, 59, 185–200. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- EFSA Panel on Biological Hazards (BIOHAZ). Scientific opinion on quantification of the risk posed by broiler meat to human campylobacteriosis in the EU. EFSA J. 2010, 8, 1437. [Google Scholar] [CrossRef] [Scilit]
- Ravel, A.; Hurst, M.; Petrica, N.; David, J.; Mutschall, S.K.; Pintar, K.; Taboada, E.N. Source attribution of human campylobacteriosis at the point of exposure by combining comparative exposure assessment and subtype comparison based on comparative genomic fingerprinting. PLoS ONE 2017, 12, e0183790. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Osimani, A.; Aquilanti, L.; Pasquini, M.; Clementi, F. Prevalence and risk factors for thermotolerant species of Campylobacter in poultry meat at retail in Europe. Poult. Sci. 2017, 96, 3382–3391. [Google Scholar] [CrossRef] [Scilit]
- EU Commission Regulation (EU). 2017/1495 of 23 August 2017 amending Regulation (EC) No 2073/2005 as regards Campylobacter in broiler carcases. Off. J. Eur. Union 2017, L218, 1–6. [Google Scholar]
- Newell, D.G.; Elvers, K.T.; Dopfer, D.; Hansson, I.; Jones, P.; James, S.; Gittins, J.; Stern, N.J.; Davies, R.; Connerton, I.; et al. Biosecurity-based interventions and strategies to reduce Campylobacter spp. on poultry farms. Appl. Environ. Microbiol. 2011, 77, 8605–8614. [Google Scholar] [CrossRef] [Scilit]
- Crotta, M.; Georgiev, M.; Guitian, J. Quantitative risk assessment of Campylobacter in broiler chickens—Assessing interventions to reduce the level of contamination at the end of the rearing period. Food Control 2017, 75, 29–39. [Google Scholar] [CrossRef] [Scilit]
- Nauta, M.; Johannessen, G.; Laureano Adame, L.; Williams, N.; Rosenquist, H. The effect of reducing numbers of Campylobacter in broiler intestines on human health risk. Microb. Risk Anal. 2016, 2–3, 68–77. [Google Scholar] [CrossRef] [Scilit]
- Loc Carrillo, C.; Atterbury, R.J.; El-Shibiny, A.; Connerton, P.L.; Dillon, E.; Scott, A.; Connerton, I.F. Bacteriophage therapy to reduce Campylobacter jejuni colonization of broiler chickens. Appl. Environ. Microbiol. 2005, 71, 6554–6563. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wagenaar, J.A.; Van Bergen, M.A.; Mueller, M.A.; Wassenaar, T.M.; Carlton, R.M. Phage therapy reduces Campylobacter jejuni colonization in broilers. Vet. Microbiol. 2005, 109, 275–283. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- El-Shibiny, A.; Scott, A.; Timms, A.; Metawea, Y.; Connerton, P.; Connerton, I. Application of a group II campylobacter bacteriophage to reduce strains of Campylobacter jejuni and Campylobacter coli colonizing broiler chickens. J. Food Protect. 2009, 72, 733–740. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kittler, S.; Fischer, S.; Abdulmawjood, A.; Glünder, G.; Klein, G. Effect of bacteriophage application on Campylobacter jejuni loads in commercial broiler flocks. Appl. Environ. Microbiol. 2013, 79, 7525–7533. [Google Scholar] [CrossRef] [Scilit]
- Chinivasagam, H.N.; Estella, W.; Maddock, L.; Mayer, D.G.; Weyand, C.; Connerton, P.L.; Connerton, I.F. Bacteriophages to Control Campylobacter in Commercially Farmed Broiler Chickens, in Australia. Front Microbiol. 2020, 11, 632. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Atterbury, R.J.; Connerton, P.L.; Dodd, C.E.; Rees, C.E.; Connerton, I.F. Application of host-specific bacteriophages to the surface of chicken skin leads to a reduction in recovery of Campylobacter jejuni. Appl. Environ. Microbiol. 2003, 69, 6302–6306. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Goode, D.; Allen, V.M.; Barrow, P.A. Reduction of experimental Salmonella and Campylobacter contamination of chicken skin by application of lytic bacteriophages. Appl. Environ. Microbiol. 2003, 69, 5032–5036. [Google Scholar] [CrossRef] [Scilit]
- Connerton, I.F.; Connerton, P.L. Campylobacter foodborne disease. In Foodborne Diseases, 3rd ed.; Dodd, C.E.R., Aldsworth, T., Stein, R.A., Cliver, D.O., Riemann, H.P., Eds.; Elsevier Inc.: Amsterdam, The Netherlands; Academic Press: Dordrecht, The Netherlands, 2017; pp. 209–221. [Google Scholar]
- Moye, Z.D.; Woolston, J.; Sulakvelidze, A. Bacteriophage applications for food production and processing. Viruses 2018, 10, 205. [Google Scholar] [CrossRef] [Scilit]
- Goodridge, L.D.; Bisha, B. Phage-based biocontrol strategies to reduce foodborne pathogens in foods. Bacteriophage 2011, 1, 130–137. [Google Scholar] [CrossRef] [Scilit]
- Hatfull, G.F. Dark matter of the biosphere: The amazing world of bacteriophage diversity. J. Virol. 2015, 89, 8107–8110. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Connerton, P.L.; Loc Carrillo, C.M.; Swift, C.; Dillon, E.; Scott, A.; Rees, C.E.; Dodd, C.E.R.; Frost, J.; Connerton, I.F. Longitudinal study of Campylobacter jejuni bacteriophages and their hosts from broiler chickens. Appl. Environ. Microbiol. 2004, 70, 3877–3883. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Loc Carrillo, C.M.; Connerton, P.L.; Pearson, T.; Connerton, I.F. Free-range layer chickens as a source of Campylobacter bacteriophage. Antonie Van Leeuwenhoek 2007, 92, 275. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Owens, J.; Barton, M.D.; Heuzenroeder, M.W. The isolation and characterization of Campylobacter jejuni bacteriophages from free range and indoor poultry. Vet. Microbiol. 2013, 162, 144–150. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Atterbury, R.J.; Connerton, P.L.; Dodd, C.E.; Rees, C.E.; Connerton, I.F. Isolation and characterization of Campylobacter bacteriophages from retail poultry. Appl. Environ. Microbiol. 2003, 69, 4511–4518. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- El-Shibiny, A.; Connerton, P.L.; Connerton, I.F. Enumeration and diversity of campylobacters and bacteriophages isolated during the rearing cycles of free-range and organic chickens. Appl. Environ. Microbiol. 2005, 71, 1259–1266. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Abd-El Wahab, A.; Basiouni, S.; El-Seedi, H.R.; Ahmed, M.F.E.; Bielke, L.R.; Hargis, B.; Tellez-Isaias, G.; Eisenreich, W.; Lehnherr, H.; Kittler, S.; et al. An overview of the use of bacteriophages in the poultry industry: Successes, challenges, and possibilities for overcoming breakdowns. Front. Microbiol. 2023, 14, 1136638. [Google Scholar] [CrossRef] [Scilit]
- Chan, B.K.; Abedon, S.T.; Loc-Carrillo, C. Phage cocktails and the future of phage therapy. Future Microbiol. 2013, 8, 769–783. [Google Scholar] [CrossRef] [Scilit]
- Sails, A.D.; Wareing, D.R.A.; Bolton, F.J.; Fox, A.J.; Curry, A. Characterisation of 16 Campylobacter jejuni and C. coli typing bacteriophages. J. Med. Microbiol. 1998, 47, 123–128. [Google Scholar] [CrossRef] [Scilit]
- Javed, M.A.; Ackermann, H.-W.; Azeredo, J.; Carvalho, C.M.; Connerton, I.; Evoy, S.; Hammerl, J.A.; Hertwig, S.; Lavigne, R.; Singh, A.; et al. A suggested classification for two groups of Campylobacter myoviruses. Arch. Virol. 2014, 159, 181–190. [Google Scholar] [CrossRef] [Scilit]
- Coward, C.; Grant, A.J.; Swift, C.; Philp, J.; Towler, R.; Heydarian, M.; Frost, J.A.; Maskell, D.J. Phase-variable surface structures are required for infection of Campylobacter jejuni by bacteriophages. Appl. Environ. Microbiol. 2006, 72, 4638–4647. [Google Scholar] [CrossRef] [Scilit]
- Scott, A.E.; Timms, A.R.; Connerton, P.L.; Loc Carrillo, C.; Radzum, K.A.; Connerton, I.F. Genome dynamics of Campylobacter jejuni in response to bacteriophage predation. PLoS Pathog. 2007, 3, 119. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Baldvinsson, S.B.; Sørensen, M.C.H.; Vegge, C.S.; Clokie, M.R.; Brøndsted, L. Campylobacter jejuni motility is required for infection of the flagellotropic bacteriophage F341. Appl. Environ. Microbiol. 2014, 80, 7096–7106. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lis, L.; Connerton, I.F. The minor flagellin of Campylobacter jejuni (FlaB) confers defensive properties against bacteriophage infection. Front. Microbiol. 2016, 7, 1908. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sørensen, M.C.H.; van Alphen, L.B.; Harboe, A.; Li, J.; Christensen, B.B.; Szymanski, C.M.; Brøndsted, L. The F336 bacteriophage recognizes the capsular phosphoramidate modification of Campylobacter jejuni NCTC11168. J. Bacteriol. 2011, 193, 6742–6749. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fischer, S.; Kittler, S.; Klein, G.; Glünder, G. Impact of a single phage and a phage cocktail application in broilers on reduction of Campylobacter jejuni and development of resistance. PLoS ONE 2013, 8, e78543. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hammerl, J.A.; Jäckel, C.; Alter, T.; Janzcyk, P.; Stingl, K.; Knüver, M.T.; Hertwig, S. Reduction of Campylobacter jejuni in broiler chicken by successive application of group II and group III phages. PLoS ONE 2014, 9, e114785. [Google Scholar] [CrossRef] [Scilit]
- Richards, P.J.; Connerton, P.L.; Connerton, I.F. Phage biocontrol of Campylobacter jejuni in chickens does not produce collateral effects on the gut microbiota. Front. Microbiol. 2019, 10, 476. [Google Scholar] [CrossRef] [Scilit]
- Birk, T.; Ingmer, H.; Andersen, M.T.; Jorgensen, K.; Brondsted, L. Chicken juice, a food-based model system suitable to study survival of Campylobacter jejuni. Lett. Appl. Microbiol. 2004, 38, 66–71. [Google Scholar] [CrossRef] [Scilit]
- Brown, H.L.; Reuter, M.; Salt, L.J.; Cross, K.L.; Betts, R.P.; van Vliet, A.H. Chicken juice enhances surface attachment and biofilm formation of Campylobacter jejuni. Appl. Environ. Microbiol. 2014, 80, 7053–7060. [Google Scholar] [CrossRef] [Scilit]
- Siringan, P.; Connerton, P.L.; Payne, R.J.; Connerton, I.F. Bacteriophage mediated dispersal of Campylobacter jejuni biofilms. Appl. Environ. Microbiol. 2011, 77, 3320–3326. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bigwood, T.; Hudson, J.A.; Billington, C.; Carey-Smith, G.V.; Heinemann, J.A. Phage inactivation of foodborne pathogens on cooked and raw meat. Food Microbiol. 2008, 25, 400–406. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zampara, A.; Sorensen, M.C.H.; Elsser-Gravesn, A.; Brondsted, L. Significance of phage-host interactions for biocontrol of Campylobacter jejuni in food. Food Control 2017, 73, 1169–1175. [Google Scholar] [CrossRef] [Scilit]
- Brathwaite, K.J.; Siringan, P.; Moreton, J.; Wilson, R.; Connerton, I.F. Complete genome sequence of universal bacteriophage host strain Campylobacter jejuni subsp. jejuni PT14. Genome Announc. 2013, 1, e00969-13. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gencay, Y.E.; Sørensen, M.C.H.; Brøndsted, L. Whole-genome sequence of the bacteriophage-sensitive strain Campylobacter jejuni NCTC12662. Genome Announc. 2017, 5, e00409-17. [Google Scholar] [CrossRef] [Scilit]
- Parkhill, J.; Wren, B.W.; Mungall, K.; Ketley, J.M.; Churcher, C.; Basham, D.; Chillingworth, T.; Davies, R.M.; Feltwell, T.; Holroyd, S.; et al. The genome sequence of the food-borne pathogen Campylobacter jejuni reveals hypervariable sequences. Nature 2000, 403, 665–668. [Google Scholar] [CrossRef] [Scilit]
- Miles, A.A.; Misra, S.S.; Irwin, J.O. The estimation of the bactericidal power of the blood. J. Hygiene 1938, 38, 732–749. [Google Scholar] [CrossRef] [Scilit]
- Bolton, F.J.; Coates, D. Development of a blood-free Campylobacter medium: Screening tests on basal media and supplements, and the ability of selected supplements to facilitate aerotolerance. J. Appl. Bacteriol. 1983, 54, 115–125. [Google Scholar] [CrossRef] [Scilit]
- Frost, J.A.; Kramer, J.M.; Gillanders, S.A. Phage typing of Campylobacter jejuni and Campylobacter coli and its use as an adjunct to serotyping. Epidemiol. Infect. 1999, 123, 47–55. [Google Scholar] [CrossRef] [Scilit]
- John, A.; Connerton, P.L.; Cummings, N.; Connerton, I.F. Profound differences in the transcriptome of Campylobacter jejuni grown in two different, widely used, microaerobic atmospheres. Res. Microbiol. 2011, 162, 410–418. [Google Scholar] [CrossRef] [Scilit]
- Ou, C.Y.; Moore, J.L.; Schochetman, G. Use of UV irradiation to reduce false positivity in polymerase chain reaction. Biotechniques 1991, 10, 442–446. [Google Scholar] [PubMed]
- Providenti, M.A.; O’Brien, J.M.; Ewing, R.J.; Paterson, E.S.; Smith, M.L. The copy-number of plasmids and other genetic elements can be determined by SYBR-Green-based quantitative real-time PCR. J Microbiol. Methods 2006, 65, 476–487. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ghaffar, N.M.; Connerton, P.L.; Connerton, I.F. Filamentation of Campylobacter in broth cultures. Front. Microbiol. 2015, 6, 657. [Google Scholar] [CrossRef] [Scilit]
- Connerton, P.L.; Timms, A.R.; Connerton, I.F. Campylobacter bacteriophages and bacteriophage therapy. J. Appl. Microbiol. 2011, 111, 255–265. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kaliniene, L.; Zajančkauskaite, A.; Šimoliūnas, E.; Truncaitė, L.; Meškys, R. Low-temperature bacterial viruses VR—A small but diverse group of E. coli phages. Arch. Virol. 2015, 160, 1367–1370. [Google Scholar] [CrossRef] [Scilit]
- Jurczak-Kurek, A.; Gąsior, T.; Nejman-Faleńczyk, B.; Bloch, S.; Dydecka, A.; Topka, G.; Necel, A.; Jakubowska-Deredas, M.; Narajczyk, M.; Richert, M.; et al. Biodiversity of bacteriophages: Morphological and biological properties of a large group of phages isolated from urban sewage. Sci. Rep. 2016, 6, 34338. [Google Scholar] [CrossRef] [Scilit]
- Zajančkauskaitė, A.; Noreika, A.; Rutkienė, R.; Meškys, R.; Kaliniene, L. Low-temperature virus vB_EcoM_VR26 shows potential in biocontrol of STEC O26:H11. Foods 2021, 10, 1500. [Google Scholar] [CrossRef] [Scilit]
- Orquera, S.; Gölz, G.; Hertwig, S.; Hammerl, J.; Sparborth, D.; Joldic, A.; Alter, T. Control of Campylobacter spp. and Yersinia enterocolitica by virulent bacteriophages. J. Mol. Genet. Med. 2012, 6, 273. [Google Scholar] [CrossRef]
- Wösten, M.M.; Van Dijk, L.; Veenendaal, A.K.; De Zoete, M.R.; Bleumink-Pluijm, N.M.; Van Putten, J.P. Temperature-dependent FlgM/FliA complex formation regulates Campylobacter jejuni flagella length. Mol. Microbiol. 2010, 75, 1577–1591. [Google Scholar] [CrossRef] [Scilit]
- Payne, R.J.H.; Jansen, V.A.A. Understanding bacteriophage therapy as a density-dependent kinetic process. J. Theor. Biol. 2001, 208, 37–48. [Google Scholar] [CrossRef] [Scilit]
- Cairns, B.J.; Timms, A.R.; Jansen, V.A.; Connerton, I.F.; Payne, R.J. Quantitative models of in vitro bacteriophage–host dynamics and their application to phage therapy. PLoS Pathog. 2009, 5, e1000253. [Google Scholar] [CrossRef] [Scilit] [PubMed]


| Oligo. Name | Sequence (5′-3′) | Tm (°C) | Product Size (bp) | Gene Product | Accession |
|---|---|---|---|---|---|
| PT14 RNApol F | AACATCTGCTTATACGCC (18) | 49.5 | 69 | DNA-directed RNA polymerase alpha | CP003871.4 |
| PT14 RNApol R | GCACTGATTTTAGCCACA (18) | 50.3 | |||
| HPC5 F | CGCTCTTGGTTGCCGATT (18) | 56.1 | 179 | RNA polymerase sigma-54 | CP032316.1 |
| HPC5 R | TTACTATCCACAAAAGCCGA (20) | 51.3 | |||
| 11168 F | ACCAGGAACGCAGCTAACTC (20) | 57.2 | 176 | RNA polymerase sigma-54 | AL111168.1 |
| 11168 R | AAAACCGCCGCATTTCTACG (20) | 56.5 | |||
| Phage 12 F | CTGGACGTGCAGGGAATAAA (20) | 55 | 159 | DNA-directed RNA polymerase beta | - |
| Phage 12 R | CCAAACCTAACCAAGCATCAT (21) | 53.2 | |||
| CP30A sigma F | GTTCCTGCTCAGCTTTTC (18) | 51.2 | 92 | Phage sigma factor | JX569801.1 |
| CP30A sigma R | CCAAAGAACCAGTTAAAGC (19) | 49 | |||
| CP8 sigma F | TTGGTGAAATGTGTTTGCTTC (21) | 52.1 | 245 | Phage sigma factor | KF148616.1 |
| CP8 sigma R | TCCTGCTCAGCTTTTCTTTC (20) | 52.9 | |||
| CP20 16sMe F | GTGGTGCTGGTGCGATAG (18) | 56.1 | 171 | 16s rRNA G1207 methylase | MK408758.1 |
| CP20 16sMe R | TTGCTAAACTAAATGGTGGATT (22) | 50.3 |
| Phage/Host | Phage Adsorption (% Free Phage Reduction) | Viable Count Reduction | |
|---|---|---|---|
| (log10 CFU/mL) | (%) | ||
| Class I (flagellar dependence) | |||
| Phage 12/NCTC 11168 | 80.1 ± 9.2 | 0.4 ± 0.1 | 60.2 ± 0.1 |
| Class II (flagellar dependence) | |||
| CP20/HPC5 | 76.4 ± 6.2 | 0.24 ± 0.4 | 43.2 ± 0.4 |
| Class III (capsular polysaccharide) | |||
| CP8/PT14 | 88.2 ± 4 | 0.28 ± 0.4 | 42.5 ± 0.4 |
| CP30A/NCTC 12662 | 94.7 ± 15 | 0.21 ± 0.2 | 39.8 ± 0.2 |
| Phage/Host | Differential PI Cell Permeability (PI Infected–PI Control) | |
|---|---|---|
| 2 h | 24 h | |
| Class I (flagellar dependence) | ||
| Phage 12/NCTC 11168 | 4.76 ± 0.25 | 5.36 ± 0.72 |
| Class II (flagellar dependence) | ||
| CP20/HPC5 | 3.63 ± 0.34 | 4.62 ± 0.59 |
| Class III (capsular polysaccharide) | ||
| CP8/PT14 | 3.16 ± 0.49 | 4.14± 0.44 |
| CP30A/NCTC 12662 | 3.05 ± 0.23 | 3.62 ± 0.41 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Hu, Y.; Al Shaaer, B.; Liang, L.; Connerton, I.F. Campylobacter Bacteriophage Infection at Refrigeration Temperatures. Appl. Microbiol. 2023, 3, 1392-1406. https://doi.org/10.3390/applmicrobiol3040094
Hu Y, Al Shaaer B, Liang L, Connerton IF. Campylobacter Bacteriophage Infection at Refrigeration Temperatures. Applied Microbiology. 2023; 3(4):1392-1406. https://doi.org/10.3390/applmicrobiol3040094
Chicago/Turabian StyleHu, Yang, Bader Al Shaaer, Lu Liang, and Ian F. Connerton. 2023. "Campylobacter Bacteriophage Infection at Refrigeration Temperatures" Applied Microbiology 3, no. 4: 1392-1406. https://doi.org/10.3390/applmicrobiol3040094
APA StyleHu, Y., Al Shaaer, B., Liang, L., & Connerton, I. F. (2023). Campylobacter Bacteriophage Infection at Refrigeration Temperatures. Applied Microbiology, 3(4), 1392-1406. https://doi.org/10.3390/applmicrobiol3040094

