Dictamnine Inhibits the Adhesion to and Invasion of Uropathogenic Escherichia Coli (UPEC) to Urothelial Cells
Abstract
:1. Introduction
2. Results
2.1. Cytotoxicity of Dictamnine to Urothelial Cells
2.2. UPEC Growth in the Presence of Dictamnine
2.3. Dictamnine Reduces UPEC Adhesion to and Invasion of Urothelial Cells
2.4. Effect of Dictamnine on UPEC and Urothelial Cells’ Gene Expression
2.5. Inhibitory Effect of Dictamnine on UPEC Fimbriae
3. Discussion
4. Materials and Methods
4.1. Bacterial Strains, Cell Culture, and Chemicals
4.2. Cell Viability Assay
4.3. Antibacterial Activity Assays
4.4. Adhesion and Invasion Assays
4.5. Total RNA Extraction and RT-qPCR Analysis
4.6. Transmission Electron Microscopy (TEM) Analysis of Fimbriae
4.7. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Sample Availability
References
- Lo, A.W.; Moriel, D.G.; Phan, M.D.; Schulz, B.L.; Kidd, T.J.; Beatson, S.A.; Schembri, M.A. Omic approaches to study uropathogenic escherichia coli virulence. Trends Microbiol. 2017, 25, 729–740. [Google Scholar] [CrossRef]
- Terlizzi, M.E.; Gribaudo, G.; Maffei, M.E. UroPathogenic Escherichia coli (UPEC) infections: Virulence factors, bladder responses, antibiotic, and non-antibiotic antimicrobial strategies. Front. Microbiol. 2017, 8, 1566. [Google Scholar] [CrossRef] [PubMed]
- Gupta, K.; Bhadelia, N. Management of urinary tract infections from multidrug-resistant organisms. Infect. Dis. Clin. 2014, 28, 49–59. [Google Scholar] [CrossRef] [PubMed]
- Isaacson, B.; Hadad, T.; Glasner, A.; Gur, C.; Granot, Z.; Bachrach, G.; Mandelboim, O. Stromal cell-derived factor 1 mediates immune cell attraction upon urinary tract infection. Cell Rep. 2017, 20, 40–47. [Google Scholar] [CrossRef] [Green Version]
- Flores-Mireles, A.L.; Walker, J.N.; Caparon, M.; Hultgren, S.J. Urinary tract infections: Epidemiology, mechanisms of infection and treatment options. Nat. Rev. Microbiol. 2015, 13, 269–284. [Google Scholar] [CrossRef]
- Foxman, B. Urinary tract infection syndromes: Occurrence, recurrence, bacteriology, risk factors, and disease burden. Infect. Dis. Clin. N. Am. 2014, 28, 1–13. [Google Scholar] [CrossRef] [PubMed]
- Wiles, T.J.; Kulesus, R.R.; Mulvey, M.A. Origins and virulence mechanisms of uropathogenic Escherichia coli. Exp. Mol. Pathol. 2008, 85, 11–19. [Google Scholar] [CrossRef] [Green Version]
- Cordeiro, M.A.; Werle, C.H.; Milanez, G.P.; Yano, T. Curli fimbria: An Escherichia coli adhesin associated with human cystitis. Braz. J. Microbiol. 2016, 47, 414–416. [Google Scholar] [CrossRef] [Green Version]
- Martinez, J.J.; Mulvey, M.A.; Schilling, J.D.; Pinkner, J.S.; Hultgren, S.J. Type 1 pilus-mediated bacterial invasion of bladder epithelial cells. EMBO J. 2000, 19, 2803–2812. [Google Scholar] [CrossRef] [PubMed]
- Lane, M.C.; Mobley, H.L. Role of P-fimbrial-mediated adherence in pyelonephritis and persistence of uropathogenic Escherichia coli (UPEC) in the mammalian kidney. Kidney Int. 2007, 72, 19–25. [Google Scholar] [CrossRef] [Green Version]
- Veranic, P.; Romih, R.; Jezernik, K. What determines differentiation of urothelial umbrella cells. Eur. J. Cell Biol. 2004, 83, 27–34. [Google Scholar] [CrossRef] [PubMed]
- Eto, D.S.; Jones, T.A.; Sundsbak, J.L.; Mulvey, M.A. Integrin-mediated host cell invasion by type 1-piliated uropathogenic Escherichia coli. PLoS Pathog. 2007, 3, e100. [Google Scholar] [CrossRef] [Green Version]
- Chen, S.L.; Hung, C.S.; Pinkner, J.S.; Walker, J.N.; Cusumano, C.K.; Li, Z.; Bouckaert, J.; Gordon, J.I.; Hultgren, S.J. Positive selection identifies an in vivo role for FimH during urinary tract infection in addition to mannose binding. Proc. Natl. Acad. Sci. USA 2009, 106, 22439–22444. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zamani, H.; Salehzadeh, A. Biofilm formation in uropathogenic Escherichia coli: Association with adhesion factor genes. Turk. J. Med. Sci. 2018, 48, 162–167. [Google Scholar] [CrossRef] [PubMed]
- Nicolle, L.E. Catheter associated urinary tract infections. Antimicrob. Resist. Infect. Control. 2014, 3, 23. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Eberly, A.R.; Floyd, K.A.; Beebout, C.J.; Colling, S.J.; Fitzgerald, M.J.; Stratton, C.W.; Schmitz, J.E.; Hadjifrangiskou, M. Biofilm formation by Uropathogenic Escherichia coli is favored under oxygen conditions that mimic the bladder environment. Int. J. Mol. Sci. 2017, 18, 2077. [Google Scholar] [CrossRef] [Green Version]
- Bernal-Mercado, A.T.; Gutierrez-Pacheco, M.M.; Encinas-Basurto, D.; Mata-Haro, V.; Lopez-Zavala, A.A.; Islas-Osuna, M.A.; Gonzalez-Aguilar, G.A.; Ayala-Zavala, J.F. Synergistic mode of action of catechin, vanillic and protocatechuic acids to inhibit the adhesion of uropathogenic Escherichia coli on silicone surfaces. J. Appl. Microbiol. 2019, 128, 387–400. [Google Scholar] [CrossRef]
- Baldiris-Avila, R.; Montes-Robledo, A.; Buelvas-Montes, Y. Phylogenetic classification, biofilm-forming capacity, virulence factors, and antimicrobial resistance in Uropathogenic Escherichia coli (UPEC). Curr. Microbiol. 2020, 77, 3361–3370. [Google Scholar] [CrossRef]
- Barber, A.E.; Norton, J.P.; Wiles, T.J.; Mulvey, M.A. Strengths and limitations of model systems for the study of urinary tract infections and related pathologies. Microbiol. Mol. Biol. Rev. 2016, 80, 351–367. [Google Scholar] [CrossRef] [Green Version]
- Prestinaci, F.; Pezzotti, P.; Pantosti, A. Antimicrobial resistance: A global multifaceted phenomenon. Pathog. Glob. Health 2015, 109, 309–318. [Google Scholar] [CrossRef] [Green Version]
- Bryce, A.; Hay, A.D.; Lane, I.F.; Thornton, H.V.; Wootton, M.; Costelloe, C. Global prevalence of antibiotic resistance in paediatric urinary tract infections caused by Escherichia coli and association with routine use of antibiotics in primary care: Systematic review and meta-analysis. BMJ 2016, 352, i939. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yang, G.; Chen, D. Alkaloids from the roots of Zanthoxylum nitidum and their antiviral and antifungal effects. Chem. Biodivers. 2008, 5, 1718–1722. [Google Scholar] [CrossRef]
- Huang, H.Y.; Ishikawa, T.; Peng, C.F.; Tsai, I.L.; Chen, I.S. Constituents of the root wood of Zanthoxylum wutaiense with antitubercular activity. J. Nat. Prod. 2008, 71, 1146–1151. [Google Scholar] [CrossRef]
- Wang, J.Y.; Wang, Z.; Li, M.Y.; Zhang, Z.; Mi, C.; Zuo, H.X.; Xing, Y.; Wu, Y.L.; Lian, L.H.; Xu, G.H.; et al. Dictamnine promotes apoptosis and inhibits epithelial-mesenchymal transition, migration, invasion and proliferation by downregulating the HIF-1α and Slug signaling pathways. Chem. Biol. Interact. 2018, 296, 134–144. [Google Scholar] [CrossRef]
- Shi, F.; Pan, H.; Cui, B.; Li, Y.; Huang, L.; Lu, Y. Dictamnine-induced hepatotoxicity in mice: The role of metabolic activation of furan. Toxicol. Appl. Pharmacol. 2019, 364, 68–76. [Google Scholar] [CrossRef]
- Wang, P.; Sun, J.; Gao, E.; Zhao, Y.; Qu, W.; Yu, Z. Simultaneous determination of limonin, dictamnine, obacunone and fraxinellone in rat plasma by a validated UHPLC-MS/MS and its application to a pharmacokinetic study after oral administration of Cortex Dictamni extract. J. Chromatogr. B 2013, 928, 44–51. [Google Scholar] [CrossRef] [PubMed]
- Shen, X.F.; Teng, Y.; Sha, K.H.; Wang, X.Y.; Yang, X.L.; Guo, X.J.; Ren, L.B.; Wang, X.Y.; Li, J.; Huang, N. Dietary flavonoid luteolin attenuates uropathogenic Escherichia. Coli invasion of the urinary bladder. Biofactors 2016, 42, 674–685. [Google Scholar] [CrossRef]
- Mohanty, S.; Zambrana, S.; Dieulouard, S.; Kamolvit, W.; Nilsén, V.; Gonzales, E.; Östenson, C.G.; Brauner, A. Amaranthus caudatus extract inhibits the invasion of E. coli into uroepithelial cells. J. Ethnopharmacol. 2018, 220, 155–158. [Google Scholar] [CrossRef]
- Mohanty, S.; Kamolvit, W.; Zambrana, S.; Sandström, C.; Gonzales, E.; Östenson, C.G.; Brauner, A. Extract of Clinopodium bolivianum protects against E. coli invasion of uroepithelial cells. J. Ethnopharmacol. 2017, 198, 214–220. [Google Scholar] [CrossRef]
- Wright, K.J.; Seed, P.C.; Hultgren, S.J. Development of intracellular bacterial communities of uropathogenic Escherichia coli depends on type 1 pili. Cell Microbiol. 2007, 9, 2230–2241. [Google Scholar] [CrossRef]
- Behzadi, P. Classical chaperone-usher (CU) adhesive fimbriome: Uropathogenic Escherichia coli (UPEC) and urinary tract infections (UTIs). Folia Microbiol. 2020, 65, 45–65. [Google Scholar] [CrossRef] [PubMed]
- Chapman, M.R.; Robinson, L.S.; Pinkner, J.S.; Roth, R.; Heuser, J.; Hammar, M.; Normark, S.; Hultgren, S.J. Role of Escherichia coli curli operons in directing amyloid fiber formation. Science 2002, 295, 851–855. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Barnhart, M.M.; Chapman, M.R. Curli biogenesis and function. Annu. Rev. Microbiol. 2006, 60, 131–147. [Google Scholar] [CrossRef] [Green Version]
- Matuszewski, M.A.; Tupikowski, K.; Dołowy, Ł.; Szymańska, B.; Dembowski, J.; Zdrojowy, R. Uroplakins and their potential applications in urology. Cent. Eur. J. Urol. 2016, 69, 252–257. [Google Scholar]
- Zhou, G.; Mo, W.J.; Sebbel, P.; Neubert, T.A.; Glockshuber, R.; Wu, X.R.; Sun, T.T.; Kong, X.P. Uroplakin Ia is the urothelial receptor for uropathogenic Escherichia coli: Evidence from in vitro FimH binding. J. Cell Sci. 2001, 114 Pt 22, 4095–4103. [Google Scholar] [CrossRef] [PubMed]
- Bokil, N.J.; Totsika, M.; Carey, A.J.; Stacey, K.J.; Hancock, V.; Saunders, B.M.; Ravasi, T.; Ulett, G.C.; Schembri, M.A.; Sweet, M.J. Intramacrophage survival of uropathogenic Escherichia coli: Differences between diverse clinical isolates and between mouse and human macrophages. Immunobiology 2011, 216, 1164–1171. [Google Scholar] [CrossRef] [PubMed]
- Min, G.; Zhou, G.; Schapira, M.; Sun, T.T.; Kong, X.P. Structural basis of urothelial permeability barrier function as revealed by Cryo-EM studies of the 16 nm uroplakin particle. J. Cell Sci. 2003, 116 Pt 20, 4087–4094. [Google Scholar] [CrossRef] [Green Version]
- Zhuge, X.; Sun, Y.; Jiang, M.; Wang, J.; Tang, F.; Xue, F.; Ren, J.; Zhu, W.; Dai, J. Acetate metabolic requirement of avian pathogenic Escherichia coli promotes its intracellular proliferation within macrophage. Vet. Res. 2019, 50, 31. [Google Scholar] [CrossRef] [Green Version]
Gene | Forward Primer | Reverse Primer |
---|---|---|
dnaE | GCTCGCGGGCTTGCTAT | TCGGTTTAAAAGCTGGTCATCA |
β-actin | GCGCGGCTACAGCTTCA | TCCTTAATGTCACGCACGATTT |
FimA | ACTCTGGCAATCGTTGTTCTGTCG | ATCAACAGAGCCTGCATCAACTGC |
FimC | GCCCACTGAAGAACGGATTTT | AGTCCGGTCAGCCCTTT |
FimD | CGCGCGTTGGGATAAAACT | CAAACGGCAGCGGCTTA |
FimE | GCGGGAGTCGGCTTTCTC | ATACCGGCATCGCGAATAAT |
FimF | TGTGGCTGGCGGTGAGT | CCGCGGATAGTAATCGTGCTA |
FimH | GTACCAGCCCGCCGTAATCAT | GTCGATGGCGGGTCAAGTAT |
CsgA | GCGGTAATGGTGCAGATGTTG | CGTTGGGTCAGATCGATTGA |
CsgB | CGGCAGGGAGGCTCAAA | CCCGGTTGCTACTACCTTCTTG |
CsgF | CCGCGATGGTCAATTGC | GGTCGAGGTTTGTCCGGTTT |
PapE | CCGCCGAGGTAACCAAAAA | GCAAGCGCGCCAGAGA |
PapF | CCCGTGAAGAGCTGCGTAA | TCTCGGCGCCAGCAA |
PapG | TTCGCGGCCAGGATCTC | AGCCTTACGTTTCGCTTCCA |
PapH | GGTCTGGCGGCAATCG | CAGGAATTTACCCCCGAGGAT |
ITGA3 | AAGGGACCTTCAGGTGCA | TGTAGCCGGTGATTTACCAT |
ITGB1 | GAAGGGTTGCCCTCCAGA | GCTTGAGCTTCTCTGCTGTT |
UPK1A | TGTCCAACCCATCCCTGATC | GGTGTCCGCGCTGTAGAAG |
UPK1B | CAGCCTCTACCCACTGCTTGA | GATCCAGGCAGCCCCATAG |
UPK2 | TCCAGCAGAGAGATCCCAATG | CCAGCCCAATGGATTCCA |
UPK3A | TTCGGCTCGGCTGTGAAC | GTTGGTGGCGAAAGTCACACT |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yang, W.; Liu, P.; Chen, Y.; Lv, Q.; Wang, Z.; Huang, W.; Jiang, H.; Zheng, Y.; Jiang, Y.; Sun, L. Dictamnine Inhibits the Adhesion to and Invasion of Uropathogenic Escherichia Coli (UPEC) to Urothelial Cells. Molecules 2022, 27, 272. https://doi.org/10.3390/molecules27010272
Yang W, Liu P, Chen Y, Lv Q, Wang Z, Huang W, Jiang H, Zheng Y, Jiang Y, Sun L. Dictamnine Inhibits the Adhesion to and Invasion of Uropathogenic Escherichia Coli (UPEC) to Urothelial Cells. Molecules. 2022; 27(1):272. https://doi.org/10.3390/molecules27010272
Chicago/Turabian StyleYang, Wenbo, Peng Liu, Ying Chen, Qingyu Lv, Zhongtian Wang, Wenhua Huang, Hua Jiang, Yuling Zheng, Yongqiang Jiang, and Liping Sun. 2022. "Dictamnine Inhibits the Adhesion to and Invasion of Uropathogenic Escherichia Coli (UPEC) to Urothelial Cells" Molecules 27, no. 1: 272. https://doi.org/10.3390/molecules27010272