Co-Infection of Tobacco Rattle and Cycas Necrotic Stunt Viruses in Paeonia lactiflora: Detection Strategies, Potential Origins of Infection, and Implications for Paeonia Germplasm Conservation
Abstract
:1. Introduction
2. Materials and Methods
2.1. The UMNA Peony Reference Collection
2.2. Sampling, RNA Extraction, Reverse Transcription, and PCR Amplification of Viral Genes
2.3. DNA Sequencing
2.4. Diversity and Phylogenetic Relationships among Virus Isolates
2.5. Visual Detection of TRV and CNSV Infection
3. Results
3.1. Molecular Confirmation of TRV in Symptomatic Peony Plants
3.2. TRV Diversity at the UMNA Peony Collection
3.3. Molecular Identification of CNSV and Co-Infection with TRV in the UMNA Peony Collection
3.4. Michigan CNSV Isolates Display Close Relationship to Several Paeonia Isolates from Asia
3.5. Visual Indicators of CNSV Infection and TRV/CNSV Co-Infection on P. lactiflora Plants
4. Discussion
4.1. Diversity of TRV and CNSV Isolates in Michigan
4.2. Symptoms of Peonies with CNSV and TRV Infection and Co-Infection and Implications for the Collection Management
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Panis, B.; Nagel, M.; Van den Houwe, I. Challenges and prospects for the conservation of crop genetic resources in field genebanks, In In vitro collections and/or in liquid nitrogen. Plants 2020, 9, 1634. [Google Scholar] [CrossRef] [PubMed]
- Tay, D. Herbaceous ornamental plant germplasm conservation and use: Theoretical and practical treatments. In Flower Breeding and Genetics: Issues, Challenges and Opportunities for the 21st Century; Andersen, N.O., Ed.; Springer: Dordrecht, The Netherlands, 2007; pp. 113–175. [Google Scholar]
- Jones, R.A.; Naidu, R.A. Global dimensions of plant virus diseases: Current status and future perspectives. Annu. Rev. Virol. 2019, 6, 387–409. [Google Scholar] [CrossRef] [PubMed]
- Ji, L.; Wang, Q.; da Silva, J.A.T.; Yu, X.N. The genetic diversity of Paeonia L. Sci. Hortic. 2012, 143, 62–74. [Google Scholar] [CrossRef]
- Kamenetsky-Goldstein, R.; Yu, X. Cut peony industry: The first 30 years of research and new horizons. Hortic. Res. 2022, 9, uhac079. [Google Scholar] [CrossRef] [PubMed]
- Yang, Y.; Sun, M.; Li, S.; Chen, Q.; Teixeira da Silva, J.A.; Wang, A.; Yu, X.; Wang, L. Germplasm resources and genetic breeding of Paeonia: A systematic review. Hort. Res. 2020, 7, 107. [Google Scholar] [CrossRef] [PubMed]
- Hammond, J.; Huang, Q.; Jordan, R.; Meekes, E.; Fox, A.; Vazquez-Iglesias, I.; Vaira, A.M.; Copetta, A.; Delmiglio, C. International Trade and Local Effects of Viral and Bacterial Diseases in Ornamental Plants. Annu. Rev. Phytopathol. 2023, 61, 73–95. [Google Scholar] [CrossRef] [PubMed]
- American Peony Society. Peony Registry. 2022. Available online: https://www.americanpeonysociety.org/cultivar-registration/peony-cultivars (accessed on 31 January 2023).
- Michener, D.C.; Vlasava, N.B. Developing an international model for Paeonia lactiflora Pall. (Paeoniaceae) genetic resources conservation: Integrating assessment of relative significance of historic cultivars for field genebanks with their genetic diversity. In Proceedings of the III International Scientific-Practical Conference: Problems of Biodiversity Conservation and Use of Biological Resources, Minsk, Belarus, 7–9 October 2015; pp. 438–442. [Google Scholar]
- Leus, L. Breeding for disease resistance in ornamentals. In Ornamental Crops; Springer: Cham, Switzerland, 2018; pp. 97–125. [Google Scholar] [CrossRef]
- Mitrofanova, I.V.; Zakubanskiy, A.V.; Mitrofanova, O.V. Viruses infecting main ornamental plants: An overview. Ornam. Hortic. 2018, 24, 95–102. [Google Scholar] [CrossRef]
- Rubio, L.; Galipienso, L.; Ferriol, I. Detection of plant viruses and disease management: Relevance of genetic diversity and evolution. Front. Plant Sci. 2020, 11, 1092. [Google Scholar] [CrossRef]
- Geiser, D.M.; Martin, F.N.; Espindola, A.S.; Brown, J.K.; Bell, T.H.; Yang, Y.; Kang, S. Knowledge gaps, research needs, and opportunities in plant disease diagnostic assay development and validation. PhytoFrontiers 2023, 3, 51–63. [Google Scholar] [CrossRef]
- Fisher, J.R. First report of Tobacco rattle virus associated with ring spot and line pattern disease of peony in Ohio. Plant Health Prog. 2012, 13, 40. [Google Scholar] [CrossRef]
- Garfinkel, A.R.; Chastagner, G.A. Diseases of peonies. In Handbook of Florists’ Crops Diseases; McGovern, R.J., Elmer, W.H., Eds.; Springer International Publishing: Cham, Switzerland, 2018; pp. 663–692. [Google Scholar] [CrossRef]
- Gress, J.C.; Smith, S.; Tzanetakis, I.E. First report of Citrus leaf blotch virus in peony in the USA. Plant Dis. 2017, 101, 637. [Google Scholar] [CrossRef]
- Jia, A.; Yan, C.; Yin, H.; Sun, R.; Xia, F.; Gao, L.; Zhang, Y.; Li, Y. Small RNA and transcriptome sequencing of a symptomatic peony plant reveals mixed infections with novel viruses. Plant Dis. 2021, 105, 3816–3828. [Google Scholar] [CrossRef] [PubMed]
- Lim, S.; Kwon, S.Y.; Lee, J.H.; Cho, H.S.; Kim, H.S.; Park, J.M.; Lee, S.H.; Moon, J.S. Genomic detection and molecular characterization of two distinct isolates of cycas necrotic stunt virus from Paeonia suffruticosa and Daphne odora. Virus Genes 2019, 55, 734–737. [Google Scholar] [CrossRef] [PubMed]
- Robertson, N.L.; Brown, K.L.; Winton, L.M.; Holloway, P.S. First report of Tobacco rattle virus in Peony in Alaska. Plant Dis. 2009, 93, 675. [Google Scholar] [CrossRef]
- Shaffer, C.; Gress, J.C.; Tzanetakis, I. First report of cycas necrotic stunt virus and lychnis mottle virus in peony in the United States. Plant Dis. 2019, 103, 1048. [Google Scholar] [CrossRef]
- Shaffer, C.; Vakić, M.; Tzanetakis, I.E. First report of amazon lily mild mottle virus in peony in the United States. Plant Dis. 2021, 105, 236. [Google Scholar] [CrossRef]
- Shaffer, C.M.; Michener, D.C.; Vlasava, N.B.; Chotkowski, H.; Botermans, M.; Starre, J.; Tzanetakis, I.E. First report of gentian Kobu-sho-associated virus infecting peony in the United States and the Netherlands. Plant Dis. 2022, 106, 1311. [Google Scholar] [CrossRef]
- Tang, J.; Ward, L.; Delmiglio, C. Occurrence of cycas necrotic stunt virus in Paeonia lactiflora in New Zealand. Plant Dis. 2020, 104, 1567. [Google Scholar] [CrossRef]
- Yoon, J.Y.; Soeng, C.; Ju, H.J.; Cho, I.S.; Chung, B.N. First report of cycas necrotic stunt virus in a hybrid peony in South Korea. J. Plant Pathol. 2024, 106, 761–762. [Google Scholar] [CrossRef]
- Pearson, M.N.; Clover, G.R.G.; Guy, P.L.; Fletcher, J.D.; Beever, R.E. A review of the plant virus, viroid and mollicute records for New Zealand. Australas. Plant Pathol. 2006, 35, 217–252. [Google Scholar] [CrossRef]
- Chang, M.U.; Doi, Y.; Yora, K. A rod-shaped virus found in the peony ringspot. Jpn. J. Phytopathol. 1976, 42, 325–328. [Google Scholar] [CrossRef]
- Crosslin, J.M.; Hamm, P.B.; Kirk, W.W.; Hammond, R.W. Complete genomic sequence of a Tobacco rattle virus isolate from Michigan-grown potatoes. Arch. Virol. 2010, 155, 621–625. [Google Scholar] [CrossRef] [PubMed]
- Pearson, M.N.; Cohen, D.; Cowell, S.J.; Jones, D.; Blouin, A.; Lebas, B.S.M.; Shiller, J.B.; Clover, G.R.G. A survey of viruses of flower bulbs in New Zealand. Australas. Plant Pathol. 2009, 38, 305–309. [Google Scholar] [CrossRef]
- Harrison, B.D.; Robinson, D.J. Tobraviruses. In The Plant Viruses: The Rod-Shaped Plant Viruses; Springer: Boston, MA, USA, 1986; pp. 339–369. [Google Scholar] [CrossRef]
- Robinson, D.J.; Mayo, M.A.; Fritsch, C.; Jones, A.T.; Raschke, J.H. Origin and messenger activity of two small RNA species found in particles of tobacco rattle virus strain SYM. J. Gen. Virol. 1983, 64, 1591–1599. [Google Scholar] [CrossRef]
- Macfarlane, S.A. Molecular determinants of the transmission of plant viruses by nematodes. Mol. Plant Pathol. 2003, 4, 211–215. [Google Scholar] [CrossRef] [PubMed]
- Koenig, R.; Hilbrich, I.; Lindner, K. Molecular characterization of a new tobacco rattle virus (TRV) RNA2 and identification of different TRV RNA1/RNA2 pairings in various potato-growing areas in Germany. Arch. Virol. 2016, 161, 693–697. [Google Scholar] [CrossRef] [PubMed]
- Owen, W.G.; Byrne, J.; Warner, F. Tobacco Rattle Virus in Peony. Floral Dayly, e-GRO Alert. 2017. Available online: http://www.floraldaily.com/article/9010267/tobacco-rattle-virus-in-peony/ (accessed on 26 April 2024).
- Hanada, K.; Kusunoki, M.; Iwaki, M. Properties of virus particles, nucleic acid and coat protein of cycas necrotic stunt virus. Jpn. J. Phytopathol. 1986, 52, 422–427. [Google Scholar] [CrossRef]
- Han, S.S.; Karasev, A.V.; Ieki, H.; Iwanami, T. Nucleotide sequence and taxonomy of Cycas necrotic stunt virus: Brief Report. Arch. Virol. 2002, 147, 2207–2214. [Google Scholar] [CrossRef] [PubMed]
- Kusunoki, M.; Hanada, K.; Iwaki, M.; Chang, M.U.; Doi, Y.; Yora, K. Cycas necrotic stunt virus, a new member of nepoviruses found in Cycas revoluta host range, purification, serology and some other properties. Jpn. J. Phytopathol. 1986, 52, 302–311. [Google Scholar] [CrossRef]
- Ochoa-Corona, F.M.; Elliot, D.R.; Tang, Z.; Lebas, B.S.M.; Alexander, B.J.R. Detection of Cycas necrotic stunt virus (CNSV) in post-entry quarantine stocks of ornamentals in New Zealand. Phytopathology 2003, 93, S67. [Google Scholar]
- Hanada, K.; Fukumoto, F.; Kusunoki, M.; Kameya-Iwaki, M.; Tanaka, Y.; Iwanami, T. Cycas necrotic stunt virus isolated from gladiolus plants in Japan. J. Gen. Plant Pathol. 2006, 72, 383–386. [Google Scholar] [CrossRef]
- Igori, D.; Lee, H.K.; Yang, H.J.; Lee, D.S.; Kim, S.Y.; Kwon, B.; Oh, J.; Kim, T.D.; An, C.A.; Moon, J.S.; et al. First report of the cycas necrotic stunt virus infecting Cnidium officinale in South Korea. Plant Dis. 2020, 104, 3275. [Google Scholar] [CrossRef]
- Lee, B.Y.; Ryu, K.H. Identification and molecular detection of Cycas necrotic stunt virus from Daphne odora plants in Korea. Hortic. Environ. Biotechnol. 2006, 47, 75–79. [Google Scholar]
- Wylie, S.J.; Luo, H.; Li, H.; Jones, M.G. Multiple polyadenylated RNA viruses detected in pooled cultivated and wild plant samples. Arch. Virol. 2012, 157, 271–284. [Google Scholar] [CrossRef]
- Shaffer, C.; Michener, D.; Vlasava, N.B.; Tzanetakis, I.E. Perennial ornamental enables virus spread across the United States. Phytopathology 2018, 108, 8–9. [Google Scholar] [CrossRef] [PubMed]
- Alcaide, C.; Rabadán, M.P.; Moreno-Perez, M.G.; Gómez, P. Implications of mixed viral infections on plant disease ecology and evolution. Adv. Vir. Res. 2020, 106, 145–169. [Google Scholar] [CrossRef] [PubMed]
- Sallinen, S.; Norberg, A.; Susi, H.; Laine, A.L. Intraspecific host variation plays a key role in virus community assembly. Nat. Commun. 2020, 11, 5610. [Google Scholar] [CrossRef] [PubMed]
- Susi, H.; Barrès, B.; Vale, P.F.; Laine, A.L. Co-infection alters population dynamics of infectious disease. Nat. Commun. 2015, 6, 5975. [Google Scholar] [CrossRef] [PubMed]
- Singhal, P.; Nabi, S.U.; Yadav, M.K.; Dubey, A. Mixed infection of plant viruses: Diagnostics, interactions and impact on host. J. Plant Dis. Prot. 2021, 128, 353–368. [Google Scholar] [CrossRef]
- Wei, T.; Clover, G. Use of primers with 5′ non-complementary sequences in RT-PCR for the detection of nepovirus subgroups A and B. J. Virol. Methods 2008, 153, 16–21. [Google Scholar] [CrossRef]
- Larkin, M.A.; Blackshields, G.; Brown, N.P.; Chenna, R.; McGettigan, P.A.; McWilliam, H.; Valentin, F.; Wallace, I.M.; Wilm, A.; Lopez, R.; et al. Clustal W and Clustal X version 2.0. Bioinformatics 2007, 23, 2947–2948. [Google Scholar] [CrossRef] [PubMed]
- Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular evolutionary genetics analysis across computing platforms. Mol. Biol. Evol. 2018, 35, 1547. [Google Scholar] [CrossRef] [PubMed]
- Felsenstein, J. Confidence limits on phylogenies: An approach using the bootstrap. Evolution 1985, 39, 783–791. [Google Scholar] [CrossRef] [PubMed]
- Fraser, R.S.S.; Loughlin, S.A.R. Resistance to tobacco mosaic virus in tomato: Effects of the Tm-1 gene on virus multiplication. J. Gen. Virol. 1980, 48, 87–96. [Google Scholar] [CrossRef]
- Fisher, J.R. Identification of two Tobacco rattle virus variants associated with line pattern disease of bleeding heart in Ohio. Plant Health Prog. 2013, 14, 26. [Google Scholar] [CrossRef]
- Tamura, K.; Nei, M. Estimation of the number of nucleotide substitutions in the control region of mitochondrial DNA in humans and chimpanzees. Mol. Biol. Evol. 1993, 10, 512–526. [Google Scholar] [CrossRef] [PubMed]
- He, Z.; Chen, C. First report of tobacco rattle virus infecting Chinese herbaceous peony (Paeonia lactiflora Pall.) in China. Plant Dis. 2016, 100, 2543. [Google Scholar] [CrossRef]
- Shaffer, C.M.; Michener, D.C.; Vlasava, N.B.; Chotkowski, H.; Tzanetakis, I.E. Population genetics of cycas necrotic stunt virus and the development of multiplex RT-PCR diagnostics. Vir. Res. 2022, 309, 198655. [Google Scholar] [CrossRef]
- Koenig, R.; Lesemann, D.E.; Pfeilstetter, E.; Winter, S.; Pleij, C.W.A. Deletions and recombinations with the RNA1 3′ ends of different tobraviruses have created a multitude of Tobacco rattle virus TCM-related RNA2 species in Alstroemeria and tulip. J. Gen. Virol. 2011, 92, 988–996. [Google Scholar] [CrossRef] [PubMed]
- Sol, H.H.; Van Heuven, J.C.; Sein-horst, J.W. Transmission of rattle virus and Atropa belladonna mosaic virus by nematodes. Tijdschr. Over Plantenziekten 1960, 66, 228–231. [Google Scholar]
- Otulak, K.; Chouda, M.; Chrzanowska, M.; Garbaczewska, G. Ultrastructural effects of infection caused by Tobacco rattle virus transmitted by Trichodorus primitivus in potato and tobacco tissues. Can. J. Plant. Pathol. 2012, 34, 126–138. [Google Scholar] [CrossRef]
- Lee, B.Y.; Ryu, K.H. Incidence of virus diseases and RT-PCR detection of Daphne-infecting viruses in Korea. Eur. J. Plant Pathol. 2009, 124, 127–132. [Google Scholar] [CrossRef]
- Pagán, I.; García-Arenal, F. Population genomics of plant viruses. In Population Genomics: Microorganisms; Polz, M., Rajora, O., Eds.; Springer: Cham, Switzerland, 2019; pp. 233–265. [Google Scholar] [CrossRef]
- Helliot, B.; Panis, B.; Poumay, Y.; Swennen, R.; Lepoivre, P.; Frison, E. Cryopreservation for the elimination of cucumber mosaic and banana streak viruses from banana (Musa spp.). Plant Cell Rep. 2002, 20, 1117–1122. [Google Scholar] [CrossRef]
- Reed, B.M.; Engelmann, F.; Dulloo, M.E.; Engels, J.M.M. Technical guidelines for the management of field and in vitro germplasm collections. In IPGRI Handbooks for Genebanks No. 7; Bioversity International, IPGRI/SGRP: Rome, Italy, 2004; 116p. [Google Scholar]
- Wang, M.R.; Cui, Z.H.; Li, J.W.; Hao, X.Y.; Zhao, L.; Wang, Q.C. In vitro thermotherapy-based methods for plant virus eradication. Plant Methods 2018, 14, 87. [Google Scholar] [CrossRef] [PubMed]
- Wang, M.R.; Lambardi, M.; Engelmann, F.; Pathirana, R.; Panis, B.; Volk, G.M.; Wang, Q.C. Advances in cryopreservation of in vitro-derived propagules: Technologies and explant sources. Plant Cell Tiss. Organ. Cult. 2021, 144, 7–20. [Google Scholar] [CrossRef]
- Gisbert, C.; Peiró, R.; San Pedro, T.; Olmos, A.; Jiménez, C.; García, J. Recovering Ancient Grapevine Varieties: From Genetic Variability to In Vitro Conservation, A Case Study. In Grapes and Wines-Advances in Production, Processing, Analysis and Valorization; Jordão, A.M., Cosme, F., Eds.; InTech: Rijeka, Croatia, 2018; pp. 3–21. ISBN 978-953-51-3834-1. [Google Scholar]
- Hosoki, T.; Ando, M.; Kubara, T.; Hamada, M.; Itami, M. In vitro propagation of herbaceous peony (Paeonia lactiflora Pall.) by a longitudinal shoot-split method. Plant Cell Rep. 1989, 8, 243–246. [Google Scholar] [CrossRef] [PubMed]
- Shen, M.; Wang, Q.; Yu, X.; da Silva, J.A.T. Micropropagation of herbaceous peony (Paeonia lactiflora Pall.). Sci. Hortic. 2012, 148, 30–38. [Google Scholar] [CrossRef]
- Tian, D.; Tilt, K.M.; Dane, F.; Woods, F.M.; Sibley, J.L. Comparison of shoot induction ability of different explants in herbaceous peony (Paeonia lactiflora Pall.). Sci. Hortic. 2010, 123, 385–389. [Google Scholar] [CrossRef]
- Cazan, G.N.; Toma, F. Study on results obtained by different researchers on in vitro propagation of herbaceous peony. Sci. Pap. Ser. B Hortic. 2017, 61, 369–376. [Google Scholar]
- Rather, Z.A.; Nazki, I.T.; Qadri, Z.A.; Mir, M.A.; Bhat, K.M.; Hussain, G. In vitro propagation of herbaceous peony (Paeonia lactiflora Pall.) cv. Sara Bernhardt using shoot tips. Indian. J. Hortic. 2014, 71, 385–389. [Google Scholar]
- Verevchik, A.A. Creating In Vitro Collections of Plants of Paeonia L. Genus with the Goal of Preserving and Reproducing Valuable Genotypes. Bachelor’s Thesis, Belarusian State University, Faculty of Biology, Minsk, Belarus, 2017. [Google Scholar]
- Pyke, G.H.; Ehrlich, P.R. Biological collections and ecological/environmental research: A review, some observations and a look to the future. Biol. Rev. Camb. Philos. Soc. 2010, 85, 247–266. [Google Scholar] [CrossRef] [PubMed]
Virus (Abbreviation) | Primer Name, Sequence (5′-3′), and Reference | Genomic Region | Annealing T (°C) in This Study | Amplicon Size (bp) | PCR Conditions |
---|---|---|---|---|---|
Tobacco Rattle Virus (TRV) | TRVF683 (forward) 5′GCTATTGGTGATCAAGCTAGAAG3′ and TRVR1439 5′GCHGCCCCGTTWATGAAYARGAC3′ (reverse) [14] | 194 K RNA polymerase gene | 52 | 779 | In total, 25 μL reaction (0.5 units of Platinum Taq DNA polymerase (Invitrogen, Carlsbad, CA, USA), 2.5 mM MgCl2, 0.2 mM dNTP mix, 0.2 μM of each primer, and 1 μL of cDNA). The cycling conditions: 94 °C (2 min), 30 cycles of 94 °C (45 s), 52 °C (30 s), 72 °C (60 s), and a final extension 72 °C (10 min) |
Cycas Necrotic Stunt Virus (CNSV) | TRVF683 (forward) 5′GCTATTGGTGATCAAGCTAGAAG-3′ and TRVR1439 5′GCHGCCCCGTTWATGAAYARGAC3′ (reverse) [14] | polyprotein 1 gene, partial | 52 | ~450 | As above |
Cycas Necrotic Stunt Virus (CNSV) | NepoPl_F 5′CTATTCTTCTTGGGCAAATGGGGTG3′ andNepoPl_R 5′GACCTGACTCCACTGCATTTCATTATG3′ [This study] | 4349–4730 nt region of CNSV polyprotein 1 | 52 | 380 | In total, 25 μL reaction (0.5 units of Platinum Taq DNA polymerase (Invitrogen, Carlsbad, CA, USA), 1.5 mM MgCl2, 0.2 mM dNTP mix, 0.2 μM of each primer, and 2 μL of cDNA). The cycling conditions: 94 °C (2 min), 30 cycles of 94 °C (30 s), 52 °C (30 s), 72 °C (60 s), and a final extension 72 °C (10 min) |
Cycas Necrotic Stunt Virus (CNSV) | NepoB-F (forward) 5′TCTGGITTTGCYTTRACRGT3′ NepoB-R (reverse) 5′CTTRTCACTVCCATCRGTAA3′ [47] | RdRp gene | 50 | 250 | In total, 25 μL reaction (0.5 units of Platinum Taq DNA polymerase (Invitrogen, Carlsbad, CA, USA), 1.5 mM MgCl2, 0.2 mM dNTP mix, 0.2 μM of each primer, and 2 μL of cDNA). The cycling conditions: 94 °C (5 min), 35 cycles of 94 °C (30 s), 50 °C (30 s), 65 °C (2 min), and a final extension 72 °C (5 min) |
Cycas Necrotic Stunt Virus (CNSV) | NepoA-F 5′ACDTCWGARGGITAYCC3′ (forward) NepoA-R 5′RATDCCYACYTGRCWIGGCA3′ (reverse) [47] | RdRp gene | 50 | 340 | In total, 25 μL reaction (0.5 units of Platinum Taq DNA polymerase (Invitrogen, Carlsbad, CA, USA), 1.5 mM MgCl2, 0.2 mM dNTP mix, 0.2 μM of each primer, 2 μL of cDNA). The cycling conditions: 94 °C (2 min), 35 cycles of 94 °C (30 s), 50 °C (30 s), 69 °C (2 min), and a final extension 72 °C (5 min) |
Name of Cultivar | Abbreviation a | UMNA Peony Collection Plant Accession Number | 194 K RNA Polymerase Gene, 779 bp (TRV) | 16 kDa Putative RNA Silencing Suppressor (TRV b) | Polyprotein 1 Gene, Partial, ~450 bp (CNSV c) | 4349–4730 nt Region of CNSV Polyprotein 1, 380 bp (CNSV) | RdRp Gene, Subgroup B, 250 bp (CNSV) | RdRp Gene, Subgroup A, 340 bp (CNSV) | TRV Visual Symptoms (Severity, 0–5) d |
---|---|---|---|---|---|---|---|---|---|
Duchess of Portland | DP1-2015 | MBGNA-P-0147 | − | − | na | + | + | − | 0 |
Duchess of Portland | DP2-2015 | MBGNA-P-0148 | + | + | na | − | − | − | 1 |
Gisele | Gis1-2015 | MBGNA-P-0231 | − | − | na | − | − | − | 0 |
Gisele | Gis2-2015 | MBGNA-P-0232 | + | + | + | + | + | − | 2 |
Gisele | Gis1-2016 | MBGNA-P-0231 | − | − | na | + | + | − | 0 |
Gisele | Gis2-2016 | MBGNA-P-0232 | + | + | na | + | + | − | 3 |
Yeso | Y1-2016 | MBGNA-P-0710 | + | + | na | + | + | − | 4 |
Yeso | Y2-2016 | MBGNA-P-0711 | + | + | na | + | + | − | 4 |
Gigantea | G1-2016 | MBGNA-P-0227 | + | + | na | + | + | − | 3 |
Gigantea | G2-2016 | MBGNA-P-0228 | + | + | na | − | − | − | 1 |
Jeannot | J1-2016 | MBGNA-P-0289 | − | − | na | + | + | − | 0 |
Isoline | I1-2016 | MBGNA-P-0272 | − | − | na | + | + | − | 0 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Vlasava, N.B.; Michener, D.C.; Kharytonchyk, S.; Cortés-Ortiz, L. Co-Infection of Tobacco Rattle and Cycas Necrotic Stunt Viruses in Paeonia lactiflora: Detection Strategies, Potential Origins of Infection, and Implications for Paeonia Germplasm Conservation. Viruses 2024, 16, 893. https://doi.org/10.3390/v16060893
Vlasava NB, Michener DC, Kharytonchyk S, Cortés-Ortiz L. Co-Infection of Tobacco Rattle and Cycas Necrotic Stunt Viruses in Paeonia lactiflora: Detection Strategies, Potential Origins of Infection, and Implications for Paeonia Germplasm Conservation. Viruses. 2024; 16(6):893. https://doi.org/10.3390/v16060893
Chicago/Turabian StyleVlasava, Nastassia B., David C. Michener, Siarhei Kharytonchyk, and Liliana Cortés-Ortiz. 2024. "Co-Infection of Tobacco Rattle and Cycas Necrotic Stunt Viruses in Paeonia lactiflora: Detection Strategies, Potential Origins of Infection, and Implications for Paeonia Germplasm Conservation" Viruses 16, no. 6: 893. https://doi.org/10.3390/v16060893