Genetic Approach to Target Putative Pks Genes in Aspergillus Section Nigri Species Producing Ochratoxin A †
Abstract
:1. Introduction
2. Materiel and Methods
2.1. Fungal Strains and Culture Condition
2.2. Fungal DNA Extraction
2.3. Amplification of Fungal DNA
2.4. DNA Cloning and Sequencing
3. Results
3.1. Amplification and Identification of Pks Gene Sequence in A. carbonarius
3.2. Amplification and Identification of PKS Gene Sequences in A. niger and A. tubingensis
3.2.1. Cloning of AN Pks Gene in A. niger
3.2.2. Cloning of ATPks Gene in A. tubingensis
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Abbreviations
References
- Abarca, M.L.; Bragulat, M.R.; Castellá, G.; Cabañes, F.J. Ochratoxin A production by strains of Aspergillus niger var. niger. Appl. Environ. Microbiol. 1994, 60, 2650–2652. [Google Scholar] [CrossRef] [PubMed]
- Varga, J.; Rigó, K.; Kocsubé, S.; Farkas, B.; Pál, K. Diversity of polyketide synthase gene sequences in Aspergillus species. Res. Microbiol. 2003, 154, 593–600. [Google Scholar] [CrossRef] [PubMed]
- Abbas, D.A. Lactogenic and Cytogenetic Effects of Ochratoxin A in Adult Male Rats and Pups. Br. J. Pharmacol. Toxicol. 2013, 4, 101–105. [Google Scholar] [CrossRef]
- Petziner, E.; Ziegler, K. Ochratoxin A from a toxicological perspective. J. Veter- Pharmacol. Ther. 2000, 23, 91–98. [Google Scholar] [CrossRef] [PubMed]
- Harris, J.P.; Mantle, P.G. Biosynthesis of ochratoxins by Aspergillus ochraceus. Phytochemistry 2001, 58, 709–716. [Google Scholar] [CrossRef] [PubMed]
- Leong, S.-L.; Hocking, A.D.; Pitt, J. Occurrence of fruit rot fungi (Aspergillus section Nigri) on some drying varieties of irrigated grapes. Aust. J. Grape Wine Res. 2004, 10, 83–88. [Google Scholar] [CrossRef]
- Melki Ben Fredj, S.; Gautier, A.; Brygoo, Y.; Mliki, A. Molecular strategy to discrim inate between two ochratoxin A producing fungal species in Aspergillus niger ag gregate group isolated from fresh and dried grapes. Ann. Microbiol. 2009, 50, 1–7. [Google Scholar]
- Chang, P.K.; Ehrlich, K.C.; Linz, J.E.; Bhatnagar, D.; Cleveland, T.E.; Bennett, J.W. Characterization of the Aspergillus parasiticus niaD and niiA gene cluster. Curr. Genet. 1996, 30, 68–75. [Google Scholar] [CrossRef] [PubMed]
- Proctor, R.H.; Brown, D.W.; Plattner, R.D.; Desjardins, A.E. Co-expression of 15 contiguous genes delineates a fumonisin biosynthetic gene cluster in Gibberella moniliformis. Fungal Genet. Biol. 2003, 38, 237–249. [Google Scholar] [CrossRef] [PubMed]
- Abe, Y.; Suzuki, T.; Ono, C.; Iwamoto, K.; Hosobuchi, M.; Yoshikawa, H. Molecular cloning and characterization of an ML-236B (compactin) biosynthetic gene cluster in Penicillium citrinum. Mol. Genet. Genom. 2002, 267, 636–646. [Google Scholar] [CrossRef] [PubMed]
- Keller, N.P.; Hohn, T.M. Metabolic pathway gene clusters in filamentous fungi. Fungal Genet. Biol. 1997, 21, 17–29. [Google Scholar] [CrossRef] [PubMed]
- Huff, W.E.; Hamilton, P. Mycotoxins—Their Biosynthesis in Fungi: Ochratoxins—Metabolites of Combined Pathways. J. Food Prot. 1979, 42, 815–820. [Google Scholar] [CrossRef] [PubMed]
- Birch, A.; Donovan, F. Studies in relation to biosynthesis I. Some possible routes to derivatives of Orcinol and Phloroglucinol. Aust. J. Chem. 1953, 6, 360–368. [Google Scholar] [CrossRef]
- Kao, C.M.; Katz, L.; Khosla, C. Engineered biosynthesis of a complete macrolactone in a heterologous host. Science 1994, 265, 509–512. [Google Scholar] [CrossRef] [PubMed]
- Metz, J.G.; Roessler, P.; Facciotti, D.; Levering, C.; Dittrich, F.; Lassner, M.; Valentine, R.; Lardizabal, K.; Domergue, F.; Yamada, A.; et al. Production of polyunsaturated fatty acids by polyketide synthases in both prokaryotes and eukaryotes. Science 2001, 293, 290–293. [Google Scholar] [CrossRef] [PubMed]
- Graziani, S.; Vasnier, C.; Daboussi, M.J. Novel polyketide synthase from Nectria haematococca. Appl. Environ. Microbiol. 2004, 70, 2984–2988. [Google Scholar] [CrossRef] [PubMed]
- O’Callaghan, J.; Caddick, M.X.; Dobson, A.D.W. A polyketide synthase gene required for ochratoxin A biosynthesis in Aspergillus ochraceus. Microbiology 2003, 149, 3485–3491. [Google Scholar] [CrossRef] [PubMed]
- Sambrook, J.; Fritsch, E.F.; Maniatis, T. Molecular Cloning, 2nd ed.; Cold Spring Harbor Laboratory Press: New York, NY, USA, 1989. [Google Scholar]
- Atoui, A.; Dao, H.P.; Mathieu, F.; Lebrihi, A. Amplification and diversity analysis of ketosynthase domains of putative polyketide synthase genes in Aspergillus ochraceus and Aspergillus carbonarius producers of ochratoxin A. Mol. Nutr. Food Res. 2006, 50, 488–493. [Google Scholar] [CrossRef] [PubMed]
- Bingle, L.E.; Simpson, T.J.; Lazarus, C.M. Ketosynthase domain probes identify two subclasses of fungal polyketide synthase genes. Fungal Genet. Biol. 1999, 26, 209–223. [Google Scholar] [CrossRef] [PubMed]
- Nicholson, T.P.; Rudd, B.A.; Dawson, M.; Lazarus, C.M.; Simpson, T.J.; Cox, R.J. Design and utility of oligonucleotide gene probes for fungal polyketide synthases. Chem. Biol. 2001, 8, 157–178. [Google Scholar] [CrossRef] [PubMed]
- Téren, J.; Varga, J.; Hamari, Z.; Rinyu, E.; Kevei, F. Immunochemical detection of ochratoxin A in black Aspergillus strains. Mycopathologia 1996, 134, 171–176. [Google Scholar] [CrossRef]
- Duncombe, J.U. Infrared navigation—Part I: An assessment of feasibility. IEEE Trans. Electron Devices 1959, 11, 34–39. [Google Scholar]
- Cox, R.J.; Glod, F.; Hurley, D.; Lazarus, C.M.; Nicholson, T.P.; Rudd, B.A.M.; Simpson, T.J.; Wilkinson, B.; Zhang, Y. Rapid cloning and expression of a fungal polyketide synthase gene involved in squalestatin biosynthesis. Chem. Commun. 2004, 20, 2260–2261. [Google Scholar] [CrossRef] [PubMed]
- Dalcero, A.; Magnoli, C.; Hallak, C.; Chiacchiera, S.M.; Palacio, G.; Rosa, C.A. Detection of ochratoxin A in animal feeds and capacity to produce this mycotoxin by Aspergillus section Nigri in Argentina. Food Addit. Contam. 2002, 19, 1065–1072. [Google Scholar] [CrossRef] [PubMed]
- Hendrickson, L.; Davis, C.R.; Roach, C.; Nguyen, D.K.; Aldrich, T.; McAda, P.C.; Reeves, C.D. Lovastatin biosynthesis in Aspergillus terreus: Characterization of blocked mutants, enzyme activities and a multifunctional polyketide synthase gene. Chem. Biol. 1999, 6, 429–439. [Google Scholar] [CrossRef] [PubMed]
- Lee, T.; Yun, S.-H.; Hodge, K.T.; Humber, R.A.; Krasnoff, S.B.; Turgeon, G.B.; Yoder, O.C.; Gibson, D.M. Polyketide synthase genes in insect- and nematode associated fungi. Appl. Microbiol. Biotechnol. 2001, 56, 181–187. [Google Scholar] [CrossRef] [PubMed]
- Liou, G.F.; Khosla, C. Building-block selectivity of polyketide synthases. Curr. Opin. Chem. Biol. 2003, 7, 279–284. [Google Scholar] [CrossRef] [PubMed]
- Martínez-Culebras, P.V.; Crespo-Sempere, A.; Gil, J.V.; Ramón, D. Acyl Transferase Domains of Putative Polyketide Synthase (PKS) Genes in Aspergillus and Penicillium Producers of Ochratoxin A and the Evaluation of PCR Primers to Amplify PKS Sequences in Black Aspergillus Species. Food Sci. Technol. Int. 2009, 15, 97–105. [Google Scholar] [CrossRef]
- Mbah, M.C.; Akueshi, C.O. Aflatoxin in mould infested sesame seeds. Afr. J. Biotech. 2009, 8, 391–394. [Google Scholar]
- Fredj, S.M.B.; Chebil, S.; Lebrihi, A.; Lasram, S.; Ghorbel, A.; Mliki, A. Occurrence of pathogenic fungal species in Tunisian vineyards. Int. J. Food Microbiol. 2007, 113, 245–250. [Google Scholar] [CrossRef] [PubMed]
- Fredj, S.M.B.; Chebil, S.; Mliki, A. Isolation and characterization of ochratoxin A and aflatoxin B1 producing fungi infecting grapevines cultivated in Tunisia. Afr. J. Microbiol. Res. 2009, 3, 523–527. [Google Scholar]
- Lin, X.; Huang, Y.J.; Zheng, Z.H.; Su, W.J.; Qian, X.M.; Shen, Y.M. Endophytes from the pharmaceutical plant, Annona squamosa: Isolation, bioactivity, identification and diversity of its polyketide synthase gene. Fungal Div. 2010, 41, 41–51. [Google Scholar] [CrossRef]
- Schümann, J.; Hertweck, C. Advances in cloning, functional analysis and heterologous expression of fungal polyketide synthase genes. J. Biotechnol. 2006, 124, 690–703. [Google Scholar] [CrossRef] [PubMed]
- Recep, K.; Neslihan, D.; Hidayet, B. Biological control of post-harvest disease caused by Aspergillus flavus on stored lemon fruits. Afr. J. Biotech. 2009, 8, 209–214. [Google Scholar]
- Lin, C.Y.; Wu, M.; Bloom, J.A.; Cox, I.J.; Miller, M.; Lui, Y.M. Rotation, scale, and translation resilient watermarking for images. IEEE Trans. Image Process. 2001, 10, 767–782. [Google Scholar] [CrossRef] [PubMed]
Primer Code | Primer Sequence (5′-3′) | Annealing Temperature (°C) |
---|---|---|
LC1 LC2c | GAYCCNMGNTTYTTYAAYATG GTNCCNGTNCCRTGCATYTC | 55 |
KSLB LC6 | ATGACIATHGAYACIGCITG CCRTGIGCYTCRAARAAYTG | 55 |
Afl1F LC2R | GARGCICCICARATGGAYCC GTNCCNGTNCCRTGCATYTC | 55 |
PU PR | CGTTGTAAAACGACGGCCAGT GTACCAGTATCGACAAAGGAG | 52 |
Fungal PKSs | A. oryzae (AP007162) | A. ochraceus (AAS98198) | A. terreus (CAB44699) | A. flavus (AAS90022) |
---|---|---|---|---|
Similarity (%) | 81 | 76 | 76 | 66 |
Fungal PKSs | P. chrysogenum (CAP95405) | A. ochraceus (AAS98204) | A. carbonarius (CAB44699) | A. oryzae (BAE56814) |
---|---|---|---|---|
Similarity (%) | 71 | 71 | 68 | 68 |
Fungal PKSs | A. terreus (BAB88689) | A. flavus (AAS89999) | A. ochraceoroseus (ACH72912) |
---|---|---|---|
Similarities (%) | 87 | 82 | 81 |
Fungal PKSs | Ketosynthase of P. thomii (AAS60178) | A. niger (CAK38306) | A. ochraceus (AAS98198) |
---|---|---|---|
Similarity (%) | 97 | 94 | 88 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Melki, S.B.F.; Gautier, A.; Mliki, A. Genetic Approach to Target Putative Pks Genes in Aspergillus Section Nigri Species Producing Ochratoxin A. Biol. Life Sci. Forum 2023, 24, 15. https://doi.org/10.3390/IECT2023-16623
Melki SBF, Gautier A, Mliki A. Genetic Approach to Target Putative Pks Genes in Aspergillus Section Nigri Species Producing Ochratoxin A. Biology and Life Sciences Forum. 2023; 24(1):15. https://doi.org/10.3390/IECT2023-16623
Chicago/Turabian StyleMelki, Sabah Ben Fredj, Angelique Gautier, and Ahmed Mliki. 2023. "Genetic Approach to Target Putative Pks Genes in Aspergillus Section Nigri Species Producing Ochratoxin A" Biology and Life Sciences Forum 24, no. 1: 15. https://doi.org/10.3390/IECT2023-16623