microRNA Regulation in Health and Disease

A special issue of Genes (ISSN 2073-4425). This special issue belongs to the section "Molecular Genetics and Genomics".

Deadline for manuscript submissions: closed (31 January 2019) | Viewed by 51938

Printed Edition Available!
A printed edition of this Special Issue is available here.

Special Issue Editors


E-Mail Website
Guest Editor
Department of Medicine and Genetics, Cell Biology and Development, University of Minnesota Medical School, Minneapolis, MN 55455, USA
Interests: receptor-mediated delivery; liver regeneration; microRNA biogenesis; genome editing
Special Issues, Collections and Topics in MDPI journals

E-Mail Website
Guest Editor
Department of Surgery, University of Minnesota, Minneapolis, MN 55455, USA
Interests: colorectal cancer; sarcoma; osteosarcoma; immune response; exosomes; extra cellular vesicles; tumor immunology; microRNAs; gene regulation
Special Issues, Collections and Topics in MDPI journals

Special Issue Information

Dear Colleagues,

microRNAs (miRNAs) are small regulatory RNAs that play a crucial role in posttranscriptional gene regulation. Over two thousand miRNAs have been identified in humans, and many of them are conserved in other species. miRNAs are implicated in fundamental cellular functions including development and disease. In the last decade, there has been an overwhelming understanding of miRNA biogenesis and their target genes. Further, there is a significant amount of work carried out in developing miRNA biomarkers and therapeutics for various disease conditions. RNA based markers and therapeutics have proved to have a clinical impact, and many of these miRNA-based therapies are at various stages of human clinical trial and clinical applications. Notably, miRNAs are also found in exosomes and are considered to impart intercellular communication and function via several different modalities including tunneling nanotubes. In spite of our understanding of miRNA biology and function, there are many challenges in effectively using miRNAs as biomarkers and therapeutic agents in clinical applications.

In this Special Issue, we are inviting reviews, perspectives, and original research articles to address some of these challenges. Topics will include, but not limited to, miRNA biogenesis, clinical applications, extracellular function, biomarkers, miRNA immune regulation, signaling pathways, and preclinical models.

Prof. Dr. Clifford Steer
Dr. Subree Subramanian
Guest Editors

Manuscript Submission Information

Manuscripts should be submitted online at www.mdpi.com by registering and logging in to this website. Once you are registered, click here to go to the submission form. Manuscripts can be submitted until the deadline. All submissions that pass pre-check are peer-reviewed. Accepted papers will be published continuously in the journal (as soon as accepted) and will be listed together on the special issue website. Research articles, review articles as well as short communications are invited. For planned papers, a title and short abstract (about 100 words) can be sent to the Editorial Office for announcement on this website.

Submitted manuscripts should not have been published previously, nor be under consideration for publication elsewhere (except conference proceedings papers). All manuscripts are thoroughly refereed through a single-blind peer-review process. A guide for authors and other relevant information for submission of manuscripts is available on the Instructions for Authors page. Genes is an international peer-reviewed open access monthly journal published by MDPI.

Please visit the Instructions for Authors page before submitting a manuscript. The Article Processing Charge (APC) for publication in this open access journal is 2600 CHF (Swiss Francs). Submitted papers should be well formatted and use good English. Authors may use MDPI's English editing service prior to publication or during author revisions.

Keywords

  • miRNA
  • cancer
  • development
  • immune response
  • intercellular communication biomarkers
  • therapeutics

Benefits of Publishing in a Special Issue

  • Ease of navigation: Grouping papers by topic helps scholars navigate broad scope journals more efficiently.
  • Greater discoverability: Special Issues support the reach and impact of scientific research. Articles in Special Issues are more discoverable and cited more frequently.
  • Expansion of research network: Special Issues facilitate connections among authors, fostering scientific collaborations.
  • External promotion: Articles in Special Issues are often promoted through the journal's social media, increasing their visibility.
  • Reprint: MDPI Books provides the opportunity to republish successful Special Issues in book format, both online and in print.

Further information on MDPI's Special Issue policies can be found here.

Published Papers (10 papers)

Order results
Result details
Select all
Export citation of selected articles as:

Editorial

Jump to: Research, Review

4 pages, 160 KB  
Editorial
Special Issue: MicroRNA Regulation in Health and Disease
by Subbaya Subramanian and Clifford J. Steer
Genes 2019, 10(6), 457; https://doi.org/10.3390/genes10060457 - 15 Jun 2019
Cited by 33 | Viewed by 3512
Abstract
Our understanding of non-coding RNA has significantly changed based on recent advances in genomics and molecular biology, and their role is recognized to include far more than a link between the sequence of DNA and synthesized proteins [...] Full article
(This article belongs to the Special Issue microRNA Regulation in Health and Disease)

Research

Jump to: Editorial, Review

20 pages, 1723 KB  
Article
Single Nucleotide Polymorphisms in MIR143 Contribute to Protection against Non-Hodgkin Lymphoma (NHL) in Caucasian Populations
by Gabrielle Bradshaw, Larisa M. Haupt, Eunise M. Aquino, Rodney A. Lea, Heidi G. Sutherland and Lyn R. Griffiths
Genes 2019, 10(3), 185; https://doi.org/10.3390/genes10030185 - 27 Feb 2019
Cited by 11 | Viewed by 3995
Abstract
Recent studies show an association of microRNA (miRNA) polymorphisms (miRSNPs) in different cancer types, including non-Hodgkin lymphoma (NHL). The identification of miRSNPs that are associated with NHL susceptibility may provide biomarkers for early diagnosis and prognosis for patients who may not respond well [...] Read more.
Recent studies show an association of microRNA (miRNA) polymorphisms (miRSNPs) in different cancer types, including non-Hodgkin lymphoma (NHL). The identification of miRSNPs that are associated with NHL susceptibility may provide biomarkers for early diagnosis and prognosis for patients who may not respond well to current treatment options, including the immunochemotherapy drug combination that includes rituximab, cyclophosphamide, doxorubicin, vincristine and prednisome (R-CHOP). We developed a panel of miRSNPs for genotyping while using multiplex PCR and chip-based mass spectrometry analysis in an Australian NHL case-control population (300 cases, 140 controls). Statistical association with NHL susceptibility was performed while using Chi-square (χ2) and logistic regression analysis. We identified three SNPs in MIR143 that are to be significantly associated with reduced risk of NHL: rs3733846 (odds ratio (OR) [95% confidence interval (CI)] = 0.54 [0.33–0.86], p = 0.010), rs41291957 (OR [95% CI] = 0.61 [0.39–0.94], p = 0.024), and rs17723799 (OR [95% CI] = 0.43 [0.26–0.71], p = 0.0009). One SNP, rs17723799, remained significant after correction for multiple testing (p = 0.015). Subsequently, we investigated an association between the rs17723799 genotype and phenotype by measuring target gene Hexokinase 2 (HKII) expression in cancer cell lines and controls. Our study is the first to report a correlation between miRSNPs in MIR143 and a reduced risk of NHL in Caucasians, and it is supported by significant SNPs in high linkage disequilibrium (LD) in a large European NHL genome wide association study (GWAS) meta-analysis. Full article
(This article belongs to the Special Issue microRNA Regulation in Health and Disease)
Show Figures

Figure 1

16 pages, 2787 KB  
Article
An Exonic Switch Regulates Differential Accession of microRNAs to the Cd34 Transcript in Atherosclerosis Progression
by Miguel Hueso, Josep M. Cruzado, Joan Torras and Estanis Navarro
Genes 2019, 10(1), 70; https://doi.org/10.3390/genes10010070 - 21 Jan 2019
Cited by 7 | Viewed by 4136
Abstract
Background: CD34+ Endothelial Progenitor Cells (EPCs) play an important role in the recovery of injured endothelium and contribute to atherosclerosis (ATH) pathogenesis. Previously we described a potential atherogenic role for miR-125 that we aimed to confirm in this work. Methods: Microarray hybridization, [...] Read more.
Background: CD34+ Endothelial Progenitor Cells (EPCs) play an important role in the recovery of injured endothelium and contribute to atherosclerosis (ATH) pathogenesis. Previously we described a potential atherogenic role for miR-125 that we aimed to confirm in this work. Methods: Microarray hybridization, TaqMan Low Density Array (TLDA) cards, qPCR, and immunohistochemistry (IHC) were used to analyze expression of the miRNAs, proteins and transcripts here studied. Results: Here we have demonstrated an increase of resident CD34-positive cells in the aortic tissue of human and mice during ATH progression, as well as the presence of clusters of CD34-positive cells in the intima and adventitia of human ATH aortas. We introduce miR-351, which share the seed sequence with miR-125, as a potential effector of CD34. We show a splicing event at an internal/cryptic splice site at exon 8 of the murine Cd34 gene (exonic-switch) that would regulate the differential accession of miRNAs (including miR-125) to the coding region or to the 3’UTR of Cd34. Conclusions: We introduce new potential mediators of ATH progression (CD34 cell-clusters, miR-351), and propose a new mechanism of miRNA action, linked to a cryptic splicing site in the target-host gene, that would regulate the differential accession of miRNAs to their cognate binding sites. Full article
(This article belongs to the Special Issue microRNA Regulation in Health and Disease)
Show Figures

Figure 1

15 pages, 4870 KB  
Article
Systems Analysis of Transcriptomic and Proteomic Profiles Identifies Novel Regulation of Fibrotic Programs by miRNAs in Pulmonary Fibrosis Fibroblasts
by Steven Mullenbrock, Fei Liu, Suzanne Szak, Xiaoping Hronowski, Benbo Gao, Peter Juhasz, Chao Sun, Mei Liu, Helen McLaughlin, Qiurong Xiao, Carol Feghali-Bostwick and Timothy S. Zheng
Genes 2018, 9(12), 588; https://doi.org/10.3390/genes9120588 - 29 Nov 2018
Cited by 27 | Viewed by 6036
Abstract
Fibroblasts/myofibroblasts are the key effector cells responsible for excessive extracellular matrix (ECM) deposition and fibrosis progression in both idiopathic pulmonary fibrosis (IPF) and systemic sclerosis (SSc) patient lungs, thus it is critical to understand the transcriptomic and proteomic programs underlying their fibrogenic activity. [...] Read more.
Fibroblasts/myofibroblasts are the key effector cells responsible for excessive extracellular matrix (ECM) deposition and fibrosis progression in both idiopathic pulmonary fibrosis (IPF) and systemic sclerosis (SSc) patient lungs, thus it is critical to understand the transcriptomic and proteomic programs underlying their fibrogenic activity. We conducted the first integrative analysis of the fibrotic programming in these cells at the levels of gene and microRNA (miRNA) expression, as well as deposited ECM protein to gain insights into how fibrotic transcriptional programs culminate in aberrant ECM protein production/deposition. We identified messenger RNA (mRNA), miRNA, and deposited matrisome protein signatures for IPF and SSc fibroblasts obtained from lung transplants using next-generation sequencing and mass spectrometry. SSc and IPF fibroblast transcriptional signatures were remarkably similar, with enrichment of WNT, TGF-β, and ECM genes. miRNA-seq identified differentially regulated miRNAs, including downregulation of miR-29b-3p, miR-138-5p and miR-146b-5p in disease fibroblasts and transfection of their mimics decreased expression of distinct sets of fibrotic signature genes as assessed using a Nanostring fibrosis panel. Finally, proteomic analyses uncovered a distinct “fibrotic” matrisome profile deposited by IPF and SSc fibroblasts compared to controls that highlights the dysregulated ECM production underlying their fibrogenic activities. Our comprehensive analyses of mRNA, miRNA, and matrisome proteomic profiles in IPF and SSc lung fibroblasts revealed robust fibrotic signatures at both the gene and protein expression levels and identified novel fibrogenesis-associated miRNAs whose aberrant downregulation in disease fibroblasts likely contributes to their fibrotic and ECM gene expression. Full article
(This article belongs to the Special Issue microRNA Regulation in Health and Disease)
Show Figures

Figure 1

17 pages, 2027 KB  
Article
A Two-Cohort RNA-seq Study Reveals Changes in Endometrial and Blood miRNome in Fertile and Infertile Women
by Kadri Rekker, Signe Altmäe, Marina Suhorutshenko, Maire Peters, Juan F. Martinez-Blanch, Francisco M. Codoñer, Felipe Vilella, Carlos Simón, Andres Salumets and Agne Velthut-Meikas
Genes 2018, 9(12), 574; https://doi.org/10.3390/genes9120574 - 23 Nov 2018
Cited by 36 | Viewed by 6227
Abstract
The endometrium undergoes extensive changes to prepare for embryo implantation and microRNAs (miRNAs) have been described as playing a significant role in the regulation of endometrial receptivity. However, there is no consensus about the miRNAs involved in mid-secretory endometrial functions. We analysed the [...] Read more.
The endometrium undergoes extensive changes to prepare for embryo implantation and microRNAs (miRNAs) have been described as playing a significant role in the regulation of endometrial receptivity. However, there is no consensus about the miRNAs involved in mid-secretory endometrial functions. We analysed the complete endometrial miRNome from early secretory (pre-receptive) and mid-secretory (receptive) phases from fertile women and from patients with recurrent implantation failure (RIF) to reveal differentially expressed (DE) miRNAs in the mid-secretory endometrium. Furthermore, we investigated whether the overall changes during early to mid-secretory phase transition and with RIF condition could be reflected in blood miRNA profiles. In total, 116 endometrial and 114 matched blood samples collected from two different population cohorts were subjected to small RNA sequencing. Among fertile women, 91 DE miRNAs were identified in the mid-secretory vs. early secretory endometrium, while no differences were found in the corresponding blood samples. The comparison of mid-secretory phase samples between fertile and infertile women revealed 21 DE miRNAs from the endometrium and one from blood samples. Among discovered novel miRNAs, chr2_4401 was validated and showed up-regulation in the mid-secretory endometrium. Besides novel findings, we confirmed the involvement of miR-30 and miR-200 family members in mid-secretory endometrial functions. Full article
(This article belongs to the Special Issue microRNA Regulation in Health and Disease)
Show Figures

Figure 1

17 pages, 2296 KB  
Article
Serum and Lipoprotein Particle miRNA Profile in Uremia Patients
by Markus Axmann, Sabine M. Meier, Andreas Karner, Witta Strobl, Herbert Stangl and Birgit Plochberger
Genes 2018, 9(11), 533; https://doi.org/10.3390/genes9110533 - 5 Nov 2018
Cited by 15 | Viewed by 3557
Abstract
microRNAs (miRNAs) are post-transcriptional regulators of messenger RNA (mRNA), and transported through the whole organism by—but not limited to—lipoprotein particles. Here, we address the miRNA profile in serum and lipoprotein particles of healthy individuals in comparison with patients with uremia. Moreover, we quantitatively [...] Read more.
microRNAs (miRNAs) are post-transcriptional regulators of messenger RNA (mRNA), and transported through the whole organism by—but not limited to—lipoprotein particles. Here, we address the miRNA profile in serum and lipoprotein particles of healthy individuals in comparison with patients with uremia. Moreover, we quantitatively determined the cellular lipoprotein-particle-uptake dependence on the density of lipoprotein particle receptors and present a method for enhancement of the transfer efficiency. We observed a significant increase of the cellular miRNA level using reconstituted high-density lipoprotein (HDL) particles artificially loaded with miRNA, whereas incubation with native HDL particles yielded no measurable effect. Thus, we conclude that no relevant effect of lipoprotein-particle-mediated miRNA-transfer exists under in vivo conditions though the miRNA profile of lipoprotein particles can be used as a diagnostic marker. Full article
(This article belongs to the Special Issue microRNA Regulation in Health and Disease)
Show Figures

Graphical abstract

11 pages, 1571 KB  
Article
Complemented Palindromic Small RNAs First Discovered from SARS Coronavirus
by Chang Liu, Ze Chen, Yue Hu, Haishuo Ji, Deshui Yu, Wenyuan Shen, Siyu Li, Jishou Ruan, Wenjun Bu and Shan Gao
Genes 2018, 9(9), 442; https://doi.org/10.3390/genes9090442 - 5 Sep 2018
Cited by 18 | Viewed by 6448
Abstract
In this study, we report for the first time the existence of complemented palindromic small RNAs (cpsRNAs) and propose that cpsRNAs and palindromic small RNAs (psRNAs) constitute a novel class of small RNAs. The first discovered 19-nt cpsRNA UUAACAAGCUUGUUAAAGA, named SARS-CoV-cpsR-19, was detected [...] Read more.
In this study, we report for the first time the existence of complemented palindromic small RNAs (cpsRNAs) and propose that cpsRNAs and palindromic small RNAs (psRNAs) constitute a novel class of small RNAs. The first discovered 19-nt cpsRNA UUAACAAGCUUGUUAAAGA, named SARS-CoV-cpsR-19, was detected from a 22-bp DNA complemented palindrome TCTTTAACAAGCTTGTTAAAGA in the severe acute respiratory syndrome coronavirus (SARS-CoV) genome. The phylogenetic analysis supported that this DNA complemented palindrome originated from bat betacoronavirus. The results of RNA interference (RNAi) experiments showed that one 19-nt segment corresponding to SARS-CoV-cpsR-19 significantly induced cell apoptosis. Using this joint analysis of the molecular function and phylogeny, our results suggested that SARS-CoV-cpsR-19 could play a role in SARS-CoV infection or pathogenesis. The discovery of cpsRNAs has paved a way to find novel markers for pathogen detection and to reveal the mechanisms underlying infection or pathogenesis from a different point of view. Researchers can use cpsRNAs to study the infection or pathogenesis of pathogenic viruses when these viruses are not available. The discovery of psRNAs and cpsRNAs, as a novel class of small RNAs, also inspire researchers to investigate DNA palindromes and DNA complemented palindromes with lengths of psRNAs and cpsRNAs in viral genomes. Full article
(This article belongs to the Special Issue microRNA Regulation in Health and Disease)
Show Figures

Figure 1

17 pages, 27814 KB  
Article
Somatostatin Analogue Treatment Primarily Induce miRNA Expression Changes and Up-Regulates Growth Inhibitory miR-7 and miR-148a in Neuroendocrine Cells
by Kristina B. V. Døssing, Christina Kjær, Jonas Vikeså, Tina Binderup, Ulrich Knigge, Michael D. Culler, Andreas Kjær, Birgitte Federspiel and Lennart Friis-Hansen
Genes 2018, 9(7), 337; https://doi.org/10.3390/genes9070337 - 4 Jul 2018
Cited by 14 | Viewed by 5265
Abstract
Somatostatin (SST) analogues are used to control the proliferation and symptoms of neuroendocrine tumors (NETs). MicroRNAs (miRNA) are small non-coding RNAs that modulate posttranscriptional gene expression. We wanted to characterize the miRNAs operating under the control of SST to elucidate to what extent [...] Read more.
Somatostatin (SST) analogues are used to control the proliferation and symptoms of neuroendocrine tumors (NETs). MicroRNAs (miRNA) are small non-coding RNAs that modulate posttranscriptional gene expression. We wanted to characterize the miRNAs operating under the control of SST to elucidate to what extent they mediate STT actions. NCI-H727 carcinoid cell line was treated with either a chimeric SST/dopamine analogue; a SST or dopamine analogue for proliferation assays and for identifying differentially expressed miRNAs using miRNA microarray. The miRNAs induced by SST analogue treatment are investigated in carcinoid cell lines NCI-H727 and CNDT2 using in situ hybridization, qPCR and proliferation assays. SST analogues inhibited the growth of carcinoid cells more potently compared to the dopamine analogue. Principal Component Analysis (PCA) of the samples based on miRNA expression clearly separated the samples based on treatment. Two miRNAs which were highly induced by SST analogues, miR-7 and miR-148a, were shown to inhibit the proliferation of NCI-H727 and CNDT2 cells. SST analogues also produced a general up-regulation of the let-7 family members. SST analogues control and induce distinct miRNA expression patterns among which miR-7 and miR-148a both have growth inhibitory properties. Full article
(This article belongs to the Special Issue microRNA Regulation in Health and Disease)
Show Figures

Figure 1

13 pages, 6121 KB  
Article
MicroRNA-106a-5p Inhibited C2C12 Myogenesis via Targeting PIK3R1 and Modulating the PI3K/AKT Signaling
by Xiao Li, Youbo Zhu, Huifang Zhang, Guangjun Ma, Guofang Wu, Aoqi Xiang, Xin’E. Shi, Gong She Yang and Shiduo Sun
Genes 2018, 9(7), 333; https://doi.org/10.3390/genes9070333 - 2 Jul 2018
Cited by 29 | Viewed by 5692
Abstract
The microRNA (miR)-17 family is widely expressed in mammalian tissues and play important roles in various physiological and pathological processes. Here, the functions of miR-106a-5p, a member of miR-17 family, were explored during myogenic differentiation in C2C12 cell line. First, miR-106a-5p was found [...] Read more.
The microRNA (miR)-17 family is widely expressed in mammalian tissues and play important roles in various physiological and pathological processes. Here, the functions of miR-106a-5p, a member of miR-17 family, were explored during myogenic differentiation in C2C12 cell line. First, miR-106a-5p was found to be relatively lower expressed in two-month skeletal muscle tissues and gradually decreased upon myogenic stimuli. Forced expression of miR-106a-5p significantly reduced the differentiation index, fusion index as well as the expression of myogenic markers (MyoD, MyoG, MyHC, Myomixer, Myomarker). Meanwhile, the levels of phosphorylated AKT were reduced by overexpression of miR-106a-5p, and administration of insulin-like growth factor 1 (IGF1), a booster of myogenic differentiation, could recover all the inhibitory effects above of miR-106a-5p. Furthermore, miR-106a-5p was elevated in aged muscles and dexamethasone (DEX)-treated myotubes, and up-regulation of miR-106a-5p significantly reduced the diameters of myotubes accompanied with increased levels of muscular atrophy genes and decreased PI3K/AKT activities. Finally, miR-106a-5p was demonstrated to directly bind to the 3’-UTR of PIK3R1, thus, repress the PI3K/AKT signaling. Full article
(This article belongs to the Special Issue microRNA Regulation in Health and Disease)
Show Figures

Figure 1

Review

Jump to: Editorial, Research

13 pages, 715 KB  
Review
Host–MicroRNA–Microbiota Interactions in Colorectal Cancer
by Ce Yuan, Clifford J. Steer and Subbaya Subramanian
Genes 2019, 10(4), 270; https://doi.org/10.3390/genes10040270 - 2 Apr 2019
Cited by 33 | Viewed by 5614
Abstract
Changes in gut microbiota composition have consistently been observed in patients with colorectal cancer (CRC). Yet, it is not entirely clear how the gut microbiota interacts with tumor cells. We know that tumor cells undergo a drastic change in energy metabolism, mediated by [...] Read more.
Changes in gut microbiota composition have consistently been observed in patients with colorectal cancer (CRC). Yet, it is not entirely clear how the gut microbiota interacts with tumor cells. We know that tumor cells undergo a drastic change in energy metabolism, mediated by microRNAs (miRNAs), and that tumor-derived miRNAs affect the stromal and immune cell fractions of the tumor microenvironment. Recent studies suggest that host intestinal miRNAs can also affect the growth and composition of the gut microbiota. Our previous CRC studies showed a high-level of interconnectedness between host miRNAs and their microbiota. Considering all the evidence to date, we postulate that the altered nutrient composition and miRNA expression in the CRC microenvironment selectively exerts pressure on the surrounding microbiota, leading to alterations in its composition. In this review article, we present our current understanding of the role of miRNAs in mediating host–microbiota interactions in CRC. Full article
(This article belongs to the Special Issue microRNA Regulation in Health and Disease)
Show Figures

Figure 1

Back to TopTop