Melatonin Improves Heat Tolerance in Kiwifruit Seedlings through Promoting Antioxidant Enzymatic Activity and Glutathione S-Transferase Transcription
Abstract
1. Introduction
2. Results
2.1. Seedling Morphology, H2O2 and Proline Content in Heat-Stressed Kiwifruit
2.2. POD, CAT, and SOD Activities under Heat Stress
2.3. Ascorbic Acid Content and AsA-GSH-Cycle Enzymatic Activity under Heat Stress
2.4. Expression Profile of GST under Heat Stress
3. Discussion
4. Materials and Methods
4.1. Plant Materials and Treatment
4.2. Assays of H2O2 Content and Antioxidant Enzyme Activity
4.3. Extraction and Assay of AsA Content and AsA-GSH Cycle Enzymes
4.4. Quantitative Real-Time PCR for Profiling GST Expression
4.5. Expression Analysis of GST Genes Based on Transcriptome Data
Acknowledgments
Author Contributions
Conflicts of Interest
References
- Rodriguez, V.M.; Soengas, P.; Alonso-Villaverde, V.; Sotelo, T.; Cartea, M.E.; Velasco, M.P. Effect of temperature stress on the early vegetative development of Brassica oleracea L. BMC Plant Biol. 2015, 15, 145. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shah, F.; Huang, J.; Cui, K.; Nie, L.; Shah, T.; Chen, C.; Wang, K. Impact of high temperature stress on rice plant and its traits related to tolerance. J. Agric. Sci. 2011, 149, 545–556. [Google Scholar] [CrossRef] [Scilit]
- Vasseur, F.; Pantin, F.; Vile, D. Changes in light intensity reveal a major role for carbon balance in Arabidopsis responses to high temperature. Plant Cell Environ. 2011, 34, 1563–1576. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mishkind, M.; Vermeer, J.E.; Darwish, E.; Munnik, T. Heat stress activates phospholipase D and triggers PIP accumulation at the plasma membrane and nucleus. Plant J. 2009, 60, 10–21. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Narayanan, S.; Tamura, P.J.; Roth, M.R.; Prasad, P.V.; Welti, R. Wheat leaf lipids during heat stress, high day and night temperatures result in major lipid alterations. Plant Cell Environ. 2016, 39, 787–803. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mittler, R.; Vanderauwera, S.; Suzuki, N.; Miller, G.; Tognetti, V.B.; Vandepoele, K.; Gollery, M.; Shulaev, V.; Van Breusegem, F. ROS signaling, the new wave? Trends Plant Sci. 2011, 16, 300–309. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Allakhverdiev, S.I.; Kreslavski, V.D.; Klimov, V.V.; Los, D.A.; Carpentier, R.; Mohanty, P. Heat stress, an overview of molecular responses in photosynthesis. Photosynth. Res. 2008, 98, 541–550. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hasanuzzaman, M.; Nahar, K.; Alam, M.M.; Roychowdhury, R.; Fujita, M. Physiological, biochemical, and molecular mechanisms of heat stress tolerance in plants. Int. J. Mol. Sci. 2013, 14, 9643–9684. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dixon, D.P.; Davis, B.G.; Edwards, R. Functional divergence in the glutathione transferase superfamily in plants. Identification of two classes with putative functions in redox homeostasis in Arabidopsis thaliana. J. Biol. Chem. 2002, 277, 30859–30869. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Moons, A. Regulatory and Functional Interactions of Plant Growth Regulators and Plant Glutathione S-Transferases (GSTs). Vitam. Horm. 2005, 72, 155–202. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Arnao, M.B.; Hernández-Ruiz, J. Functions of melatonin in plants, a review. J. Pineal Res. 2015, 59, 133–150. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fan, J.; Hu, Z.; Xie, Y.; Chan, Z.; Chen, Z.; Amombo, E.; Chen, L.; Fu, J. Alleviation of cold damage to photosystem II and metabolisms by melatonin in Bermudagrass. Front. Plant Sci. 2015, 6, 925. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, J.; Shi, Y.; Zhang, X.Z.; Du, H.M.; Bin, X.; Bingru, H. Melatonin suppression of heat-induced leaf senescence involves changes in abscisic acid and cytokinin biosynthesis and signaling pathways in perennial ryegrass (Lolium perenne, L.). Environ. Exp. Bot. 2017, 138, 36–54. [Google Scholar] [CrossRef] [Scilit]
- Tiryaki, I.; Keles, H. Reversal of the inhibitory effect of light and high temperature on germination of Phacelia tanacetifolia seeds by melatonin. J. Pineal Res. 2012, 52, 332–339. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Marta, B.; Szafrańska, K.; Posmyk, M.M. Exogenous melatonin improves antioxidant defense in cucumber seeds (Cucumis sativus L.) germinated under chilling stress. Front. Plant Sci. 2016, 7, 575. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Korkmaz, A.; Karaca, A.; Kocaçinar, F.; Cuci, Y. The effects of seed treatment with melatonin on germination and emergence performance of pepper seeds under chilling stress. Tarim Bilimleri Dergisi J. Agric. Sci. 2017, 23, 167–176. [Google Scholar]
- Zhang, R.; Sun, Y.; Liu, Z.; Jin, W.; Sun, Y. Effects of melatonin on seedling growth, mineral nutrition, and nitrogen metabolism in cucumber under nitrate stress. J. Pineal Res. 2017, 62. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Arnao, M.B.; Hernández-Ruiz, J. Melatonin promotes adventitious- and lateral root regeneration in etiolated hypocotyls of Lupinus albus L. J. Pineal Res. 2007, 42, 147–152. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Laing, W.A. Temperature and light response curves for photosynthesis in kiwifruit (Actinidia chinensis) cv. Hayward. N. Z. J. Agric. Res. 1985, 28, 117–124. [Google Scholar] [CrossRef] [Scilit]
- Richardson, A.C.; Marsh, K.B.; Boldingh, H.L.; Pickering, A.H.; Bulley, S.M.; Frearson, N.J.; Ferguson, A.R.; Thornber, S.E.; Bolitho, K.M.; Macrae, E.A. High growing temperatures reduce fruit carbohydrate and vitamin C in kiwifruit. Plant Cell Environ. 2004, 27, 423–435. [Google Scholar] [CrossRef] [Scilit]
- Greer, D.H.; Laing, W.A.; Kipnis, T. Photoinhibition of photosynthesis in intact kiwifruit (Actinidia deliciosa) leaves, Effect of temperature. Planta 1988, 174, 152–158. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Luo, H.T.; Zhang, J.Y.; Wang, G. Functional characterization of waterlogging and heat stresses tolerance gene Pyruvate decarboxylase 2 from Actinidia deliciosa. Int. J. Mol. Sci. 2017, 18, 2377. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, H.; He, J.; Yang, X.; Li, X.; Luo, D.; Wei, C.; Ma, J.; Zhang, Y.; Yang, J.; Zhang, X. Glutathione-dependent induction of local and systemic defense against oxidative stress by exogenous melatonin in cucumber (Cucumis sativus L.). J. Pineal Res. 2016, 60, 206–216. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pieri, C.; Marra, M.; Moroni, F.; Recchioni, R.; Marcheselli, F. Melatonin, A peroxyl radical scavenger more effective than vitamin E. Life Sci. 1994, 55, 271–276. [Google Scholar] [CrossRef] [Scilit]
- Tan, D.X.; Chen, L.D.; Poeggeler, B.; Manchester, L.D.; Reiter, R.J. Melatonin, a potent, endogenous hydroxyl radical scavenger. Endocr. J. 1993, 1, 57–60. [Google Scholar]
- Tan, D.X.; Poeggeler, B.; Reiter, R.J. The pineal hormone melatonin inhibits DNA adduct formation induced by the chemical carcinogen safrole in vivo. Cancer Lett. 1993, 70, 65–71. [Google Scholar] [CrossRef] [Scilit]
- Shi, H.; Wang, X.; Tan, D.X.; Reiter, R.J.; Chan, Z. Comparative physiological and proteomic analyses reveal the actions of melatonin in the reduction of oxidative stress in Bermuda grass (Cynodon dactylon (L). Pers.). J. Pineal Res. 2015, 59, 120–131. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, C.; Tan, D.X.; Liang, D.; Chang, C.; Jia, D.F.; Ma, F.W. Melatonin mediates the regulation of ABA metabolism, free-radical scavenging, and stomatal behaviour in two malus species under drought stress. J. Exp. Bot. 2015, 66, 669–680. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhao, H.; Ye, L.; Wang, Y.; Zhou, X.T.; Yang, J.W.; Wang, J.W.; Cao, K.; Zou, Z. Melatonin Increases the Chilling Tolerance of Chloroplast in Cucumber Seedlings by regulating photosynthetic electron flux and the ascorbate-glutathione cycle. Front. Plant Sci. 2016, 7, 1814. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Srinivasa-Rao, N.K.; Shivashankara, K.S.; Laxman, R.H. Abiotic Stress Physiology of Horticultural Crops; Springer: Berlin/Heidelberg, Germany, 2016. [Google Scholar]
- Mittler, R. Oxidative stress, antioxidants and stress tolerance. Trends Plant Sci. 2002, 7, 405–410. [Google Scholar] [CrossRef] [Scilit]
- Li, X.; Wei, J.P.; Scott, E.R.; Liu, J.W.; Guo, S.; Li, Y.; Zhang, L.; Han, W.Y. Exogenous Melatonin Alleviates Cold Stress by Promoting Antioxidant Defense and Redox Homeostasis in Camellia sinensis L. Molecules 2018, 23, 165. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, X.N.; Brestic, M.; Tan, D.X.; Zivcak, M.; Zhu, X.C.; Liu, S.Q.; Song, F.B.; Reiter, R.J.; Liu, F.L. Melatonin alleviates low PS I-limited carbon assimilation under elevated CO2 and enhances the cold tolerance of offspring in chlorophyll b-deficient mutant wheat. J. Pineal Res. 2018, 64, e12453. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, C.; Wen, D.; Sun, A.; Han, X.Y.; Zhang, J.B.; Wang, Z.J.; Yin, Y.P. Differential activity and expression of antioxidant enzymes and alteration in osmolyte accumulation under high temperature stress in wheat seedlings. J. Cereal Sci. 2014, 60, 653–659. [Google Scholar] [CrossRef] [Scilit]
- Ahmed, J.U.; Hassan, M.A. Evaluation of seedling proline content of wheat genotypes in relation to heat tolerance. Bangladesh J. Bot. 2011, 40, 17–22. [Google Scholar] [CrossRef] [Scilit]
- Boggess, S.F.; Stewart, C.R. The relationship between water stress induced proline accumulation and inhibition of protein synthesis in tobacco leaves. Plant Sci. Lett. 1980, 17, 245–252. [Google Scholar] [CrossRef] [Scilit]
- Sarropoulou, V.; Dimassi-Theriou, K.; Therios, L.; Koukourekou-Petridou, M. Melatonin enhances root regeneration, photosynthetic pigments, biomass, total carbohydrates and proline content in the cherry rootstock PHL-C (Prunus avium × Prunus cerasus). Plant Physiol. Biochem. 2012, 61, 162–168. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ding, F.; Liu, B.; Zhang, S. Exogenous melatonin ameliorates cold-induced damage in tomato plants. Sci. Hortic. 2017, 219, 264–271. [Google Scholar] [CrossRef] [Scilit]
- Turk, H.; Erdal, S.; Genisel, M.; Atici, O.; Demir, Y.; Yanmis, D. The regulatory effect of melatonin on physiological, biochemical and molecular parameters in cold-stressed wheat seedlings. Plant Growth Regul. 2014, 74, 139–152. [Google Scholar] [CrossRef] [Scilit]
- Meng, J.F.; Xu, T.F.; Wang, Z.Z.; Fang, Y.L.; Xi, Z.M.; Zhang, Z.W. The ameliorative effects of exogenous melatonin on grape cuttings under water-deficient stress: Antioxidant metabolites, leaf anatomy, and chloroplast morphology. J. Pineal Res. 2014, 57, 200–212. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Noctor, G.; Foyer, C.H. Ascorbate and glutathione, keeping active oxygen under control. Annu. Rev. Plant Physiol. Plant Mol. Biol. 1998, 49, 249–279. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bonnefont-Rousselot, D.; Collin, F.; Jore, D.; Gardèsalbert, M. Reaction mechanism of melatonin oxidation by reactive oxygen species in vitro. J. Pineal Res. 2011, 50, 328–335. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Karam, E.A.; Maresca, V.; Sorbo, S.; Keramat, B.; Basile, A. Effects of triacontanol on ascorbate-glutathione cycle in Brassica napus L. exposed to cadmium-induced oxidative stress. Ecotoxicol. Environ. Saf. 2017, 144, 268–274. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dixon, D.P.; Adrian, L.; Robert, E. Plant glutathione transferases. Genome Biol. 2005, 401, 169–186. [Google Scholar]
- Fujita, M.; Hossain, M.Z. Modulation of pumpkin glutathione S-transferases by aldehydes and related compounds. Plant Cell Physiol. 2003, 44, 481–490. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dean, J.D.; Goodwin, P.H.; Hsiang, T. Induction of glutathione S-transferase genes of nicotiana benthamiana following infection by colletotrichum destructivum and C. orbiculare and involvement of one in resistance. J. Exp. Bot. 2005, 56, 1525–1533. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gong, H.; Jiao, Y.; Hu, W.W.; Pua, E.C. Expression of glutathione-S-transferase and its role in plant growth and development in vivo and shoot morphogenesis in vitro. Plant Mol. Biol. 2005, 57, 53–66. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kunieda, T.; Fujiwara, T.; Amano, T.; Shioi, Y. Molecular Cloning and characterization of a senescence-induced Tau-class glutathione S-transferase from barley leaves. Plant Cell Physiol. 2005, 46, 1540–1548. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Urbanek, H.; Majorowicz, H.; Zalewski, M.; Saniewski, M. Induction of glutathione S-transferase and glutathione by toxic compounds and elicitors in reed canary grass. Biotechnol. Lett. 2005, 27, 911–914. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wagner, U.; Edwards, R.; Dixon, D.P.; Mauch, F. Probing the diversity of the Arabidopsis glutathione S-transferase gene family. Plant Mol. Biol. 2002, 49, 515–532. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Le, M.B.; Poage, M.; Shiel, K.; Nugent, G.D.; Dix, P.J. Tobacco chloroplast transformants expressing genes encoding dehydroascorbate reductase, glutathione reductase, and glutathione-S-transferase, exhibit altered anti-oxidant metabolism and improved abiotic stress tolerance. Plant Biotechnol. J. 2011, 9, 661–673. [Google Scholar] [CrossRef] [Scilit]
- Xu, J.; Tian, Y.S.; Xing, X.J.; Peng, R.H.; Zhu, B.; Gao, J.J.; Yao, Q.H. Over-expression of AtGSTU19 provides tolerance to salt, drought and methyl viologen stresses in Arabidopsis. Physiol. Plant. 2015. [Google Scholar] [CrossRef] [Scilit]
- Anwar, M.M.; Meki, A.R. Oxidative stress in streptozotocin-induced diabetic rats: Effects of garlic oil and melatonin. Comp. Biochem. Physiol. Part A Mol. Integr. Physiol. 2003, 135, 539–547. [Google Scholar] [CrossRef] [Scilit]
- Reiter, R.J.; Tan, D.X. Melatonin: An antioxidant in edible plants. Ann. N. Y. Acad. Sci. USA 2002, 957, 341–344. [Google Scholar] [CrossRef] [Scilit]
- Sergiev, L.; Alexieva, V.; Karanova, E. Effect of spermine, atrazine and combination between them on some endogenous protective systems and stress markers in plants. C. R. Acad. Bulg. Sci. 1997, 51, 121–124. [Google Scholar]
- Bates, L.S.; Waldeen, R.P.; Teare, I.D. Rapid determination of free proline for water stress studies. Plant Soil 1973, 39, 205–207. [Google Scholar] [CrossRef] [Scilit]
- Giannopolitis, C.N.; Ries, S.K. Superoxide Dismutases, II. purification and quantitative relationship with water-soluble protein in seedlings. Plant Physiol. 1977, 59, 315–318. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Scebba, F.; Sebastiani, L.; Vitagliano, C. Activities of antioxidant enzymes during senescence of Prunus Armeniaca leaves. Biol. Plant. 2001, 44, 41–46. [Google Scholar] [CrossRef] [Scilit]
- Patra, H.K.; Kar, M.; Mishra, D. Catalase activity in leaves and cotyledons during plant development and senescence. Biochem. Physiol. Pflanz. 1978, 172, 385–390. [Google Scholar] [CrossRef] [Scilit]
- Kampfenkel, K.; Montagu, M.C.; Inzè, D. Extraction and determination of ascorbate and dehydroascorbate from plant tissue. Anal. Biochem. 1995, 225, 165–167. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nakano, Y.; Asada, K. Hydrogen peroxide is scavenged by ascorbate-specific peroxidase in spinach chloroplasts. Plant Cell Physiol. 1981, 22, 867–880. [Google Scholar] [CrossRef] [Scilit]
- Arrigoni, O.; Dipierro, S.; Borraccino, G. Ascorbate free radical reductase, a key enzyme of the ascorbic acid system. FEBS Lett. 1981, 125, 242–244. [Google Scholar] [CrossRef] [Scilit]
- Edwards, E.A.; Rawsthorne, S.; Mullineux, P.M. Subcellular distribution of multiple forms of glutathione reductase in leaves of pea (Pisum sativum L.). Planta 1990, 180, 278–284. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ferradás, Y.; Rey, L.; Troncoso, O.M.; Rey, M.; González, M.V. Identification and validation of reference genes for accurate normalization of real-time quantitative PCR data in kiwifruit. Plant Physiol. Biochem. 2016, 102, 27–36. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Benjamini, Y.; Hochberg, Y. Controlling the false discovery rate: A practical and 580 powerful approach to multiple testing. J. R. Stat. Soc. 1995, 57, 289–300. [Google Scholar] [CrossRef]
Sample Availability: Samples of the compounds are not available from the authors. |






| Gene Locus | Forward Primer | Reverse Primer |
|---|---|---|
| ACHN160841 | GGTGTTGATACATAACGGAAAG | TGGACAATGATGAGGGACT |
| Actin1 | GCAGGAATCCATGAGACTACC | GTCTGCGATACCAGGGAACAT |
© 2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Liang, D.; Gao, F.; Ni, Z.; Lin, L.; Deng, Q.; Tang, Y.; Wang, X.; Luo, X.; Xia, H. Melatonin Improves Heat Tolerance in Kiwifruit Seedlings through Promoting Antioxidant Enzymatic Activity and Glutathione S-Transferase Transcription. Molecules 2018, 23, 584. https://doi.org/10.3390/molecules23030584
Liang D, Gao F, Ni Z, Lin L, Deng Q, Tang Y, Wang X, Luo X, Xia H. Melatonin Improves Heat Tolerance in Kiwifruit Seedlings through Promoting Antioxidant Enzymatic Activity and Glutathione S-Transferase Transcription. Molecules. 2018; 23(3):584. https://doi.org/10.3390/molecules23030584
Chicago/Turabian StyleLiang, Dong, Fan Gao, Zhiyou Ni, Lijin Lin, Qunxian Deng, Yi Tang, Xun Wang, Xian Luo, and Hui Xia. 2018. "Melatonin Improves Heat Tolerance in Kiwifruit Seedlings through Promoting Antioxidant Enzymatic Activity and Glutathione S-Transferase Transcription" Molecules 23, no. 3: 584. https://doi.org/10.3390/molecules23030584
APA StyleLiang, D., Gao, F., Ni, Z., Lin, L., Deng, Q., Tang, Y., Wang, X., Luo, X., & Xia, H. (2018). Melatonin Improves Heat Tolerance in Kiwifruit Seedlings through Promoting Antioxidant Enzymatic Activity and Glutathione S-Transferase Transcription. Molecules, 23(3), 584. https://doi.org/10.3390/molecules23030584

