Next Article in Journal
All-Trans Retinoic Acid Treatment Is Associated with Prohibitin Expression in Renal Interstitial Fibrosis Rats
Previous Article in Journal
Genome-Wide Analysis of a TaLEA-Introduced Transgenic Populus simonii × Populus nigra Dwarf Mutant
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Isolation and Characterization of Polymorphic Microsatellite Loci from Metapenaeopsis barbata Using PCR-Based Isolation of Microsatellite Arrays (PIMA)

1
Department of Life Sciences, National Cheng Kung University, Tainan 701, Taiwan
2
Department of Leisure, Recreation and Tourism Management, Shu-Te University, Kaohsiung 824, Taiwan
3
The Affiliated School of National Tainan First Senior High School, Tainan 701, Taiwan
*
Author to whom correspondence should be addressed.
These authors contributed equally to this work.
Int. J. Mol. Sci. 2012, 13(3), 2763-2768; https://doi.org/10.3390/ijms13032763
Submission received: 19 January 2012 / Revised: 19 February 2012 / Accepted: 21 February 2012 / Published: 1 March 2012
(This article belongs to the Section Biochemistry)

Abstract

The red-spot prawn, Metapenaeopsis barbata, is a commercially important, widely distributed demersal species in the Indo-West Pacific Ocean. Overfishing has made its populations decline in the past decade. To study conservation genetics, eight polymorphic microsatellite loci were isolated. Genetic characteristics of the SSR (simple sequence repeat) fingerprints were estimated in 61 individuals from adjacent seas of Taiwan and China. The number of alleles, ranging from 2 to 4, as well as observed and expected heterozygosities in populations, ranging from 0.048 to 0.538, and 0.048 and 0.654, respectively, were detected. No deviation from Hardy–Weinberg expectations was detected at either locus. No significant linkage disequilibrium was detected in locus pairs. The polymorphic microsatellite loci will be useful for investigations of the genetic variation, population structure, and conservation genetics of this species.

1. Introduction

The red-spot prawn, Metapenaeopsis barbata, is a widely distributed demersal species in Indo-West Pacific from the Gulf of Bengal to Japan and Indonesia [13]. It is one of the abundant prawns with high commercial values [2,4]. It was overfished from 1995 to 1996 around Taiwan [5]. Furthermore, the populations of this species declined in the past decade likely due to the effective benthic trawling [6] and ecological destruction. The life history, morphometric variation and fishery biology of these shrimps have been well studied [2,5,710]. Recently, Chu [11,12] investigated the population structure and historical demography of the whiskered velvet shrimp using one intron of elongation factor-1α gene and the mitochondrial DNA control region. For practicing conservation and understanding the genetic structuring across populations, codominant and highly polymorphic molecular markers are desired. Highly polymorphic microsatellite DNAs have been widely used in many aquacultural species to evaluate the genetic diversity [13,14], construct genetic maps [15,16], and determine species’ lineages [17], as well as for conservation and management in shrimps [16]. In order to protect and manage these overexploited wild resources of M. barbata, molecular markers are urgently needed to develop suitable strategies to maintain sustainable populations

2. Results and Discussion

In total, 61 individuals of M. barbata, including 21 from Taichung, Taiwan and 40 from Fujian, China, were collected. Eight di-nucleotide SSR loci were isolated. The characteristics of the innovative microsatellite loci and variability measures across two populations are described in Table 1. The number of alleles per locus ranged from 2 to 4, with an average of 3.00 in Taichung and an average 3.25 in Fujian. The observed heterozygosities (HO) and expected heterozygosities (HE) ranged from 0.048 to 0.476 (averaged at 0.327) and ranged from 0.048 to 0.667 (averaged at 0.420), respectively, in Taichung; while the HO and HE ranged from 0.205 to 0.538 (average = 0.331) and from 0.283 to 0.654 (average = 0.392), respectively, in Fujian. No deviation from Hardy–Weinberg expectations was detected at either locus. There was no evidence of linkage disequilibrium between any pairs of loci. The locus-wise FIS for each population, shown in Table 2, was non-significant after Bonferroni correction [18], indicating heterozygote deficiency in all but one locus (MIMB03) in Fujian population. Microsatellite markers could be a good choice for the characterization of genetic diversity in M. barbata due to its reliable, informative, co-dominant nature and ease of exchange of data among different studies. The results suggest that the microsatellite DNA loci identified in this study are highly polymorphic, and that these markers can be useful for investigating the genetic structure and management of M. barbata populations.

3. Experimental Section

3.1. Isolation of Microsatellite Markers

In present study, we have developed eight polymorphic microsatellite markers that are specific for M. barbata. Genomic DNA was extracted from muscle tissues preserved in 95% ethanol by following standard phenol-chloroform procedure [19]. The enrichment of DNA fragments was carried out using the random amplified polymorphic DNA-polymerase chain reaction (RAPD-PCR) method [20] with a minor modification [21]. This PIMA (PCR isolation of microsatellite arrays) approach has been proposed [20]. It takes advantage of the fact that the RAPD fragments contain microsatellite repeats more frequently than random genomic clones [22]. Several RAPD primers were selected to amplify the target DNA fragments. The RAPD-PCR amplifications were performed in a thermal cycler (Bio-Rad) with a reaction mixture (50 μL) containing 20–100 ng DNA, 0.2 mM of each dNTP, 2 mM MgCl2, 0.5 U Taq polymerase (Promega), and 5 pmol of one RAPD primer. The PCR program were as follows: initial denaturing for 3 min at 95 °C for 1 cycle, 40 cycles of 1 min at 94 °C, 45 s at 42 °C, 2 min at 72 °C, followed by 10 min at 72 °C for an additional extension step. Approximately 100 ng of PCR product was ligated into a pGEM-T vector (Promega) according to the manufacturer’s instructions. The ligation mixture was then transformed into Escherichia coli competent cells to form the enriched microsatellite sequence library. Colonies of RAPD fragments were analyzed to verify existence of repetitive sequences. Clones were screened using repeat-specific and vector primers [20]. In positive clones, the repeat-specific and vector primers amplified DNA fragments that contain microsatellites, whereas no amplification was found in negative clones. Plasmid DNA from positives was purified using the High-Speed Plasmid Mini Kit (Geneaid). Both strands of the DNA insert were sequenced. DNA sequencing in both directions was conducted with an Applied Biosystems ABI3730 automated sequencer (Applied Biosystems). Primers for these loci were designed using PRIMER 3 software [23] and synthesized. Primers were designed according to the nucleotide sequences upstream and downstream of the repetitive DNA. A total of 8 primer pairs were designed from 8 sequences as the remaining sequences were too close to the cloning site. Polymorphisms of these microsatellite loci were assessed by 40 M. barbata individuals collected from Fujian Province, China and PCR conditions were optimized for each pair of primers. Reactions were performed in a total volume of 15-μL containing 10 ng of genomic DNA, 0.2 mM dNTP, 2 mM MgCl2, and 0.12 μM of each primer. The PCR program consisted of 94 °C for 5 min followed by 35 cycles at 94 °C for 30 s, 30 s at primer-specific annealing temperature (Table 1), 72 °C for 45 s and a final extension step at 72 °C for 5 min. Individuals were genotyped on 6% denaturing polyacrylamide gels stained with ethidium bromide straining and sized by comparison to a 10-bp DNA ladder standard (Invitrogen).

3.2. Data Analysis

Genotype data files were inter-converted for the various analytical software programs using CREATE [24] to minimize errors. The allele number, size range, number of bands per individual, expected (HE), and observed heterozygosity (HO) were quantified using the Arlequin version 3.5 [25]. Hardy–Weinberg equilibrium (HWE) and linkage disequilibrium (LD) were performed using GENEPOP 3.4 software [26]. Results of tests for linkage and Hardy–Weinberg disequilibria were corrected for multiple comparisons by applying sequential Bonferroni corrections [18]. Inbreeding coefficient (FIS) [27] and the significance of these values were calculated for each population with GenePop Web Version 4.0.10 [26,28].

4. Conclusions

The wild resource of M. barbata has declined in the last decade. Therefore, the development of microsatellites and their application, which can offer an effective tool for understanding genetic variation and population structure in M. barbata, is of vital importance. These eight polymorphic microsatellite loci reported here are the first microsatellite markers designed specifically for M. barbata, and the versatility of these new primer sets will provide for the further studies on the genetic structure, gene flow, sustainable management and molecular evolution of this susceptible species. The microsatellite loci are sufficient to perceive significant differences among populations of M. barbata in different fishing grounds of Asia in future studies.

Acknowledgments

The present work is a contribution from a research grant supported by the National Science Council, Taiwan, R.O.C. (NSC 99-2321-B-006-013-MY3).

References

  1. George, M.J.; Muthu, M.S. On the occurrence of Metapenaeopsis barbata (De Haan) (Decapoda: Penaeidae) in Indian Waters with taxonomic notes on the genus. J. Mar. Boil. Ass. Inida 1968, 10, 286–291. [Google Scholar]
  2. Wu, C.C. Survey of shrimp in Taiwan Strait and biological studies of thick shell shrimp (Metapenaeopsis barbata). Bull. Taiwan Fish. Res. Inst 1984, 37, 67–82. [Google Scholar]
  3. Chan, T.Y. Shrimps and Prawns. FAO Species Identification Guide for Fishery Purposes. In The Living Marine Resources of the Western-Central Pacific; Carpenter, K.E., Niem, V.H., Eds.; Food and Agriculture Organization of the United Nations: Rome, Italy, 1998; Volume 2, pp. 851–971. [Google Scholar]
  4. Wu, C.C. Studies on the shrimp fishery and their fishing ground in Taiwan. Bull. Taiwan Fish. Res. Inst 1985, 39, 169–197. [Google Scholar]
  5. Tzeng, T.D.; Chiu, C.S.; Yeh, S.Y. Growth and mortality of the red-spot prawn (Metapenaeopsis barbata) in the northeastern coast off Taiwan. J. Fish. Soc. Taiwan 2005, 32, 229–238. [Google Scholar]
  6. Fisheries Agency Council of Agriculture, Executive Yuan, Taiwan. 2010 Annual Report. Available online: http://www.fa.gov.tw accessed on 24 February 2012.
  7. Dall, W.; Hill, J.; Rothlisberg, P.C.; Staples, D.J. The Biology of Penaeidae. In Advances in Marine Biology; Blaxter, J.H.S., Southward, A.J., Eds.; Academic: New York, NY, USA, 1990; Volume 27. [Google Scholar]
  8. Tzeng, T.D.; Yeh, S.Y. Growth parameters of red-spot shrimp, Metapenaeopsis barbata, from the adjacent waters off Taichung harbor. J. Fish. Soc. Taiwan 1995, 22, 53–68. [Google Scholar]
  9. Tzeng, T.D.; Chiu, C.S.; Yeh, S.Y. Comparison of multivariate allometric coefficients in red-spot prawn (Metapenaeopsis barbata) from adjacent waters off Taiwan. J. Fish. Soc. Taiwan 1998, 25, 85–92. [Google Scholar]
  10. Tzeng, T.D.; Chiu, C.S.; Yeh, S.Y. Morphometric variation in red-spot prawn (Metapenaeopsis barbata) in different geographic waters off Taiwan. Fish. Res 2001, 53, 211–217. [Google Scholar]
  11. Chu, T.J.; Wang, D.; Haung, H.L.; Lin, F.J.; Tzeng, T.D. Genetic variations and expansion of whiskered velvet shrimp (Metapenaeopsis barbata) off China and Taiwan inferred from intron sequence. Biochem. Syst. Ecol 2011, 39, 520–525. [Google Scholar]
  12. Chu, T.J.; Wang, D.; Haung, H.L.; Lin, F.J.; Tzeng, T.D. Population structure and historical demography of the whiskered velvet shrimp (Metapenaeopsis barbata) off China and Taiwan inferred from the mitochondrial control region. Zool. Stud 2012, 51, 99–107. [Google Scholar]
  13. Pettay, D.T.; LaJeunesse, T.C. Microsatellite loci for assessing genetic diversity, dispersal and clonality of coral symbionts in “stress-tolerant” Clade D Symbiodinium. Mol. Ecol. Resour 2009, 9, 1022–1025. [Google Scholar]
  14. Ma, H.Y.; Bi, J.Z.; Shao, C.W.; Chen, Y.; Miao, G.D.; Chen, S.L. Development of 40 microsatellite markers in spotted halibut (Verasper variegatus) and the cross-species amplification in barfin flounder (Verasper moseri). Anim. Genet 2009, 40, 576–578. [Google Scholar]
  15. Guyomard, R.; Mauger, S.; Tabet-Canale, K.; Martineau, S.; Genet, C.; Krieg, F.; Quillet, E. A Type I and Type II microsatellite linkage map of Rainbow trout (Oncorhynchus mykiss) with presumptive coverage of all chromosome arms. BMC Genomics 2006, 7. [Google Scholar] [CrossRef]
  16. Zhang, T.; Kong, J.; Wang, W.; Wang, Q. Genetic variability assessed by microsatellites in the breeding populations of the shrimp Penaeus (Fenneropenaeus) chinensis in China. Aquaculture 2010, 310, 229–233. [Google Scholar]
  17. McDonald, G.J.; Danzmann, R.G.; Ferguson, M.M. Relatedness determination in the absence of pedigree information in three cultured strains of rainbow trout (Oncorhynchus mykiss). Aquaculture 2004, 233, 65–78. [Google Scholar]
  18. Rice, W.R. Analyzing tables of statistical tests. Evolution 1989, 43, 223–225. [Google Scholar]
  19. Sambrook, J.; Fritsch, E.F.; Maniatis, T. Molecular Cloning: A Laboratory Manual, 2nd ed; ColdSpring Harbor Laboratory Press: New York, NY, USA, 1989. [Google Scholar]
  20. Lunt, D.H.; Hutchinson, W.F.; Carvalho, G.R. An efficient method for PCR-based isolation of microsatellite arrays (PIMA). Mol. Ecol 1999, 8, 891–893. [Google Scholar]
  21. Chiang, T.Y.; Lee, T.W.; Lin, F.J.; Huang, K.H.; Lin, H.D. Isolation and characterization of microsatellite loci in the endangered freshwater fish Varicorhinus alticorpus (Cyprinidae). Conserv. Genet 2008, 9, 1399–1401. [Google Scholar]
  22. Cifarelli, R.A.; Gallitelli, M.; Cellini, F. Random amplified hybridization microsatellites (Rahm)—Isolation of a new class of microsatellite-containing DNA clones. Nucleic Acids Res 1995, 23, 3802–3803. [Google Scholar]
  23. Rozen, S.; Skaletsky, H. Primer3 on the WWW for General Users and for Biologist Programmers. In Bioinformatics Methods and Protocols; Krawetz, S., Misener, S., Eds.; Humana Press: Totowa, NJ USA, 2000; pp. 365–386. [Google Scholar]
  24. Coombs, J.A.; Letcher, B.H.; Nislow, K.H. CREATE: A software to create input files from diploid genotype data for 52 genetic software programs. Mol. Ecol. Resour 2008, 8, 578–580. [Google Scholar]
  25. Excoffier, L.; Lischer, H.E.L. Arlequin suite ver 3.5: A new series of programs to perform population genetics analyses under Linux and Windows. Mol. Ecol. Res 2010, 10, 564–567. [Google Scholar]
  26. Raymond, M.; Rousset, F. Genepop (Version-1.2) population genetics software for exact tests and ecumenicism. J. Hered 1995, 86, 248–249. [Google Scholar]
  27. Weir, B.S.; Cockerham, C. Estimating F-statistics for the analysis of population structure. Evolution 1984, 38, 1358–1370. [Google Scholar]
  28. Rousset, F. Genepop’007: A complete reimplementation of the Genepop software for Windows and Linux. Mol. Ecol. Res 2008, 8, 103–106. [Google Scholar]
Table 1. The forward (F) and reverse (R) primer sequences, repeat motif, size range and Tm, annealing temperature for eleven microsatellite loci of Metapenaeopsis barbata.
Table 1. The forward (F) and reverse (R) primer sequences, repeat motif, size range and Tm, annealing temperature for eleven microsatellite loci of Metapenaeopsis barbata.
LocusPrimer sequence(5′ to 3′)Repeat motifSize range (bp)Tm °C
MIMB01F: CAATCGCGCCTCTTACACTT(CA)9147~16154
R: GGCAAAAAGAATGGTAATTGGT
MIMB02F: TCTATATGTGTGTCCGCGTGT(TG)9168~18254
R: CATGTTCAGTATGATGTGTCTATCG
MIMB03F: AAAACAACGATTTCCAAACAGAA(TC)12204~21857
R: TGAAAATTGCGAATTTCCTTT
MIMB04F: TGATTGCGAAGGTCATCAAG(CT)15180~20050
R: TGAAAGGAAAGATTCGAGGAGA
MIMB05F: AGTTAACAGCCTCCGGGAACTCC(AT)8175~19350
R: GGACAAGAGGCAGGTACATAG
MIMB06F: TTTAATGTGTATTGCGGTCTCC(GT)11149~15560
R: CATACACACACGCAGGACATAG
MIMB07F TGCTGGACCTTTGGGTTTATAG(GT)10240~25260
R: CATACAAGCACACGCACAAATA
MIMB08F TGGAGGAGATTGGGAGATTG(GT)10201~20554
R: GAATTCGATTGACCGCTTGT
Table 2. Genetic estimates of eight microsatellite loci for Metapenaeopsis barbata from Taichung, Taiwan, and Fujian, China.
Table 2. Genetic estimates of eight microsatellite loci for Metapenaeopsis barbata from Taichung, Taiwan, and Fujian, China.
TaichungFujian

NAARHOHEPHWFISPFISNAARHOHEPHWFISPFIS
MIMB0132.9050.3810.4310.703520.1180.07432.8600.3000.3031.000000.0100.012
MIMB0232.9050.3810.4310.700330.1180.07432.4870.2050.3030.076290.3250.183
MIMB0321.9050.0480.0481.000000.0000.00032.9290.5000.4820.18053−0.0380.061
MIMB0433.0000.2860.4290.063010.3390.34532.8900.3240.4190.174740.2280.139
MIMB0544.0000.4740.6670.173900.2960.38143.9980.5380.6540.213980.1790.125
MIMB0633.0000.4760.5630.076540.1580.35832.8900.3240.4050.350830.2010.102
MIMB0733.0000.3330.4240.152700.2180.07043.5100.2290.2830.137770.1950.109
MIMB0833.0000.2380.3680.085630.3590.40832.9740.2250.2890.058800.2230.234
mean3.002.9640.3270.4201.00000.2260.03923.253.0670.3310.3920.99660.1580.0476
Number of alleles (NA), allelic richness (Ar), expected (HE) and observed (HO) heterozgosities and significance of deviation from Hardy–Weinberg equilibrium (PHW), fixation index (FIS) and P-values of Chi-Square tests for fixation index (PFIS) for microsatellite loci were estimated.

Share and Cite

MDPI and ACS Style

Chiang, T.-Y.; Tzeng, T.-D.; Lin, H.-D.; Cho, C.-J.; Lin, F.-J. Isolation and Characterization of Polymorphic Microsatellite Loci from Metapenaeopsis barbata Using PCR-Based Isolation of Microsatellite Arrays (PIMA). Int. J. Mol. Sci. 2012, 13, 2763-2768. https://doi.org/10.3390/ijms13032763

AMA Style

Chiang T-Y, Tzeng T-D, Lin H-D, Cho C-J, Lin F-J. Isolation and Characterization of Polymorphic Microsatellite Loci from Metapenaeopsis barbata Using PCR-Based Isolation of Microsatellite Arrays (PIMA). International Journal of Molecular Sciences. 2012; 13(3):2763-2768. https://doi.org/10.3390/ijms13032763

Chicago/Turabian Style

Chiang, Tzen-Yuh, Tzong-Der Tzeng, Hung-Du Lin, Ching-Ju Cho, and Feng-Jiau Lin. 2012. "Isolation and Characterization of Polymorphic Microsatellite Loci from Metapenaeopsis barbata Using PCR-Based Isolation of Microsatellite Arrays (PIMA)" International Journal of Molecular Sciences 13, no. 3: 2763-2768. https://doi.org/10.3390/ijms13032763

APA Style

Chiang, T.-Y., Tzeng, T.-D., Lin, H.-D., Cho, C.-J., & Lin, F.-J. (2012). Isolation and Characterization of Polymorphic Microsatellite Loci from Metapenaeopsis barbata Using PCR-Based Isolation of Microsatellite Arrays (PIMA). International Journal of Molecular Sciences, 13(3), 2763-2768. https://doi.org/10.3390/ijms13032763

Article Metrics

Back to TopTop