Effects of Heat Stress on Breast Muscle Metabolomics and Lipid Metabolism Related Genes in Growing Broilers
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Birds and Treatments
2.2. Sample Collection and Chemical Analysis
2.2.1. Growth Performance Measurement
2.2.2. Lipid Parameters
2.2.3. LC-MS
2.2.4. Expression of Genes for Regulatory Factors
2.3. Statistical Analysis
3. Results
3.1. Growth Performance
3.2. Lipid Parameters
3.3. Metabolite Analysis
3.4. Metabolite Pathways and Expression of Genes for Regulatory Factors
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Madkour, M.; Aboelenin, M.M.; Younis, E.; Mohamed, M.A.; Shourrap, M. Hepatic acute-phase response, antioxidant biomarkers and DNA fragmentation of two rabbit breeds subjected to acute heat stress. Ital. J. Anim. Sci. 2020, 19, 1568–1576. [Google Scholar] [CrossRef]
- Nawaz, A.H.; Amoah, K.; Leng, Q.Y.; Zheng, J.H.; Zhang, W.L.; Zhang, L. Poultry Response to Heat Stress: Its Physiological, Metabolic, and Genetic Implications on Meat Production and Quality Including Strategies to Improve Broiler Production in a Warming World. Front. Vet. Sci. 2021, 8, 699081. [Google Scholar] [CrossRef] [PubMed]
- Madkour, M.; Salman, F.M.; El-Wardany, I.; Abdel-Fattah, S.A.; Alagawany, M.; Hashem, N.M.; Abdelnour, S.A.; El-Kholy, M.S.; Dhama, K. Mitigating the detrimental effects of heat stress in poultry through thermal conditioning and nutritional manipulation. J. Therm. Biol. 2022, 103, 103169. [Google Scholar] [CrossRef]
- Akinyemi, F.; Adewole, D. Effects of brown seaweed products on growth performance, plasma biochemistry, immune response, and antioxidant capacity of broiler chickens challenged with heat stress. Poult. Sci. 2022, 101, 102215. [Google Scholar] [CrossRef] [PubMed]
- Ma, B.; Xing, T.; Li, J.; Zhang, L.; Jiang, Y.; Gao, F. Chronic heat stress causes liver damage via endoplasmic reticulum stress-induced apoptosis in broilers. Poult. Sci. 2022, 101, 102063. [Google Scholar] [CrossRef] [PubMed]
- Goel, A.; Ncho, C.M.; Choi, Y.H. Regulation of gene expression in chickens by heat stress. J. Anim. Sci. Biotechnol. 2021, 12, 11. [Google Scholar] [CrossRef]
- Zhai, W.; Peebles, E.D.; Mejia, L.; Zumwalt, C.D.; Corzo, A. Effects of dietary amino acid density and metabolizable energy level on the growth and meat yield of summer-reared broilers. J. Appl. Poult. Res. 2014, 23, 501–515. [Google Scholar] [CrossRef]
- Jiang, S.; Yan, F.-F.; Hu, J.-Y.; Mohammed, A.; Cheng, H.-W. Bacillus subtilis-Based Probiotic Improves Skeletal Health and Immunity in Broiler Chickens Exposed to Heat Stress. Animals 2021, 11, 1494. [Google Scholar] [CrossRef]
- Yunianto, V.D.; Hayashit, K.; Kaiwda, S.; Ohtsuka, A.; Tomita, Y. Effect of environmental temperature on muscle protein turnover and heat production in tube-fed broiler chickens. Br. J. Nutr. 1997, 77, 897–909. [Google Scholar] [CrossRef]
- Dai, S.F.; Gao, F.; Zhang, W.H.; Song, S.X.; Xu, X.L.; Zhou, G.H. Effects of dietary glutamine and gamma-aminobutyric acid on performance, carcass characteristics and serum parameters in broilers under circular heat stress. Anim. Feed. Sci. Technol. 2011, 168, 51–60. [Google Scholar] [CrossRef]
- Zhang, Z.Y.; Jia, G.Q.; Zuo, J.J.; Zhang, Y.; Lei, J.; Ren, L.; Feng, D.Y. Effects of constant and cyclic heat stress on muscle metabolism and meat quality of broiler breast fillet and thigh meat. Poult. Sci. 2012, 91, 2931. [Google Scholar] [CrossRef]
- Yuan, L.; Lin, H.; Jiang, K.J.; Jiao, H.C.; Song, Z.G. Corticosterone administration and high-energy feed results in enhanced fat accumulation and insulin resistance in broiler chickens. Br. Poult. Sci. 2008, 49, 487–495. [Google Scholar] [CrossRef] [PubMed]
- He, S.; Zhao, S.; Dai, S.; Liu, D.; Bokhari, S.G. Effects of dietary betaine on growth performance, fat deposition and serum lipids in broilers subjected to chronic heat stress. Anim. Sci. J. 2015, 86, 897–903. [Google Scholar] [CrossRef]
- Moraes, V.; Malheiros, R.D.; Bruggeman, V.; Collin, A.; Tona, K.; As, P.V.; Onagbesan, O.M.; Buyse, J.; Decuypere, E.; Macari, M. Effect of thermal conditioning during embryonic development on aspects of physiological responses of broilers to heat stress. J. Therm. Biol. 2003, 28, 133–140. [Google Scholar] [CrossRef]
- Shim, K.S.; Hwang, K.T.; Son, M.W.; Park, G.H. Lipid Metabolism and Peroxidation in Broiler Chicks under Chronic Heat Stress. Asian Australas. J. Anim. Sci. 2006, 19, 1206–1211. [Google Scholar] [CrossRef]
- Bahri, S.I.S.; Ariffin, A.S.; Mohtar, S. Critical Review on Food Security in Malaysia for Broiler Industry. Int. J. Acad. Res. Bus. Soc. Sci. 2019, 9, 869–876. [Google Scholar] [CrossRef] [PubMed]
- Matsakas, A.; Patel, K. Skeletal muscle fibre plasticity in response to selected environmental and physiological stimuli. Histol. Histopathol. 2009, 24, 611–629. [Google Scholar] [CrossRef]
- Ottaviani, E.; Malagoli, D.; Franceschi, C. The evolution of the adipose tissue: A neglected enigma. Gen. Comp. Endocrinol. 2011, 174, 1–4. [Google Scholar] [CrossRef]
- Sato, M.; Tachibana, T.; Furuse, M. Heat production and lipid metabolism in broiler and layer chickens during embryonic development. Comp. Biochem. Physiol. A Mol. Integr. Physiol. 2006, 143, 382–388. [Google Scholar] [CrossRef]
- Zeng, C.; Wen, B.; Hou, G.; Lei, L.; Mei, Z.; Jia, X.; Chen, X.; Zhu, W.; Li, J.; Kuang, Y.; et al. Lipidomics profiling reveals the role of glycerophospholipid metabolism in psoriasis. GigaScience 2017, 6, 1–11. [Google Scholar] [CrossRef]
- Sammad, A.; Luo, H.; Hu, L.; Zhao, S.; Gong, J.; Umer, S.; Khan, A.; Zhu, H.; Wang, Y. Joint Transcriptome and Metabolome Analysis Prevails the Biological Mechanisms Underlying the Pro-Survival Fight in In Vitro Heat-Stressed Granulosa Cells. Biology 2022, 11, 839. [Google Scholar] [CrossRef]
- Cao, X.; Lu, X.M.; Tuo, X.; Liu, J.Y.; Zhang, Y.C.; Song, L.N.; Cheng, Z.Q.; Yang, J.K.; Xin, Z. Angiotensin-converting enzyme 2 regulates endoplasmic reticulum stress and mitochondrial function to preserve skeletal muscle lipid metabolism. Lipids Health Dis. 2019, 18, 207. [Google Scholar] [CrossRef]
- Zhou, Y.; Liu, H.; Zhang, M. Analysis of the metabolic pathways affected by hot-Humid or dry climate based on fecal metabolomics coupled with serum metabolic changes in broiler chickens. Poult. Sci. 2020, 99, 5526–5546. [Google Scholar] [CrossRef] [PubMed]
- Gowda, G.A.; Djukovic, D. Overview of mass spectrometry-based metabolomics: Opportunities and challenges. Methods Mol. Biol. 2013, 1198, 3–12. [Google Scholar]
- Vinayavekhin, N.; Sueajai, J.; Chaihad, N.; Panrak, R.; Chokchaisiri, R.; Sangvanich, P.; Suksamrarn, A.; Piyachaturawat, P. Serum lipidomics analysis of ovariectomized rats under Curcuma comosa treatment. J. Ethnopharmacol. 2016, 192, 273–282. [Google Scholar] [CrossRef]
- Nardone, A.; Ronchi, B.; Lacetera, N.; Ranieri, M.S.; Bernabucci, U. Effects of climate changes on animal production and sustainability of livestock systems. Livest. Sci. 2010, 130, 57–69. [Google Scholar] [CrossRef]
- Zampiga, M.; Laghi, L.; Zhu, C.; Mancinelli, A.C.; Sirri, F. Breast muscle and plasma metabolomics profile of broiler chickens exposed to chronic heat stress conditions. Animal 2021, 15, 100275. [Google Scholar] [CrossRef] [PubMed]
- Geraert, P.A.; Padilha, J.C.; Guillaumin, S. Metabolic and endocrine changes induced by chronic heat exposure in broiler chickens: Growth performance, body composition and energy retention. Br. J. Nutr. 1996, 75, 195–204. [Google Scholar] [CrossRef] [PubMed]
- Segerstrom, S.C. Stress, Energy, and Immunity: An Ecological View. Curr. Dir. Psychol. Sci. 2007, 16, 326–330. [Google Scholar] [CrossRef]
- Piestun, Y.; Patael, T.; Yahav, S.; Velleman, S.G.; Halevy, O. Early posthatch thermal stress affects breast muscle development and satellite cell growth and characteristics in broilers. Poult. Sci. 2017, 96, 2877–2888. [Google Scholar] [CrossRef]
- El-Deep, M.H.; Ijiri, D.; Ebeid, T.A.; Ohtsuka, A. Effects of Dietary Nano-Selenium Supplementation on Growth Performance, Antioxidative Status, and Immunity in Broiler Chickens under Thermoneutral and High Ambient Temperature Conditions. J. Poult. Sci. 2016, 53, 274–283. [Google Scholar] [CrossRef] [PubMed]
- Lu, Z.; He, X.; Ma, B.; Zhang, L.; Li, J.; Jiang, Y.; Zhou, G.; Gao, F. Chronic Heat Stress Impairs the Quality of Breast-Muscle Meat in Broilers by Affecting Redox Status and Energy-Substance Metabolism. J. Agric. Food Chem. 2017, 65, 11251–11258. [Google Scholar] [CrossRef]
- He, S.; Li, S.; Arowolo, M.A.; Yu, Q.; Chen, F.; Hu, R.; He, J. Effect of resveratrol on growth performance, rectal temperature and serum parameters of yellow-feather broilers under heat stress. Anim. Sci. J. 2019, 90, 401–411. [Google Scholar] [CrossRef] [PubMed]
- Xie, J.; Chen, Z.; Tang, J.; Wang, B. Effect of gamma-aminobutyric acid on digestive enzymes, absorption function, and immune function of intestinal mucosa in heat-stressed chicken. Poult. Sci. 2014, 93, 2490–2500. [Google Scholar]
- DeBose-Boyd, R.A. Significance and regulation of lipid metabolism. Semin. Cell Dev. Biol. 2018, 81, 97. [Google Scholar] [CrossRef]
- Luo, J.; Song, J.; Liu, L.; Xue, B.; Tian, G.; Yang, Y. Effect of epigallocatechin gallate on growth performance and serum biochemical metabolites in heat-stressed broilers. Poult. Sci. 2018, 97, 599–606. [Google Scholar] [CrossRef] [PubMed]
- Huang, L.; Tepaamorndech, S.; Kirschke, C.P.; Newman, J.W.; Keyes, W.R.; Pedersen, T.L.; Dumnil, J. Aberrant fatty acid metabolism in skeletal muscle contributes to insulin resistance in zinc transporter 7 (Znt7)-knockout mice. J. Biol. Chem. 2018, 293, 7549–7563. [Google Scholar] [CrossRef]
- Zhang, C.; Chen, K.; Zhao, X.; Geng, Z. Protective effects of resveratrol against high ambient temperature-induced spleen dysplasia in broilers through modulating splenic redox status and apoptosis. J. Sci. Food Agric. 2018, 98, 5409–5417. [Google Scholar] [CrossRef]
- Guo, Y.; Balasubramanian, B.; Zhao, Z.H.; Liu, W.C. Heat stress alters serum lipid metabolism of Chinese indigenous broiler chickens-a lipidomics study. Environ. Sci. Pollut. Res. 2020, 28, 10707–10717. [Google Scholar] [CrossRef]
- Sahebkar, A. Fat lowers fat: Purified phospholipids as emerging therapies for dyslipidemia. Biochim. Biophys. Acta 2013, 1831, 887–893. [Google Scholar] [CrossRef] [PubMed]
- Zhang, T.; Zhao, Q.; Xiao, X.; Yang, R.; Hu, D.; Zhu, X.; Gonzalez, F.J.; Li, F. Modulation of Lipid Metabolism by Celastrol. J. Proteome Res. 2019, 18, 1133–1144. [Google Scholar] [CrossRef]
- Dean, M.; Annilo, T. Evolution of the ATP-binding cassette (ABC) transporter superfamily in vertebrates. Annu. Rev. Genom. Hum. Genet. 2005, 6, 123–142. [Google Scholar] [CrossRef]
- Kennedy, M.A.; Barrera, G.C.; Nakamura, K.; Baldán, á.; Tarr, P.; Fishbein, M.C.; Frank, J.; Francone, O.L.; Edwards, P.A. ABCG1 has a critical role in mediating cholesterol efflux to HDL and preventing cellular lipid accumulation. Cell Metab. 2005, 1, 121–131. [Google Scholar] [CrossRef] [PubMed]
- Christiansen-Weber, T.A.; Voland, J.R.; Wu, Y.; Ngo, K.; Roland, B.L.; Nguyen, S.; Peterson, P.A.; Fung-Leung, W.P. Functional loss of ABCA1 in mice causes severe placental malformation, aberrant lipid distribution, and kidney glomerulonephritis as well as high-density lipoprotein cholesterol deficiency. Am. J. Pathol. 2000, 157, 1017–1029. [Google Scholar] [CrossRef] [PubMed]
- Haghpassand, M.; Bourassa, P.; Francone, O.L.; Aiello, R.J. Monocyte/macrophage expression of ABCA1 has minimal contribution to plasma HDL levels. J. Clin. Investig. 2001, 108, 1315–1320. [Google Scholar] [CrossRef]
- Aiello, R.; Brees, D.; Francone, O. ABCA1-deficient mice: Insights into the role of monocyte lipid efflux in HDL formation and inflammation. Arterioscler. Thromb. Vasc. Biol. 2003, 23, 972–980. [Google Scholar] [CrossRef]
- Terasaka, N.; Wang, N.; Yvan-Charvet, L.; Tall, A.R. High-density lipoprotein protects macrophages from oxidized low-density lipoprotein-induced apoptosis by promoting efflux of 7-ketocholesterol via ABCG1. Proc. Natl. Acad. Sci. USA 2007, 104, 15093–15098. [Google Scholar] [CrossRef]
- Xu, J.; Xiao, G.; Trujillo, C.; Chang, V.; Blanco, L.; Joseph, S.B.; Bassilian, S.; Saad, M.F.; Tontonoz, P.; Lee, W.N.; et al. Peroxisome proliferator-activated receptor alpha (PPARalpha) influences substrate utilization for hepatic glucose production. J. Biol. Chem. 2002, 277, 50237–50244. [Google Scholar] [CrossRef]
- Sun, N.; Shen, C.; Zhang, L.; Wu, X.; Gao, Y. Hepatic Krüppel-like factor 16 (KLF16) targets PPARα to improve steatohepatitis and insulin resistance. Gut 2020, 70, 2183–2195. [Google Scholar] [CrossRef] [PubMed]
- Chen, H.; Fan, W.; He, H.; Huang, F. PGC-1: A key regulator in bone homeostasis. J. Bone Min. Metab. 2022, 40, 1–8. [Google Scholar] [CrossRef] [PubMed]
- Pan, H.; Hu, Z.; Shao, Z.; Ning, Y. Peroxisome proliferator-activated receptor γ coactivator-1α (PGC-1α) overexpression alleviates endoplasmic reticulum stress after acute kidney injury. Ren. Fail. 2022, 44, 358–367. [Google Scholar] [CrossRef] [PubMed]
- Chen, L.; Shen, Y.; Xiong, H.; Guan, Z.; Si, Y.; Liang, H.; Zhu, W.; Cai, Q. Role of PGC-1α in fiber type conversion in the palatopharyngeus muscle of OSA patients. J. Clin. Lab. Anal. 2022, 36, e24551. [Google Scholar] [CrossRef]
- Wang, H.; Kuusela, S.; Rinnankoski-Tuikka, R.; Dumont, V.; Bouslama, R.; Ramadan, U.A.; Waaler, J.; Linden, A.M.; Chi, N.W.; Krauss, S.; et al. Tankyrase inhibition ameliorates lipid disorder via suppression of PGC-1α PARylation in db/db mice. Int. J. Obes. 2020, 44, 1691–1702. [Google Scholar] [CrossRef] [PubMed]
- Chinetti, G.; Lestavel, S.; Bocher, V.; Remaley, A.T.; Neve, B.; Torra, I.P.; Teissier, E.; Minnich, A.; Jaye, M.; Duverger, N.; et al. PPAR-alpha and PPAR-gamma activators induce cholesterol removal from human macrophage foam cells through stimulation of the ABCA1 pathway. Nat. Med. 2001, 7, 53–58. [Google Scholar] [CrossRef]
- Dalvi, R.; Das, T.; Debnath, D.; Yengkokpam, S.; Baruah, K.; Tiwari, L.; Pal, A. Metabolic and cellular stress responses of catfish, Horabagrus brachysoma (Günther) acclimated to increasing temperatures. J. Therm. Biol. 2017, 65, 32–40. [Google Scholar] [CrossRef]
- Jastrebski, S.F.; Lamont, S.J.; Schmidt, C.J. Chicken hepatic response to chronic heat stress using integrated transcriptome and metabolome analysis. PLoS ONE 2017, 12, e0181900. [Google Scholar] [CrossRef] [PubMed]
Primer Name 1 | Primer Sequence 2 5′-3′ | Product Size (bp) | GenBank Accession Number |
---|---|---|---|
β-actin | F: CTGTGTTCCCATCTATCGT | 270 | NM_205518 |
R: TCTTCTCTCTGTTGGCTTTG | |||
ABCA1 | F: TCATCCACCGCCGCCACATT | 223 | NM_204145 |
R: GGCTGAGGAAGGCACTGAAGTC | |||
ABCG1 | F: AACCAGTGGCTTGGATAGTGC | 298 | XM_025145525 |
R: CCTTACCAGTCGGCTGTTCTG | |||
PPARα | F: CAAACCAACCATCCTGACGAT | 22 | NM_001001464 |
R: CTCCACTGTCACTCAGGTTTCCT | |||
PGC-1α | F: GGGACCGGTTTGAAGTTTTTG | 110 | NM_001006457 |
R: GGCTCGTTTGACCTGCGTAA |
Items | NT 2 | HS 2 | p-Value |
---|---|---|---|
ADFI (g) | 129.40 a ± 2.39 | 97.21 b ± 4.22 | <0.01 |
ADG (g) | 76.81 a ± 2.39 | 56.37 b ± 3.15 | <0.01 |
FCR | 1.68 b ± 0.02 | 1.74 a ± 0.03 | <0.01 |
Breast muscle yield | 19.74 a ± 1.55 | 17.85 b ± 1.27 | <0.01 |
Items | NT 2 | HS 2 | p-Value |
---|---|---|---|
Cholesterol(mmol/L) | 3.65 b ± 0.23 | 4.80 a ± 0.11 | <0.01 |
Free fatty acids (μmol/L) | 58.61 b ± 5.72 | 106.68 a ± 3.24 | <0.01 |
Corticosterone(ng/mL) | 10.74 b ± 1.71 | 15.78 a ± 0.51 | <0.01 |
Percentage of abdominal fat (%) | 0.51 b ± 0.20 | 0.77 a ± 0.20 | <0.01 |
Metabolites 2 | VIP (HS&NT) | FC (HS/NT) | p-Value | Change |
---|---|---|---|---|
PE | ||||
P-18:1(9Z)/16:1(9Z) | 1.647 | 1.0298 | 0.0277 | ↑ |
P-16:0/20:4(6E,8Z,11Z,14Z)(5OH[S]) | 1.557 | 0.9679 | 0.0343 | ↓ |
18:2(9Z,12Z)/P-16:0 | 1.869 | 1.0429 | 0.0101 | ↑ |
18:2(9Z,12Z)/18:0 | 1.736 | 1.0362 | 0.0151 | ↑ |
15:0/22:2(13Z,16Z) | 1.185 | 1.0129 | 0.0232 | ↑ |
NMe(18:0/22:5(4Z,7Z,10Z,13Z,16Z)) | 1.244 | 0.9826 | 0.0352 | ↓ |
PC | ||||
18:2(9Z,12Z)/P-16:0 | 1.495 | 1.0231 | 0.0441 | ↑ |
16:0/22:6(4Z,7Z,10Z,13Z,16Z,19Z) | 1.624 | 0.9703 | 0.0211 | ↓ |
SM(d18:1/16:0) | 1.383 | 0.9835 | 0.0178 | ↓ |
Glycerophosphocholine | 2.547 | 1.0800 | 0.0410 | ↑ |
Alanyl-dl-leucine | 2.398 | 0.9357 | 0.0096 | ↓ |
Alanyl-tryptophan | 2.698 | 0.9340 | 0.0008 | ↓ |
Linoelaidyl carnitine | 3.730 | 0.8654 | 0.0277 | ↓ |
1,2-dipalmitoyl-sn-glycero-3-PC | 1.569 | 0.9715 | 0.0175 | ↓ |
Octadecenoylcarnitine | 3.729 | 0.8656 | 0.0259 | ↓ |
Spermidine | 2.409 | 0.9283 | 0.0296 | ↓ |
Alanyl-dl-phenylalanine | 2.703 | 0.9286 | 0.0019 | ↓ |
Decanoyl-L-carnitine | 3.664 | 0.8284 | 0.0097 | ↓ |
3-hydroxyhexadecanoyl carnitine | 3.641 | 0.8586 | 0.0108 | ↓ |
25-Hydroxyvitamin D3-26,23-lactol | 2.689 | 0.9132 | 0.0394 | ↓ |
Rockogenin | 3.520 | 0.8535 | 0.0104 | ↓ |
Persicaxanthin | 2.482 | 1.0753 | 0.0159 | ↑ |
Pipericine | 1.559 | 0.9581 | 0.0253 | ↓ |
2-Methylbutyroylcarnitine | 2.277 | 0.9442 | 0.0260 | ↓ |
Cis- and trans-L-Mercapto-p-menthan-3-one | 2.291 | 0.9244 | 0.0126 | ↓ |
Delphinidin 3-rutinoside | 2.111 | 1.0522 | 0.0190 | ↑ |
Histamine | 1.212 | 0.9763 | 0.0487 | ↓ |
Alanyl-tyrosine | 2.143 | 0.9522 | 0.0085 | ↓ |
D-Glucuronic acid | 1.734 | 1.0359 | 0.0194 | ↑ |
Palmitoyl sphingomyelin | 1.371 | 0.9813 | 0.0159 | ↓ |
Alanyl-arginine | 3.389 | 0.8285 | 0.0461 | ↓ |
Fructosamine | 2.649 | 1.0851 | 0.0029 | ↑ |
3-Phenylpropyl glucosinolate | 3.321 | 0.8777 | 0.0105 | ↓ |
Nicotinamide adenine dinucleotide | 1.848 | 0.9639 | 0.0108 | ↓ |
Phenylalanyl-Gamma-glutamate | 2.449 | 0.9334 | 0.0027 | ↓ |
1-(11Z,14Z-eicosadienoyl)-glycero-3-phosphate | 1.819 | 1.0395 | 0.0044 | ↑ |
1-Arachidonoylglycerophosphoinositol | 1.991 | 1.0516 | 0.0342 | ↑ |
9(Z),11(E)-Conjugated Linoleic Acid | 3.512 | 0.7954 | 0.0388 | ↓ |
N-(1-Deoxy-1-fructosyl) glycine | 2.695 | 1.0924 | 0.0037 | ↑ |
Sedoheptulose 1-phosphate | 1.666 | 1.0395 | 0.0278 | ↑ |
Taurine | 2.683 | 0.9176 | 0.0309 | ↓ |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Li, X.; Zhao, X.; Yu, M.; Zhang, M.; Feng, J. Effects of Heat Stress on Breast Muscle Metabolomics and Lipid Metabolism Related Genes in Growing Broilers. Animals 2024, 14, 430. https://doi.org/10.3390/ani14030430
Li X, Zhao X, Yu M, Zhang M, Feng J. Effects of Heat Stress on Breast Muscle Metabolomics and Lipid Metabolism Related Genes in Growing Broilers. Animals. 2024; 14(3):430. https://doi.org/10.3390/ani14030430
Chicago/Turabian StyleLi, Xiumei, Xin Zhao, Miao Yu, Minhong Zhang, and Jinghai Feng. 2024. "Effects of Heat Stress on Breast Muscle Metabolomics and Lipid Metabolism Related Genes in Growing Broilers" Animals 14, no. 3: 430. https://doi.org/10.3390/ani14030430
APA StyleLi, X., Zhao, X., Yu, M., Zhang, M., & Feng, J. (2024). Effects of Heat Stress on Breast Muscle Metabolomics and Lipid Metabolism Related Genes in Growing Broilers. Animals, 14(3), 430. https://doi.org/10.3390/ani14030430