Puerarin Inhibits NLRP3-Caspase-1-GSDMD-Mediated Pyroptosis via P2X7 Receptor in Cardiomyocytes and Macrophages
Abstract
:1. Introduction
2. Results
2.1. GO and KEGG Enrichment Analysis of Core Genes for Puerarin against Diabetic Cardiomyopathy
2.2. Effects of Puerarin on the Viability of H9C2 Cells
2.3. Effects of Puerarin on the Mitochondrial Membrane Potential of H9C2 Cells
2.4. D-Glucose Stimulus Inhibits the Mitochondrial Respiratory Function of H9C2 Cells
2.5. Puerarin Inhibits the Inflammatory mRNA Expression of H9C2 Cardiomyocytes
2.6. Effects of Puerarin on NLRP3-Caspase-1-GSDMD Mediated Pyroptosis in H9C2 Cells
2.7. Effects of Puerarin on the Viability of RAW264.7 Cells
2.8. Puerarin Inhibits the Inflammatory mRNA Expression of RAW264.7 Macrophages
2.9. Effects of Puerarin on Key Proteins That Mediate Pyroptosis Pathways in Treated RAW264.7 Macrophages
2.10. P2X7 Receptor Plays an Important Role in Puerarin Action against D-Glucose-Induced H9C2 Cell Injury and LPS-Induced Inflammation of RAW 264.7 Macrophages
2.11. Molecular Docking of Puerarin and P2X7 Receptor
3. Discussion
4. Materials and Methods
4.1. Puerarin Target Collection
4.2. Identification of DCM-Related Targets
4.3. Gene Ontology (GO) and the Kyoto Encyclopedia of Genes and Genomes (KEGG) Enrichment Analysis of the Core Targets for Puerarin against DCM
4.4. Cell Culture and Treatment
4.5. Cell Viability Assay
4.6. Determination of Mitochondrial Membrane Potential
4.7. Mitochondrial Respiratory Function Detection
4.8. Determination of Nitric Oxide (NO) Production
4.9. Extraction of RNA and Quantitative Real-Time Polymerase Chain Reaction (RT-qPCR)
4.10. Western Blot Analysis
4.11. Molecular Docking of Puerarin and the P2X7 Receptor Based on CDOCKER
4.12. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Lorenzo-Almorós, A.; Tuñón, J.; Orejas, M.; Cortés, M.; Egido, J.; Lorenzo, Ó. Diagnostic approaches for diabetic cardiomyopathy. Cardiovasc. Diabetol. 2017, 16, 28. [Google Scholar] [CrossRef] [PubMed]
- Othman, A.I.; El-Sawi, M.R.; El-Missiry, M.A.; Abukhalil, M.H. Epigallocatechin-3-gallate protects against diabetic cardiomyopathy through modulating the cardiometabolic risk factors, oxidative stress, inflammation, cell death and fibrosis in streptozotocin-nicotinamide-induced diabetic rats. Biomed. Pharmacother. 2017, 94, 362–373. [Google Scholar] [CrossRef] [PubMed]
- Yao, J.; Li, Y.; Jin, Y.; Chen, Y.; He, W. Synergistic cardioptotection by tilianin and syringin in diabetic cardiomyopathy involves interaction of TLR4/NF-κB/NLRP3 and PGC1a/SIRT3 pathways. Int. Immunopharmacol. 2021, 96, 107728. [Google Scholar] [CrossRef]
- Yang, F.; Qin, Y.; Lv, J.; Wang, Y.; Che, H.; Chen, X.; Jiang, Y.; Li, A.; Sun, X.; Yue, E. Silencing long non-coding RNA Kcnq1ot1 alleviates pyroptosis and fibrosis in diabetic cardiomyopathy. Cell Death Dis. 2018, 9, 1000. [Google Scholar] [CrossRef] [PubMed]
- Bergsbaken, T.; Fink, S.L.; Cookson, B.T. Pyroptosis: Host cell death and inflammation. Nat. Rev. Microbiol. 2009, 7, 99–109. [Google Scholar] [CrossRef]
- Zeng, Z.; Li, G.; Wu, S.; Wang, Z. Role of pyroptosis in cardiovascular disease. Cell Prolif. 2019, 52, e12563. [Google Scholar] [CrossRef]
- Jin, X.; Fu, W.; Zhou, J.; Shuai, N.; Yang, Y.; Wang, B. Oxymatrine attenuates oxidized low-density lipoprotein-induced HUVEC injury by inhibiting NLRP3 inflammasome-mediated pyroptosis via the activation of the SIRT1/Nrf2 signaling pathway. Int. J. Mol. Med. 2021, 48, 187. [Google Scholar] [CrossRef]
- Gaidt, M.M.; Hornung, V. Pore formation by GSDMD is the effector mechanism of pyroptosis. EMBO J. 2016, 35, 2167–2169. [Google Scholar] [CrossRef]
- Li, Y.; Liu, C.; Wan, X.S.; Li, S.W. NLRP1 deficiency attenuates diabetic retinopathy (DR) in mice through suppressing inflammation response. Biochem. Biophys. Res. Commun. 2018, 501, 351–357. [Google Scholar] [CrossRef]
- Yang, F.; Qin, Y.; Wang, Y.; Li, A.; Lv, J.; Sun, X.; Che, H.; Han, T.; Meng, S.; Bai, Y.; et al. LncRNA KCNQ1OT1 Mediates Pyroptosis in Diabetic Cardiomyopathy. Cell. Physiol. Biochem. 2018, 50, 1230–1244. [Google Scholar] [CrossRef]
- Jeyabal, P.; Thandavarayan, R.A.; Joladarashi, D.; Babu, S.S.; Krishnamurthy, S.; Bhimaraj, A.; Youker, K.A.; Kishore, R.; Krishnamurthy, P. MicroRNA-9 inhibits hyperglycemia-induced pyroptosis in human ventricular cardiomyocytes by targeting ELAVL1. Biochem. Biophys. Res. Commun. 2016, 471, 423–429. [Google Scholar] [CrossRef] [PubMed]
- Yang, F.; Li, A.; Qin, Y.; Che, H.; Wang, L. A Novel Circular RNA Mediates Pyroptosis of Diabetic Cardiomyopathy by Functioning as a Competing Endogenous RNA. Mol. Ther. Nucleic Acids 2019, 17, 636–643. [Google Scholar] [CrossRef] [PubMed]
- Shen, L.; Li, L.; Li, M.; Wang, W.; Yin, W.; Liu, W.; Hu, Y. Silencing of NOD2 protects against diabetic cardiomyopathy in a murine diabetes model. Int. J. Mol. Med. 2018, 42, 3017–3026. [Google Scholar] [CrossRef] [PubMed]
- Giacco, F.; Brownlee, M. Oxidative stress and diabetic complications. Circ. Res. 2010, 107, 1058–1070. [Google Scholar] [CrossRef] [PubMed]
- Wakisaka, M.; Kamouchi, M.; Kitazono, T. Lessons from the Trials for the Desirable Effects of Sodium Glucose Co-Transporter 2 Inhibitors on Diabetic Cardiovascular Events and Renal Dysfunction. Int. J. Mol. Sci. 2019, 20, 5668. [Google Scholar] [CrossRef]
- Hu, X.; Bai, T.; Xu, Z.; Liu, Q.; Zheng, Y.; Cai, L. Pathophysiological Fundamentals of Diabetic Cardiomyopathy. Compr. Physiol. 2017, 7, 693–711. [Google Scholar] [CrossRef]
- American Diabetes Association. Classification and Diagnosis of Diabetes: Standards of Medical Care in Diabetes-2019. Diabetes Care 2019, 42 (Suppl. S1), S13–S28. [Google Scholar] [CrossRef]
- Li, Y.; Wu, Q.; Deng, Y.; Lv, H.; Qiu, J.; Chi, G.; Feng, H. D(−)-Salicin inhibits the LPS-induced inflammation in RAW264.7 cells and mouse models. Int. Immunopharmacol. 2015, 26, 286–294. [Google Scholar] [CrossRef]
- Piazza, M.; Calabrese, V.; Baruffa, C.; Gioannini, T.; Weiss, J.; Peri, F. The cationic amphiphile 3,4-bis(tetradecyloxy)benzylamine inhibits LPS signaling by competing with endotoxin for CD14 binding. Biochem. Pharmacol. 2010, 80, 2050–2056. [Google Scholar] [CrossRef]
- Tianzhu, Z.; Shihai, Y.; Juan, D. The Effects of Morin on Lipopolysaccharide-Induced Acute Lung Injury by Suppressing the Lung NLRP3 Inflammasome. Inflammation 2014, 37, 1976–1983. [Google Scholar] [CrossRef]
- Xiang, P.; Chen, T.; Mou, Y.; Wu, H.; Xie, P.; Lu, G.; Gong, X.; Hu, Q.; Zhang, Y.; Ji, H. NZ suppresses TLR4/NF-kappa B signalings and NLRP3 inflammasome activation in LPS-induced RAW264.7 macrophages. Inflamm. Res. Off. J. Eur. Histamine Res. Soc. 2015, 64, 799–808. [Google Scholar] [CrossRef]
- Sluyter, R. The P2X7 receptor. In Protein Reviews; Springer: Berlin/Heidelberg, Germany, 2017; Volume 1051, pp. 17–53. [Google Scholar] [CrossRef]
- Chen, X.; Li, H.; Wang, K.; Liang, X.; Wang, W.; Hu, X.; Huang, Z.; Wang, Y. Aerobic Exercise Ameliorates Myocardial Inflammation, Fibrosis and Apoptosis in High-Fat-Diet Rats by Inhibiting P2X7 Purinergic Receptors. Front. Physiol. 2019, 10, 1286. [Google Scholar] [CrossRef] [PubMed]
- Stachon, P.; Heidenreich, A.; Merz, J.; Hilgendorf, I.; Wolf, D.; Willecke, F.; von Garlen, S.; Albrecht, P.; Härdtner, C.; Ehrat, N.; et al. P2X7 Deficiency Blocks Lesional Inflammasome Activity and Ameliorates Atherosclerosis in Mice. Circulation 2017, 135, 2524–2533. [Google Scholar] [CrossRef] [PubMed]
- Gulbransen, B.D.; Bashashati, M.; Hirota, S.A.; Gui, X.; Roberts, J.A.; Macdonald, J.A.; Muruve, D.A.; Mckay, D.M.; Beck, P.L.; Mawe, G.M. Activation of neuronal P2X7 receptor–pannexin-1 mediates death of enteric neurons during colitis. Nat. Med. 2012, 18, 600–604. [Google Scholar] [CrossRef]
- Mezzaroma, E.; Toldo, S.; Farkas, D.; Seropian, I.M.; Tassell, B.; Salloum, F.N.; Kannan, H.R.; Menna, A.C.; Voelkel, N.F.; Abbate, A. The inflammasome promotes adverse cardiac remodeling following acute myocardial infarction in the mouse. Proc. Natl. Acad. Sci. USA 2011, 108, 19725–19730. [Google Scholar] [CrossRef]
- Cheng, W.; Wu, P.; Du, Y.; Wang, Y.; Zhou, N.; Ge, Y.; Yang, Z. Puerarin improves cardiac function through regulation of energy metabolism in Streptozotocin-Nicotinamide induced diabetic mice after myocardial infarction. Biochem. Biophys. Res. Commun. 2015, 463, 1108–1114. [Google Scholar] [CrossRef]
- Yin, M.S.; Zhang, Y.C.; Xu, S.H.; Liu, J.J.; Mu, Y.L. Puerarin prevents diabetic cardiomyopathy in vivo and in vitro by inhibition of inflammation. J. Asian Nat. Prod. Res. 2018, 21, 476–493. [Google Scholar] [CrossRef]
- Zoppo, G.D.; Saver, J.L.; Jauch, E.C.; Adams, H.P. Expansion of the time window for treatment of acute ischemic stroke with intravenous tissue plasminogen activator: A science advisory from the American Heart Association/American Stroke Association. Stroke 2009, 40, 2945. [Google Scholar] [CrossRef]
- Sun, X.; Zhou, R.; Lei, Y.; Hu, J.; Li, X. The ligand-gated ion channel P2X7 receptor mediates NLRP3/caspase-1-mediated pyroptosis in cerebral cortical neurons of juvenile rats with sepsis. Brain Res. 2020, 1748, 147109. [Google Scholar] [CrossRef]
- Zhang, Y.; Li, F.; Wang, L.; Lou, Y. A438079 affects colorectal cancer cell proliferation, migration, apoptosis, and pyroptosis by inhibiting the P2X7 receptor. Biochem. Biophys. Res. Commun. 2021, 558, 147–153. [Google Scholar] [CrossRef]
- Sun, S.; Dawuti, A.; Gong, D.; Wang, R.; Yuan, T.; Wang, S.; Xing, C.; Lu, Y.; Du, G.; Fang, L. Puerarin-V Improve Mitochondrial Respiration and Cardiac Function in a Rat Model of Diabetic Cardiomyopathy via Inhibiting Pyroptosis Pathway through P2X7 Receptors. Int. J. Mol. Sci. 2022, 23, 13015. [Google Scholar] [CrossRef] [PubMed]
- Ozen, M.; Xie, H.; Na, S.; Yousif, G.A.; Clemens, J.; Mclane, M.W.; Lei, J.; Burd, I. Magnesium sulfate inhibits inflammation through P2X7 receptors in human umbilical vein endothelial cells. Pediatr. Res. 2019, 87, 463–471. [Google Scholar] [CrossRef] [PubMed]
- Loncarevic, B.; Trifunovic, D.; Soldatovic, I.; Vujisic-Tesic, B. Silent diabetic cardiomyopathy in everyday practice: A clinical and echocardiographic study. BMC Cardiovasc. Disord. 2016, 16, 242. [Google Scholar] [CrossRef]
- Schipper, D.A.; Palsma, R.; Marsh, K.M.; O’Hare, C.; Dicken, D.S.; Lick, S.; Kazui, T.; Johnson, K.; Smolenski, R.T.; Duncker, D.J. Chronic Myocardial Ischemia Leads to Loss of Maximal Oxygen Consumption and Complex I Dysfunction. Ann. Thorac. Surg. 2017, 104, 1298–1304. [Google Scholar] [CrossRef] [PubMed]
- Claus, P.; Driesen, R.B.; Dries, E.; Ventura-Clapier, R.; Holemans, P.; Abi-Char, J.; Vermeulen, K.; Galan, D.T.; Sipido, K.R.; Chan, K.N. Reduced mitochondrial respiration in the ischemic as well as in the remote nonischemic region in postmyocardial infarction remodeling. Am. J. Physiol. 2016, 311, H1075–H1090. [Google Scholar] [CrossRef]
- Sarti, A.C.; Vultaggio-Poma, V.; Falzoni, S.; Missiroli, S.; Virgilio, F.D. Mitochondrial P2X7 receptor localization modulates energy metabolism enhancing physical performance. Function 2021, 2, zqab005. [Google Scholar] [CrossRef] [PubMed]
- Zhao, J.; Gao, J.-L.; Zhu, J.-X.; Zhu, H.-B.; Peng, X.; Jiang, M.; Fu, Y.; Xu, J.; Mao, X.-H.; Hu, N.; et al. The different response of cardiomyocytes and cardiac fibroblasts to mitochondria inhibition and the underlying role of STAT3. Basic Res. Cardiol. 2019, 114, 12. [Google Scholar] [CrossRef]
Protein | Activate Site | Ligand | -Cdocker Interaction Energy |
---|---|---|---|
P2X7 receptor | Activate site 1 | Puerarin | 29.205 |
Original ligand 1 | 25.6637 | ||
P2X7 receptor | Activate site 2 | Puerarin | 27.435 |
Original ligand 2 | 9.77534 | ||
P2X7 receptor | Activate site 3 | Puerarin | 18.8467 |
Original ligand 3 | 9.39733 | ||
P2X7 receptor | Activate site 4 | Puerarin | 12.884 |
Original ligand 4 | 33.258 |
Cell | Primer | Sequence | |
---|---|---|---|
H9C2 | IL-1β | F | CACCTCTCAAGCAGAGCACAG |
R | GGGTTCCATGGTGAAGTCAAC | ||
IL-18 | F | TGGAGACTTGGAATCAGACC | |
R | GGCAAGCTAGAAAGTGTCCT | ||
TNF-α | F | ACGTCGTAGCAAACCACCAA | |
R | GCAGCCTTGTCCCTTGAAGA | ||
GAPDH | F | ATGGCACAGTCAAGGCTGAGA | |
R | CGCTCCTGGAAGATGGTGAT | ||
RAW264.7 | NLRP3 | F | AGCCTTCCAGGATCCTCTTC |
R | CTTGGGCAGCAGTTTCTTTC | ||
IL-1β | F | ATCTCGCAGCAGCACATCAA | |
R | ATGGGAACGTCACACACCAG | ||
IL-18 | F | AAAGAAAGCCGCCTCAAACCT | |
R | AATCATCTTTCTGGAACACAA | ||
β-actin | F | TCTGTGTGGATTGGTGGCTCTA | |
R | CTGCTTGCTGATCCACATCTG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Sun, S.; Gong, D.; Liu, R.; Wang, R.; Chen, D.; Yuan, T.; Wang, S.; Xing, C.; Lv, Y.; Du, G.; et al. Puerarin Inhibits NLRP3-Caspase-1-GSDMD-Mediated Pyroptosis via P2X7 Receptor in Cardiomyocytes and Macrophages. Int. J. Mol. Sci. 2023, 24, 13169. https://doi.org/10.3390/ijms241713169
Sun S, Gong D, Liu R, Wang R, Chen D, Yuan T, Wang S, Xing C, Lv Y, Du G, et al. Puerarin Inhibits NLRP3-Caspase-1-GSDMD-Mediated Pyroptosis via P2X7 Receptor in Cardiomyocytes and Macrophages. International Journal of Molecular Sciences. 2023; 24(17):13169. https://doi.org/10.3390/ijms241713169
Chicago/Turabian StyleSun, Shuchan, Difei Gong, Ruiqi Liu, Ranran Wang, Di Chen, Tianyi Yuan, Shoubao Wang, Cheng Xing, Yang Lv, Guanhua Du, and et al. 2023. "Puerarin Inhibits NLRP3-Caspase-1-GSDMD-Mediated Pyroptosis via P2X7 Receptor in Cardiomyocytes and Macrophages" International Journal of Molecular Sciences 24, no. 17: 13169. https://doi.org/10.3390/ijms241713169