Screening of New Microsatellite DNA Markers from the Genome of Platyeriocheir formosa
Abstract
:1. Introduction
2. Results and Discussion
3. Experimental Section
3.1. Sample Collection
3.2. Genomic DNA Isolation
3.3. Screening of GA/GT Microsatellite Sequences
3.4. Genotyping and Analysis
4. Conclusions
Acknowledgments
References
- Chan, T.Y.; Hung, M.S.; Yu, H.P. Identity of Eriocheir recta (Stimpson, 1858) (Decapoda: Brachyura), with description of a new mitten crab from Taiwan. J. Crust. Biol 1995, 15, 301–308. [Google Scholar]
- Shy, J.Y.; Yu, H.P. Complete larval development of the mitten crab Eriocheir rectus Stimpson, 1858 (Decapoda, Brachyura, Grapsidae) reared in the laboratory. Crustaceana 1992, 63, 277–290. [Google Scholar]
- Shiao, C.Y. The Genetic Diversity of Eriocheir formosa (Crustacea, Decapoda, Grapsidae). Master Thesis, Department of Life Science, National Tsing Hua University, Hsinchu, Taiwan, 2007. [Google Scholar]
- Weber, J.L.; Wong, C. Mutation of human short tandem repeats. Hum. Mol. Genet 1993, 2, 1123–1128. [Google Scholar]
- Baranski, M.; Moen, T.; Våge, D.I. Mapping of quantitative trait loci for flesh colour and growth traits in Atlantic salmon (Salmo salar). Genet. Sel. Evol 2010, 42. [Google Scholar] [CrossRef]
- Malausa, T.; Dalecky, A.; Ponsard, S.; Audiot, P.; Streiff, R.; Chaval, Y.; Bourguet, D. Genetic structure and gene flow in French populations of two Ostrinia taxa: Host races or sibling species? Mol. Ecol 2007, 6, 4210–4222. [Google Scholar]
- Pilot, M.; Dabrowski, M.J.; Jancewicz, E.; Schtickzelle, N.; Gliwicz, J. Temporally stable genetic variability and dynamic kinship structure in a fluctuating population of the root vole Microtus oeconomus. Mol. Ecol 2010, 19, 2800–2812. [Google Scholar]
- Gottelli, D.; Sillero-Zubiri, C.; Applebaum, G.D.; Roy, M.S.; Girman, D.J.; Garcia-Moreno, J.; Ostrander, E.A.; Wayne, R.K. Molecular genetics of the most endangered canid: The Ethiopian wolf Canis simensis. Mol. Ecol 1994, 3, 301–312. [Google Scholar]
- Viard, F.; Bremond, P.; Labbo, R.; Justy, F.; Delay, B.; Jarne, P. Microsatellites and the genetics of highly selfing populations in the freshwater snail Bulinus truncates. Genetics 1996, 142, 1237–1247. [Google Scholar]
- Pinheiro, M.; Ahlquist, T.; Danielsen, S.A.; Lind, G.E.; Veiga, I.; Pinto, C.; Costa, V.; Afonso, L.; Sousa, O.; Fragoso, M. Colorectal carcinomas with microsatellite instability display a different pattern of target gene mutations according to large bowel site of origin. BMC Cancer 2010, 10. [Google Scholar] [CrossRef]
- Xu, Q.; Liu, R. Development and characterization of microsatellite markers for genetic analysis of the swimming crab, Portunus trituberculatus. Biochem. Genet 2011, 49, 202–212. [Google Scholar]
- Cronin, L.E. Early days of crabbing and a brief history for the Chesapeake Bay. J. Shellfish Res 1998, 17, 379–382. [Google Scholar]
- Steven, C.R.; Hill, J.; Masters, B.; Place, A.R. Genetic markers in blue crabs (Callinectes sapidus) I: Isolation and characterization of microsatellite markers. J. Exp. Mar. Biol. Ecol 2005, 319, 3–14. [Google Scholar]
- Weber, J.L. Informativeness of human (dC-dA)n. (dG-dT)n polymorphisms. Genomics 1990, 7, 524–530. [Google Scholar]
- Gao, X.G.; Li, H.J.; Li, Y.F.; Sui, L.J.; Zhu, B.; Liang, Y.; Liu, W.D.; He, C.B. Sixteen polymorphic simple sequence repeat markers from expressed sequence tags of the Chinese mitten crab Eriocheir sinensis. Int. J. Mol. Sci 2010, 11, 3035–3038. [Google Scholar]
- Tseng, M.C.; Chen, C.A.; Kao, H.W.; Tzeng, W.N.; Lee, S.C. Polymorphisms of GA/GT microsatellite loci from Anguilla japonica. Mar. Biotechnol 2001, 3, 275–280. [Google Scholar]
- Jean, C.T.; Lee, S.C.; Liu, C.W.; Tseng, M.C. Isolation and characterization of eight microsatellite loci from Picnic seabream (Acanthopagrus berda). Mol. Ecol. Notes 2006, 6, 1269–1271. [Google Scholar]
- Kocher, T.D.; Thomas, W.K.; Meyer, A.; Edwards, S.V.; Paabo, S.; Villablabca, F.X.; Wilson, A.C. Dynamics of mitochondrial DNA evolution in animals: Amplification and sequencing with conserved primers. Proc. Natl. Acad. Sci. USA 1989, 86, 6196–6200. [Google Scholar]
- Sambrook, J.; Fritsch, E.F.; Maniatis, T. Molecular Cloning: A Laboratory Manual, 2nd ed.; Cold Spring Harbor Laboratory Press: Cold Spring Harbor, NY, USA, 1989. [Google Scholar]
- Yang, R.C.; Yeh, F.C. Multilocus structure in Pinus contoria Dougl. Theor. Appl. Genet 1993, 87, 568–576. [Google Scholar]
- Raymond, M.; Rousset, F. An exact test for population differentiation. Evolution 1995, 49, 1280–1283. [Google Scholar]
- Rousset, F. Genepop’007: A complete reimplementation of the Genepop software for Windows and Linus. Mol. Ecol. Res 2008, 8, 103–106. [Google Scholar]
- Ohta, T. Linkage disequilibrium due to random drift in infinitely subdivided populations. Proc. Natl. Acad. Sci. USA 1982, 79, 1940–1944. [Google Scholar]
Locus | Fluorescence labeling | Primer sequence (5′→3′) | Major repeats | Ta (°C) | Allelic size range (bp) | na | ne | HO/HE | Cross species amplified For | EMBL Accession no. | |
---|---|---|---|---|---|---|---|---|---|---|---|
Eriocheir sinensis | E. japonica | ||||||||||
Pfo 4 | FAM | F: TGTGAGACGGCGGTTACGAG R: GAGCACTCTCCCTGGTCTTC | (CA)29 | 56 | 145–183 | 13 | 6.45 | 0.75/0.87 | − | + | JQ582816 |
Pfo 5 | HEX | F: TGTCCAACCGCTTTCTTTC R: CGAAGATAACAGTAATACGG | (TC)6 | 54 | 141–149 | 3 | 2.25 | 0.55/0.57 | − | + | JQ582817 |
Pfo 7 | HEX | F: ACTAATCCAATGCCTGCC R: CTATGCAGTCTCCTTCCGTAG | (GT)22 | 52 | 217–239 | 10 | 6.06 | 0.65/0.86 | + | + | JQ582818 |
Pfo 9 | TAMRA | F:TCTAGGCTGCAGCTTCATAG R:GGACGCATTAGCATAACA | (CA)31 | 54 | 156–194 | 14 | 9.88 | 0.45 */0.92 | + | + | JQ582819 |
Pfo10 | HEX | F: TACCACGTCCGTTCTAG R: CGTATAGGAGATTACTGG | (CA)10 | 50 | 94–128 | 8 | 7.27 | 0.65/0.88 | − | − | JQ582820 |
Pfo12 | TAMRA | F: TTCCTATCGCTCTCATCAGC R: TTGTCCAGTTCATACTG | (CA)32 | 56 | 186–216 | 14 | 7.84 | 0.45 */0.89 | + | − | JQ582821 |
Pfo15 | TAMRA | F: GAAGAGTGTGGCGGAG R: CTTGACACCTCGTGAGG | (GT)16 | 60 | 68–76 | 5 | 2.99 | 0.00 */0.68 | + | − | JQ582822 |
Pfo18 | FAM | F: GGAAGTGGTGGTAAAG R: CACTTAACAGGTGGACA | (CA)33 | 60 | 134–170 | 13 | 6.84 | 0.35 */0.88 | + | − | JQ582823 |
Pfo19 | FAM | F: GGTGATCTTGGGCACCG R: GATAGATACTTGAACACG | (CA)32 | 50 | 141–175 | 13 | 9.20 | 0.25 */0.91 | − | − | JQ582824 |
Pfo31 | FAM | F: GCACCACAGCGCTCTCTTAC R: GGTAGGAAGACAGTGCG | (CA)17 | 52 | 79–93 | 6 | 2.74 | 0.35 */0.65 | − | + | JQ582825 |
Pfo34 | TAMRA | F: GTAGAACTGACAGCC R: CTGGTGCCTTACCTGTC | (CA)20 | 50 | 71–77 | 3 | 2.38 | 0.70 */0.59 | − | − | JQ582826 |
Pfo36 | FAM | F: CTC GTTACTACACTCC R: CCATTCATATGCCATG | (CA)35 | 54 | 101–125 | 10 | 6.11 | 0.50 */0.86 | − | − | JQ582827 |
Pfo37 | TAMRA | F: AAGCTGGCTGACACCTG R: CGTCACCTTGCAATC | (CA)31 | 50 | 166–200 | 13 | 8.79 | 0.90/0.91 | + | − | JQ582828 |
Pfo51 | FAM | F: GTGCTCTGCGAAACG R: GGAGTGCTGGAGTAG | (CA)18 | 58 | 85–101 | 8 | 2.94 | 0.20 */0.68 | − | − | JQ582829 |
Pfo52 | HEX | F: GTATGTTGATGGCGTG R: AGAGTGTGGCGGAGGC | (CA)12 | 50 | 97–109 | 6 | 4.10 | 0.95*/0.78 | − | − | JQ582830 |
Pfo54 | TAMRA | F: GCATGCAAGAGCGTAG R: TGACAGACAGACTCC | (GT)18 | 50 | 141–173 | 10 | 5.52 | 0.70 */0.84 | + | − | JQ582831 |
Pfo60 | HEX | F: ACTATCACTAGGCTCAT R: TCAGTCTCGTATTCTC | (GT)17 | 50 | 118–146 | 11 | 7.62 | 0.55 */0.89 | + | + | JQ582832 |
Pfo79 | FAM | F: TTATCCTGATCCTGAG R: GACATAGCAGCAATAC | (GT)26 | 52 | 113–143 | 13 | 10.26 | 0.45 */0.93 | − | − | JQ582833 |
© 2012 by the authors; licensee Molecular Diversity Preservation International, Basel, Switzerland. This article is an open-access article distributed under the terms and conditions of the Creative Commons Attribution license (http://creativecommons.org/licenses/by/3.0/).
Share and Cite
Cheng, H.-L.; Lee, Y.-H.; Hsiung, D.-S.; Tseng, M.-C. Screening of New Microsatellite DNA Markers from the Genome of Platyeriocheir formosa. Int. J. Mol. Sci. 2012, 13, 5598-5606. https://doi.org/10.3390/ijms13055598
Cheng H-L, Lee Y-H, Hsiung D-S, Tseng M-C. Screening of New Microsatellite DNA Markers from the Genome of Platyeriocheir formosa. International Journal of Molecular Sciences. 2012; 13(5):5598-5606. https://doi.org/10.3390/ijms13055598
Chicago/Turabian StyleCheng, Hui-Ling, Yan-Horn Lee, Dai-Shion Hsiung, and Mei-Chen Tseng. 2012. "Screening of New Microsatellite DNA Markers from the Genome of Platyeriocheir formosa" International Journal of Molecular Sciences 13, no. 5: 5598-5606. https://doi.org/10.3390/ijms13055598