Effects of Isorhamnetin on Adipocyte Mitochondrial Biogenesis and AMPK Activation
Abstract
:1. Introduction
2. Results
2.1. Effect of ISOR on 3T3-L1 Cell Viability
2.2. Effects of ISOR on Lipid and TG Accumulation in Adipocytes
2.3. Effect of ISOR on GPDH Activity in Adipocytes
2.4. Effects of ISOR on the Expression of Genes Involved in Adipogenesis and Mitochondrial Function in Adipocytes
2.5. Effect of ISOR on mtDNA Content in Adipocytes
2.6. Effect of ISOR on AMPK Activity in Adipocytes
3. Discussion
4. Materials and Methods
4.1. Materials
4.2. Cell Culture
4.3. Cell Viability Assay
4.4. Oil-Red O Staining
4.5. TG Assay
4.6. GPDH Activity
4.7. Quantitative Real-Time PCR
4.8. mtDNA Analysis
4.9. AMPK Activity Assay
4.10. Statistical Analysis
Author Contributions
Funding
Conflicts of Interest
References
- Vernochet, C.; Damilano, F.; Mourier, A.; Bezy, O.; Mori, M.A.; Smyth, G.; Rosenzweig, A.; Larsson, N.G.; Kahn, C.R. Adipose tissue mitochondrial dysfunction triggers a lipodystrophic syndrome with insulin resistance, hepatosteatosis, and cardiovascular complications. FASEB J. 2014, 28, 4408–4419. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bournat, J.C.; Brown, C.W. Mitochondrial Dysfunction in Obesity. Curr. Opin. Endocrinol. Diabetes Obes. 2010, 17, 446–452. [Google Scholar] [CrossRef] [PubMed]
- Patti, M.E.; Corvera, S. The role of mitochondria in the pathogenesis of type 2 diabetes. Endocr. Rev. 2010, 31, 364–395. [Google Scholar] [CrossRef] [PubMed]
- Wilson-Fritch, L.; Nicoloro, S.; Chouinard, M.; Lazar, M.A.; Chui, P.C.; Leszyk, J.; Straubhaar, J.; Czech, M.P.; Corvera, S. Mitochondrial remodeling in adipose tissue associated with obesity and treatment with rosiglitazone. J. Clin. Investig. 2004, 114, 1281–1289. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Puigserver, P.; Spiegelman, B.M. Peroxisome proliferator-activated receptor-γ coactivator 1α (PGC-1α): Transcriptional coactivator and metabolic regulator. Endocr. Rev. 2003, 24, 78–90. [Google Scholar] [CrossRef] [PubMed]
- Scarpulla, R.C. Nuclear activators and coactivators in mammalian mitochondrial biogenesis. Biochim. Biophys. Acta 2002, 6, 1–14. [Google Scholar] [CrossRef]
- Scarpulla, R.C. Metabolic control of mitochondrial biogenesis through the PGC-1 family regulatory network. Biochim. Biophys. Acta 2011, 1813, 1269–1278. [Google Scholar] [CrossRef] [PubMed]
- Kelly, D.P.; Scarpulla, R.C. Transcriptional regulatory circuits controlling mitochondrial biogenesis and function. Genes Dev. 2004, 6, 357–368. [Google Scholar] [CrossRef] [PubMed]
- Saleh, N.A.; Mansour, R.M.; Markham, K.R. An acylated isorhamnetin glycoside from Aerva javanica. Phytochemistry 1990, 29, 1344–1345. [Google Scholar] [CrossRef]
- Yang, J.Y.; Della-Fera, M.A.; Rayalam, S.; Ambati, S.; Hartzell, D.L.; Park, H.J.; Baile, C.A. Enhanced inhibition of adipogenesis and induction of apoptosis in 3T3-L1 adipocytes with combinations of resveratrol and quercetin. Life Sci. 2008, 82, 1032–1039. [Google Scholar] [CrossRef] [PubMed]
- Ahn, J.; Lee, H.; Kim, S.; Park, J.; Ha, T. The anti-obesity effect of quercetin is mediated by the AMPK and MAPK signaling pathways. Biochem. Biophys. Res. Commun. 2008, 373, 545–549. [Google Scholar] [CrossRef] [PubMed]
- Dong, J.; Zhang, X.; Zhang, L.; Bian, H.X.; Xu, N.; Bao, B.; Liu, J. Quercetin reduces obesity-associated ATM infiltration and inflammation in mice: A mechanism including AMPKα1/SIRT1. J. Lipid Res. 2014, 55, 363–374. [Google Scholar] [CrossRef] [PubMed]
- Nisha, V.M.; Anusree, S.S.; Priyanka, A.; Raghu, K.G. Apigenin and quercetin ameliorate mitochondrial alterations by tunicamycin-induced ER stress in 3T3-L1 adipocytes. Appl. Biochem. Biotechnol. 2014, 174, 1365–1375. [Google Scholar] [CrossRef] [PubMed]
- Kobori, M.; Takahashi, Y.; Sakurai, M.; Akimoto, Y.; Tsushida, T.; Oike, H.; Ippoushi, K. Quercetin suppresses immune cell accumulation and improves mitochondrial gene expression in adipose tissue of diet-induced obese mice. Mol. Nutr. Food Res. 2016, 60, 300–312. [Google Scholar] [CrossRef] [PubMed]
- Park, K.H; Choo, J.J.; Choe, S.N. Tissue concentrations of quercetin and its metabolite isorhamnetin following qral administration of quercetin in mice. Korean J. Food Sci. Technol. 2005, 37, 90–94. [Google Scholar]
- Seo, K.; Yang, J.H.; Kim, S.C.; Ku, S.K.; Ki, S.H.; Shin, S.M. The antioxidant effects of isorhamnetin contribute to inhibit COX-2 expression in response to inflammation: A potential role of HO-1. Inflammation 2014, 37, 712–722. [Google Scholar] [CrossRef] [PubMed]
- Boesch-Saadatmandi, C.; Loboda, A.; Wagner, A.E.; Stachurska, A.; Jozkowicz, A.; Dulak, J.; Döring, F.; Wolffram, S.; Rimbach, G. Effect of quercetin and its metabolites isorhamnetin and quercetin-3-glucuronide on inflammatory gene expression: Role of miR-155. J. Nutr. Biochem. 2011, 22, 293–299. [Google Scholar] [CrossRef] [PubMed]
- Manu, K.A.; Shanmugam, M.K.; Ramachandran, L.; Li, F.; Siveen, K.S.; Chinnathambi, A.; Zayed, M.E.; Alharbi, S.A.; Arfuso, F.; Kumar, A.P.; et al. Isorhamnetin augments the anti-tumor effect of capeciatbine through the negative regulation of NF-kB signaling cascade in gastric cancer. Cancer Lett. 2015, 363, 28–36. [Google Scholar] [CrossRef] [PubMed]
- Lee, J.; Jung, E.; Lee, J.; Kim, S.; Huh, S.; Kim, Y.; Kim, Y.; Byun, S.Y.; Kim, Y.S.; Park, D. Isorhamnetin represses adipogenesis in 3T3-L1 cells. Obesity 2008, 17, 226–232. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.; Gu, M.; Cai, W.; Yu, L.; Feng, L.; Zhang, L.; Zang, Q.; Wang, Y.; Wang, D.; Chen, H.; et al. Dietary component isorhamnetin is a PPARγ antagonist and ameliorates metabolic disorders induced by diet or leptin deficiency. Sci. Rep. 2016, 6, 19288. [Google Scholar] [CrossRef] [PubMed]
- Dong, G.Z.; Lee, J.H.; Ki, S.H.; Yang, J.H.; Cho, I.J.; Kang, S.H.; Zhao, R.J.; Kim, S.C.; Kim, Y.W. AMPK activation by isorhamnetin protects hepatocytes against oxidative stress and mitochondrial dysfunction. Eur. J. Pharmacol. 2014, 740, 634–640. [Google Scholar] [CrossRef] [PubMed]
- Boudina, S.; Graham, T.E. Mitochondrial function/dysfunction in white adipose tissue. Exp. Physiol. 2014, 99, 1168–1178. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Csiszar, A.; Labinskyy, N.; Pinto, J.T.; Ballabh, P.; Zhang, H.; Losonczy, G.; Pearson, K.; de Cabo, R.; Pacher, P.; Zhang, C.; et al. Resveratrol induces mitochondrial biogenesis in endothelial cells. Am. J. Physiol. Heart Circ. Physiol. 2009, 297, H13–H20. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ray Hamidie, R.D.; Yamada, T.; Ishizawa, R.; Saito, Y.; Masuda, K. Curcumin treatment enhances the effect of exercise on mitochondrial biogenesis in skeletal muscle by increasing cAMP levels. Metabolism 2015, 64, 1334–1347. [Google Scholar] [CrossRef] [PubMed]
- Lee, M.S.; Shin, Y.; Jung, S.; Kim, Y. Effects of epigallocatechin-3-gallate on thermogenesis and mitochondrial biogenesis in brown adipose tissues of diet-induced obese mice. Food Nutr. Res. 2017, 61, 1325307. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Schoonjans, K.; Peinado-Onsurbe, J.; Lefebvre, A.M.; Heyman, R.A.; Briggs, M.; Deeb, S.; Staels, B.; Auwerx, J. PPARR and PPARγ activators direct a distinct tissue-specific transcriptional response via a PPRE in the lipoprotein lipase gene. EMBO J. 1996, 15, 5336–5348. [Google Scholar] [PubMed]
- Ntambi, J.M.; Young-Cheul, K. Adipocyte differentiation and gene expression. J. Nutr. 2000, 130, 3122S–3126S. [Google Scholar] [CrossRef] [PubMed]
- Poulos, S.P.; Dodson, M.V.; Hausman, G.J. Cell line models for differentiation: Preadipocytes and adipocytes. Exp. Biol. Med. 2010, 35, 1185–1193. [Google Scholar] [CrossRef] [PubMed]
- Eseberri, I.; Miranda, J.; Lasa, A.; Churruca, I.; Portillo, M.P. Doses of quercetin in the range of serum concentrations exert delipidating effects in 3T3-L1 preadipocytes by acting on different stages of adipogenesis, but not in mature adipocytes. Oxid. Med. Cell Longev. 2015, 2015, 480943. [Google Scholar] [CrossRef] [PubMed]
- Chang, C.C.; Lin, K.Y.; Peng, K.Y.; Day, Y.J.; Hung, L.M. Resveratrol exerts anti-obesity effects in high-fat diet obese mice and displays differential dosage effects on cytotoxicity, differentiation, and lipolysis in 3T3-L1 cells. Endocr. J. 2015, 63, 169–178. [Google Scholar] [CrossRef] [PubMed]
- Boesch-Saadatmandi, C.; Egert, S.; Schrader, C.; Coumoul, X.; Barouki, R.; Muller, M.J.; Wolffram, S.; Rimbach, G. Effect of quercetin on paraoxonase 1 activity—Studies in cultured cells, mice and humans. J. Physiol. Pharmacol. 2010, 61, 99–105. [Google Scholar] [PubMed]
- Ekstrand, M.I.; Falkenberg, M.; Rantanen, A.; Park, C.B.; Gaspari, M.; Hultenby, K.; Rustin, P.; Gustafsson, C.M.; Larsson, N.G. Mitochondrial transcription factor A regulates mtDNA copy number in mammals. Hum. Mol. Genet. 2004, 13, 935–944. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Schreurs, M.; Kuipers, F.; van der Leij, F.R. Regulatory enzymes of mitochondrial beta-oxidation as targets for treatment of the metabolic syndrome. Obes. Rev. 2010, 11, 380–388. [Google Scholar] [CrossRef] [PubMed]
- Lentz, S.I.; Edwards, J.L.; Backus, C.; McLean, L.L.; Haines, K.M.; Feldman, E.L. Mitochondrial DNA (mtDNA) biogenesis: Visualization and duel incorporation of BrdU and EdU into newly synthesized mtDNA in vitro. J. Histochem. Cytochem. 2010, 58, 207–218. [Google Scholar] [CrossRef] [PubMed]
- Bergeron, R.; Ren, J.M.; Cadman, K.S.; Moore, I.K.; Perret, P.; Pypaert, M.; Young, L.H.; Semenkovich, C.F.; Shulman, G.I. Chronic activation of AMP kinase results in NRF-1 activation and mitochondrial biogenesis. Am. J. Physiol. Endocrinol. Metab. 2001, 281, E1340–E1346. [Google Scholar] [CrossRef] [PubMed]
- Cantó, C.; Auwerx, J. PGC-1α, SIRT1 and AMPK, an energy sensing network that controls energy expenditure. Curr. Opin. Lipidol. 2009, 20, 98–105. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lee, M.S.; Shin, Y.; Jung, S.; Kim, S.Y.; Jo, Y.H.; Kim, C.T.; Yun, M.K.; Lee, S.J.; Sohn, J.; Yu, H.J.; et al. The inhibitory effect of tartary buckwheat extracts on adipogenesis and inflammatory response. Molecules 2017, 22, 1160. [Google Scholar] [CrossRef] [PubMed]
- Rozen, S.; Skaletsky, H. Primer3 on the WWW for general users and for biologist programmers. Methods Mol. Biol. 1999, 132, 365–386. [Google Scholar]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCt method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
Sample Availability: Not available. |
Name | GeneBank No. | Primer Sequence (5′-3′) |
---|---|---|
aP2 | NM_024406 | F: CAAGTGCTCAAGTTTGGCGC |
R: CAAGAACCACCCCGAAGCTC | ||
β-actin | NM_007393 | F: GGACCTGACAGACTACCTCA |
R: GTTGCCAATAGTGATGACCT | ||
CPT-1α | NM_013495 | F: GTGTTGGAGGTGACAGACTT |
R: CACTTTCTCTTTCCACAAGG | ||
NRF1 | NM_010938 | F: AAGTATTCCACAGGTCGGGG |
R: TGGTGGCCTGAGTTTGTGTT | ||
PGC-1α | NM_008904 | F: GGGCCAAACAGAGAGAGAGG |
R: GTTTCGTTCGACCTGCGTAA | ||
PPAR-γ | NM_011146 | F: TTGATTTCTCCAGCATTTCT |
R: TGTTGTAGAGCTGGGTCTTT | ||
Tfam | NM_009360 | F: GAGGCCAGTGTGAACCAGTG |
R: GTAGTGCCTGCTGCTCCTGA |
© 2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lee, M.-S.; Kim, Y. Effects of Isorhamnetin on Adipocyte Mitochondrial Biogenesis and AMPK Activation. Molecules 2018, 23, 1853. https://doi.org/10.3390/molecules23081853
Lee M-S, Kim Y. Effects of Isorhamnetin on Adipocyte Mitochondrial Biogenesis and AMPK Activation. Molecules. 2018; 23(8):1853. https://doi.org/10.3390/molecules23081853
Chicago/Turabian StyleLee, Mak-Soon, and Yangha Kim. 2018. "Effects of Isorhamnetin on Adipocyte Mitochondrial Biogenesis and AMPK Activation" Molecules 23, no. 8: 1853. https://doi.org/10.3390/molecules23081853
APA StyleLee, M.-S., & Kim, Y. (2018). Effects of Isorhamnetin on Adipocyte Mitochondrial Biogenesis and AMPK Activation. Molecules, 23(8), 1853. https://doi.org/10.3390/molecules23081853