Next Article in Journal
Implication of Tumor Microenvironment in Chemoresistance: Tumor-Associated Stromal Cells Protect Tumor Cells from Cell Death
Previous Article in Journal
Isolation and Characterization of Microsatellite Markers in Brown Planthopper (Nilaparvata lugens Stål)
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Short Note

Isolation and Characterization of 46 Novel Polymorphic EST-Simple Sequence Repeats (SSR) Markers in Two Sinipercine Fishes (Siniperca) and Cross-Species Amplification

College of Fisheries, Huazhong Agricultural University, Wuhan 430070, China
*
Author to whom correspondence should be addressed.
Int. J. Mol. Sci. 2012, 13(8), 9534-9544; https://doi.org/10.3390/ijms13089534
Submission received: 9 July 2012 / Revised: 24 July 2012 / Accepted: 24 July 2012 / Published: 30 July 2012
(This article belongs to the Section Biochemistry)

Abstract

With the development of next generation sequencing technologies, transcriptome level sequence collections are emerging as prominent resources for the discovery of gene-based molecular markers. In this study, we described the isolation and characterization of 46 novel polymorphic microsatellite loci for Siniperca chuatsi and Siniperca scherzeri from the transcriptome of their F1 interspecies hybrids. Forty-three of these loci were polymorphic in S. chuatsi, and 20 were polymorphic in S. scherzeri. In S. chuatsi, the number of alleles per locus ranged from 2 to 8, and the observed and expected heterozygosities varied from 0.13 to 1.00 and from 0.33 to 0.85, respectively. In S. scherzeri, the number of alleles per locus ranged from 3 to 9, and the observed and expected heterozygosities varied from 0.19 to 1.00 and from 0.28 to 0.88, respectively. We also evaluated the cross-amplification of 46 polymorphic loci in four species of sinipercine fishes: Siniperca kneri, Siniperca undulata, Siniperca obscura, and Coreoperca whiteheadi. The interspecies cross-amplification rate was very high, totaling 94% of the 184 locus/taxon combinations tested. These markers will be a valuable resource for population genetic studies in sinipercine fishes.

1. Introduction

Mandarin fish (Siniperca chuatsi), an economically important species in China, has a relatively high market value, and is wide cultured throughout the country [1,2]. It has a fast growth rate, but is susceptible to diseases. Compared with S. chuatsi, Golden mandarin fish (Siniperca scherzeri) has a great disease resistance, but grows slowly. Recently, outbreaks of diseases caused by parasites, bacteria and viruses have caused severe economic losses to the aquaculture industry [3]. In addition, because of overfishing, drought and especially water pollution, the wild stock of S. chuatsi is declining [4]. Therefore, breeding a disease-resistant and faster growing strain and preserving fish germplasm are becoming urgent aims in China.
Microsatellites or simple sequence repeats (SSRs) have become a useful tool to assess genetic diversity and develop molecular breeding techniques in fish due to their co-dominance, ubiquitous distribution within genomes, high reproducibility, and transferability across species [5,6]. However, the development of microsatellite markers has been limited by the labor and time required to construct, enrich, and sequence genomic libraries [7]. Fortunately, with the advent of next generation sequencing technologies, transcriptome sequencing is emerging as a rapid and efficient means for gene discovery and genetic marker development. Since EST-SSRs derived from transcriptome exist in the transcribed region of the genome, they can lead to the development of gene-based maps which help to identify candidate function genes and increase the efficiency of marker-assisted selection (MAS) [8]. Furthermore, EST-SSRs show a higher level of transferability to closely related species than non-EST-SSRs [9].
Although a few microsatellite markers were developed for S. chuatsi [1014] and S. scherzeri [15], the number of available SSRs is grossly inadequate for genetic and mapping studies. Here, we describe the isolation and characterization of 46 novel polymorphic microsatellite loci for the S. chuatsi and S. scherzeri. We also test the transferability of these markers in other four species of sinipercine fishes: Siniperca kneri, Siniperca undulata, Siniperca obscura, and Coreoperca whiteheadi.

2. Results and Discussion

As shown in Table 1, a total of 46 polymorphic EST-SSR markers were newly developed. Forty-three of these loci were polymorphic in S. chuatsi, and 20 were polymorphic in S. scherzeri. Concerning S. chuatsi, the number of alleles per locus ranged from 2 to 8, with an average of 4.3 alleles per locus. The observed (HO) and expected heterozygosities (HE) ranged from 0.13 to 1.00 (average of 0.55) and from 0.33 to 0.85 (average of 0.63), respectively. In S. scherzeri, the number of alleles per locus ranged from 3 to 9, with an average of 5.5 alleles per locus. The observed (HO) and expected heterozygosities (HE) ranged from 0.19 to 1.00 (average of 0.74) and from 0.28 to 0.88 (average of 0.72), respectively. Five loci (Sin134 in S. chuatsi, Sin118, Sin122, Sin158 and Sin159 in S. scherzeri) showed significant deviation from the Hardy-Weinberg equilibrium (HWE) after Bonferroni correction (adjusted p-value = 0.0012 for S. chuatsi and 0.0026 for S. scherzeri), which may be due to the small sample size (n = 32) or the excess of heterozygotes. Another possible explanation for the departure from HWE is the dramatic contemporary decline in spawning populations, and consequent non-random mating and genetic bottlenecks [14]. No evidence for allelic dropout was found in these loci. No significant linkage disequilibrium (LD) was detected across all loci following Bonferroni correction (adjusted p-value = 0.0001 for S. chuatsi and 0.0003 for S. scherzeri).
Overall, a high level of cross-species amplification was observed across the four species (Table 2). Forty-five of 46 polymorphic loci (97.8%) were amplified successfully in S. undulate and S. obscura, 44 (95.7%) in S. kneri, and 39 (84.8%) in C. whiteheadi. These results were expected because of the taxonomical relationships of the families [16]. S. kneri, S. undulata, S. obscura are closely related to S. chuatsi and S. scherzeri, and all species belong to Siniperca, whereas C. whiteheadi is from Coreoperca which is sister genera to Siniperca. As transcriptome sequences are typically conserved relative to nontranscribed regions, SSRs residing in transcriptome sequences typically benefit from higher amplification rates and higher levels of cross-species transferability [17,18]. The high level of cross-species amplification tested here indicated not only the potential utility of transcriptome sequences for the identification and characterization of large numbers of gene-based SSR loci across species for which limited marker resources were available, but also the potential usefulness of the developed markers for a broader range of evolutionary, conservation and management studies in sinipercine fishes.

3. Experimental Section

De novo transcriptome sequencing of F1 hybrids between S. chuatsi (♀) and S. scherzeri (♂) was performed and a total of 118,218 unigenes were identified. The processes of library preparation for transcriptome analysis and sequence assembly were as described in [19]. This unigene set was used for mining EST-SSR markers using the default parameters of the BatchPrimer3 v1.0 software [20]. In this study, a subset of 62 EST-SSR markers was screened on 32 S. chuatsi (Chibi, Hubei Province, China) and 32 S. scherzeri (Fengcheng, Liaoning Province, China), respectively. The primers for these SSR loci were designed using NCBI/Primer-BLAST [21].
Total genomic DNA was extracted from fin clips using the TIANamp Genomic DNA Kit (Tiangen) following the manufacturer’s instructions. Polymerase chain reaction (PCR) conditions were optimized for each pair of primers. PCRs were performed in 25 μL reaction volumes containing 2.5 μL of 10× PCR buffer, 1.0–3.0 mM MgCl2, 50 μM dNTPs, 0.4 μM of each primer, 1 U Taq polymerase (Takara) and 50 ng genomic DNA. PCR conditions were as follows: initial denaturation at 94 °C for 3 min followed by 35 cycles at 94 °C for 30 s, the optimized annealing temperature (Table 1) for 30 s, 72 °C for 30 s, and then a final extension step at 72 °C for 10 min. PCR products were separated on a 8% non-denaturing polyacrylamide gel electrophoresis and visualized by silver staining. A denatured pBR322 DNA/MspI molecular weight marker (Tiangen) was used as a size standard to identify alleles.
The number of alleles (Na), the observed (HO) and expected heterozygosities (HE) were estimated using POPGENE version 1.32 [22]. The polymorphic information content (PIC) was calculated using the formula:
P I C = 1 - ( i = 1 n q i 2 ) - ( i = 1 n - 1 j = i + 1 n 2 q i 2 q j 2 )
where n is the number of alleles, and qi, qj is the ith and jth allele frequency, respectively [23]. Deviations from Hardy-Weinberg equilibrium (HWE) and linkage disequilibrium (LD) were tested using the online version of GENEPOP [24]. All results were adjusted for multiple simultaneous comparisons using a sequential Bonferroni correction [25]. Genotyping errors due to null alleles, stutter bands, or allele dropout were analyzed using the software Micro-checker 2.2.3 [26].
Cross-species amplification of the above-developed polymorphic SSR loci was tested in four species of sinipercine fishes: S. kneri, S. undulata, S. obscura, and C. whiteheadi. Two individuals of each species were analyzed. The same PCR conditions were used as described above except that the annealing temperature was re-optimized at each locus (Table 2). Amplification products were visualized in 1.5% agarose gels, and fragments were sized by comparison with a 2 kb DNA Marker (Trans). Primer pairs that amplified fragments with similar sizes to those observed in source species were considered as successful cross-species amplification.

4. Conclusions

In summary, a total of 46 polymorphic EST-SSR markers were newly developed. Forty-three of these loci were polymorphic in S. chuatsi, and 20 were polymorphic in S. scherzeri. We only tested a small subset of the SSR loci identified in our transcriptome, but high levels of polymorphism, and high level of cross-species amplification indicate that the pairs of primers described here may be suitable for assessments of genetic diversity and population structure, the construction of high-density linkage map, conservation and molecular marker-assisted breeding in many species of sinipercine fishes. Our results highlight the value of next generation transcriptome resources for the characterization and development of gene-based SSRs.

Acknowledgments

This work was financially supported by the National Natural Science Foundation of China (31172420), the National Basic Research Program of China (2009CB118702) and the Fundamental Research Funds for the Central Universities (2010PY010, 2011PY030).

References

  1. Liang, Y.; Cui, X. The eco-physiological characteristics of artificial propagation in mandarin fish (Siniperca chuatsi). Acta Hydrobiol. Sin 1982, 16, 90–92. [Google Scholar]
  2. Liu, J.; Cui, Y.; Liu, J. Food consumption and growth of two piscivorous fishes, the mandarin fish and the Chinese snakehead. J. Fish Biol 1998, 53, 1071–1083. [Google Scholar]
  3. He, J.G.; Zeng, K.; Weng, S.P.; Chan, S.M. Experimental transmission, pathogenicity and physical-chemical properties of infectious spleen and kidney necrosis virus (ISKNV). Aquaculture 2002, 204, 11–24. [Google Scholar]
  4. Zhang, C.; Zhao, Y. The resources status, recovery and reasonable utilization of Siniperca chuatsi in China (in Chinese). Bull. Biol 1999, 34, 9–11. [Google Scholar]
  5. Walter, R.; Epperson, B.K. Geographic pattern of genetic variation in Pinus resinosa: Area of greatest diversity is not the origin of postglacial populations. Mol. Ecol 2001, 10, 103–111. [Google Scholar]
  6. Saha, M.C.; Cooper, J.D.; Rouf Mian, M.A.; Chekhovskiy, K.; May, G.D. Tall fescue genomic SSR markers: Development and transferability across multiple grass species. Theor. Appl. Genet 2006, 113, 1449–1458. [Google Scholar]
  7. Edwards, K.J.; Barker, J.H.; Daly, A.; Jones, C.; Karp, A. Microsatellite libraries enriched for several microsatellite sequences in plants. BioTechniques 1996, 20, 758–760. [Google Scholar]
  8. Gupta, P.K.; Rustgi, S. Molecular markers from the transcribed/expressed region of the genome in higher plants. Funct. Integr. Genomics 2004, 4, 139–162. [Google Scholar]
  9. Saha, M.C.; Mian, M.A.; Eujay, I.; Zwonitzer, J.C.; Wang, L.; May, G.D. Tall fescue EST-SSR markers with transfer ability across several grass species. Theor. Appl. Genet 2004, 109, 783–791. [Google Scholar]
  10. Zhang, B.; Li, Z.J.; Tong, J.G.; Liao, X.L. Isolation and characterization of 18 polymorphic microsatellite markers in Chinese mandarin fish Siniperca chuatsi (Basilewsky). Mol. Ecol. Notes 2006, 6, 1216–1218. [Google Scholar]
  11. Kuang, G.Q.; Liu, Z.; Lu, S.Q.; Liu, H.Y.; Zhang, J.S.; Tang, J.Z. Isolation and characterization of microsatellite loci from Siniperca chuatsi (in Chinese). J. Fish Sci. China 2007, 14, 608–614. [Google Scholar]
  12. Kuang, G.Q.; Liu, Z.; Lu, S.Q.; Liu, H.Y.; Zhang, J.S.; Xiao, T.Y. Isolation and characterization of microsatellite loci of Siniperca chuatsi from GenBank database (in Chinese). Acta Zool. Sin 2007, 53, 184–189. [Google Scholar]
  13. Kuang, G.Q.; Lu, S.Q.; Zheng, S.M.; Wu, Q. Isolation and evaluation of 18 microsatellite loci in Siniperca chuatsi (Basilewsky). Mol. Ecol. Resour 2009, 9, 1473–1475. [Google Scholar]
  14. Liu, X.L.; Luo, W.; Zeng, C.; Wang, W.M.; Gao, Z.X. Isolation of New 40 Microsatellite Markers in Mandarin Fish (Siniperca chuatsi). Int. J. Mol. Sci 2011, 12, 4180–4189. [Google Scholar]
  15. Yang, M.; Liang, X.F.; Tian, C.X.; Gul, Y.; Dou, Y.Q.; Cao, L.; Yu, R. Isolation and characterization of fifteen novel microsatellite loci in golden mandarin fish (Siniperca scherzeri) Steindachne. Conserv. Genet. Resour 2012. [Google Scholar] [CrossRef]
  16. Liu, H.Z. Studies on Skeleton Anatomy and Phylogeny of the Sinipericine Fishes. In Ph.D. Dissertation; Institute of Hydrobiology, Chinese Academy of Sciences: Wuhan, Hubei Province, 1993. [Google Scholar]
  17. Barbara, T.; Palma-Silva, C.; Paggi, G.M.; Bered, F.; Fay, M.F.; Lexer, C. Cross-species transfer of nuclear microsatellite markers: potential and limitations. Mol. Ecol 2007, 16, 3759–3767. [Google Scholar]
  18. Ellis, J.R.; Burke, J.M. EST-SSRs as a resource for population genetic analyses. Heredity 2007, 99, 125–132. [Google Scholar]
  19. Wang, X.W.; Luan, J.B.; Li, J.M.; Bao, Y.Y.; Zhang, C.X.; Liu, S.S. De novo characterization of a whitefly transcriptome and analysis of its gene expression during development. BMC Genomics 2010, 11, 400. [Google Scholar]
  20. You, F.M.; Huo, N.; Gu, Y.Q.; Luo, M.C.; Ma, Y.; Hane, D.; Lazo, G.R.; Dvorak, J.; Anderson, O.D. BatchPrimer3: A high throughput web application for PCR and sequencing primer design. BMC Bioinforma 2008, 9, 253. [Google Scholar]
  21. National Center for Biotechnology Information, U.S. National Library of Medicine. Available online: http://www.ncbi.nlm.nih.gov/tools/primer-blast/index.cgi?LINK_LOC=BlastHome accessed on 30 July 2012.
  22. Yeh, F.C.; Boyle, T.J.B. Population genetic analysis of co-dominant and dominant markers and quantitative traits. Belg. J. Bot 1997, 129, 157. [Google Scholar]
  23. Botstein, D.; White, R.L.; Skolnick, M.; Davis, R.W. Construction of a genetic linkage map in man using restriction fragment length polymorphisms. Am. J. Hum. Genet 1980, 32, 314–331. [Google Scholar]
  24. Raymond, M.; Rousset, F. GENEPOP (version 1.2): Population genetic software for exact tests and ecumenicism. J. Hered 1995, 86, 248–249. [Google Scholar]
  25. Rice, W.R. Analyzing tables of statistical tests. Evolution 1989, 43, 223–225. [Google Scholar]
  26. Van Oosterhout, C.; Hutchinson, W.F.; Wills, D.P.M.; Shipley, P. MICRO-CHECKER: Software for identifying and correcting genotyping errors in microsatellite data. Mol. Ecol. Notes 2004, 4, 535–538. [Google Scholar]
Table 1. Characterization of 46 polymorphic EST-simple sequence repeats (SSR) markers in S. chuatsi and S. scherzeri.
Table 1. Characterization of 46 polymorphic EST-simple sequence repeats (SSR) markers in S. chuatsi and S. scherzeri.
LocusAccession numberRepeat motifPrimer sequence(5′-3′)Size range (bp)Ta (°C)NaHOHEPICp-Value
Sin109JQ804765(AG)15F: GGACACTGGACACTCAAACAT220–27054.540.25000.63390.57471.0000
R: AGAGGATCAAAATTGTGCTTGAA246–28554.560.68750.81700.77560.9510
Sin110JQ804766(AC)15F: TGCTGTTTCCTCAAAACCCCT177–24454.560.71880.81940.77980.9933
R: AATCCAAGTGACAGGACGCC
Sin112JQ804768(AC)15F: ATCGGCACCTGAGGCAAAAG132–16654.560.96880.78970.74440.0030
R: GCCATCCATAGAGCCACGTC129–19854.591.00000.87700.84790.0090
Sin113JQ804769(TG)15F: TCCCCATATCTGCCCTGACC90–12654.560.81250.79070.74390.9514
R: GTGCACATGTCGAGTCAGTA
Sin114JQ804770(AC)14F: AAGAGACAAGACACCACCGC185–20954.550.43750.67360.60120.9347
R: ATGGTTTGACGGGAGACAGC194–24354.571.00000.84180.80640.0039
Sin116JQ804771(TG)14(AG)7F: ACAATCCCAGCCCTCCTTCT212–26554.560.56250.82190.78130.9999
R: GCAAGGTCCCTTTACATGCAG219–25954.550.87500.78770.73930.0798
Sin117JQ804772(GT)14F: GGGCGGAAGACCAACTATGT268–29154.530.40620.53320.46970.9871
R: TTTCTGTCCTTTTTCCTCTCGC
Sin118JQ804773(GT)14F: AGGCCACACTTTAGTCACATC163–19254.540.87500.73760.67540.0393
R: ACCACACTCCAGCATTTCCC157–18954.531.00000.62250.53780.0000 *
Sin119JQ804774(CA)14F: AACAACTTTTTACCGCCAGCC180–22654.540.84380.72820.66520.1123
R: ACCTCTGCTGCACAGCTAATC
Sin120JQ804775(TTTG)7F: CCATCCCTCCGACCTTCAGT119–13454.540.53120.69000.62090.9418
R: TTTAGGAACCCGACTCCGCT
Sin122JQ804777(TG)14TAG(GT)7F: TGCACTCACACACCTGTCTC
R: AGCAGGATGCTTCATGCACTT205–24654.551.00000.66670.59270.0000 *
Sin123JQ804778(AC)14F: GATGGTGGTGAAACACTGGCT249–30754.560.78120.77730.73520.7478
R: GTGTTGAGAGGGTCCTGGTG198–21456.030.50000.53970.46830.9912
Sin124JQ804779(CA)14F: TCAAACACCACCCACCCCTG248–28154.540.87500.72970.66670.0180
R: ACCGGGACAGGATGGGAGTC
Sin125JQ804780(CA)14F: ACCCTCTGTGTGGCGAATGT277–31154.530.62500.62650.54740.5368
R: CGGGACAGGATGGGAGTCG
Sin127JQ804782(TG)14F: AGACGTAGCCCAGGCTCAAA215–25154.530.59380.50550.42130.0303
R: TGTGGGGTTCACTACAGGGT
Sin128JQ804783(AC)14F: CTGTGCCTCAGTGTGCTGC225–25754.530.40620.63940.55720.9995
R: ACTTGTAATGGGCAAATTGTCACT
Sin129JQ804784(CA)14F: ACGCTGCGAGGTGTGATATG131–16454.550.62500.75000.69710.9857
R: CTGGCCCTCGTTAGTGCTTG185–21754.581.00000.84570.81030.0046
Sin130JQ804785(GTGA)7N7(TG)8F: CTCGCAGGCTTTTCTCTGCT282–30054.520.34380.39630.31400.8902
R: AGCCATCAGTTCTGTTCTTTCTT252–28054.550.71880.74850.69820.3062
Sin131JQ804785(ATGG)7F: GGAGGAAAATAATTTCATTTGGGAT180–20054.530.12500.41070.36650.9998
R: GTCATTGCATTCAAAAGTTAGGCT
Sin134JQ804789(TG)14F: GCCCCCTTCTCAACCCACTA106–12054.561.00000.80750.76450.0008 *
R: TGCTTTCCAAAGCGAACCGT108–13454.580.96880.86210.82990.0451
Sin135JQ804790(TG)14F: GTGATATCTCCTCCTGACGGC273–30254.540.59380.55850.49000.3484
R: ACATTCTGAATTGCAAAGGCTCA
Sin136JQ804791(TG)14F: AACTGAAATGTGTGGTGAACTGA138–16456.850.50000.72020.65850.9243
R: GTGTCTCCCAACAAGTGGCA
Sin137JQ804792(TCA)9F: AGCGTCTACTGAGGGTCAAACT234–28054.550.46880.72070.67000.9960
R: GGTGGACTGACCAGCAAGGA
Sin138JQ804793(ATC)9F: TCATCTGAGGACGACTCGCT229–25352.530.43750.59970.50250.9772
R: AACTTAACTTCCTGCTGTCCCT
Sin139JQ804794(CTC)9F: GTGACTGCATCCAGGTGTCG
R: GGCCGAGGTCGGTTGTTATC189–20754.530.18750.28030.25840.9947
Sin140JQ804795(TCA)9F: TGTGGTTCTCCTCTCCCACA253–30453.250.43750.73360.67590.9985
R: AGAGGTTGGTGCAGGAGACTT
Sin142JQ804797(CTT)9F: CATCAACGCAATGCAAGGGT150–18054.520.15620.32890.27130.9997
R: CTGGAGCCGGACTTGAGGAA181–22654.560.34380.69940.64920.9998
Sin143JQ804797(GTT)7F: AAAGCAGGCCAAACAACACC198–24654.550.40620.77330.72061.0000
R: AGGACGGGGAGGCTTTTGAT
Sin146JQ804800(GAG)6 N5 (AAG)9F: GTAATCGACACGGACAGCGA370–45254.540.59380.67810.60690.8240
R: CACACACATTCTCCTCAGCGT
Sin147JQ804801(TCC)9F: AGATCAGACACCAGGAGGACC174–23253.550.31250.72420.65760.9971
R: AAGACGGAGGCAAAGAACGAC192–22554.540.56250.76140.70260.9964
Sin148JQ804802(CAT)9F: CGAGGCCAGGAGTGAACCAA255–30353.530.68750.48660.40090.0027
R: GCACAGCTGGAGGTGTTTCG
Sin151JQ804805(GT)13F: GTGCAAGGCCTTAGTCTCTCC170–22155.540.68750.64340.57610.8897
R: GCCCACCAGATCTACCGAGT
Sin152JQ804806(AG)8A(AG)13F: TGCGCCACTTTACTGATGGG173–24253.560.65620.81050.76770.9164
R: GCATTAACCAAACCCCGCGA185–24054.580.96880.85220.81930.1740
Sin153JQ804807(AG)13F: GCACAGGTTTTTCTAAACATTGCT155–20853.550.18750.37950.35380.9662
R: TGTTGTTATTGTCAGTGTGTTTTCT177–21554.540.25000.68060.61601.0000
Sin154JQ804808(GT)13F: ACTGGTTTGTGGTTTGGAGGT211–22953.520.56250.41070.32250.0356
R: ATGATTTTTCTTGCCTTCGTGT
Sin155JQ804809(AC)13F: GAATGGTGTGTTGCACAGCG157–19053.530.21880.38940.34730.9939
R: CATTCTAGCATGTGCGAGGC160–20154.570.68750.80210.76000.9004
Sin156JQ804810(AC)13F: TAGGAGGCTTTACAACCGGC188–20553.520.56250.41070.32250.0344
R: ATGACCAGCCTCAGGTGTCT
Sin157JQ804811(AC)13F: CATTTGCTGGCTCTCACACC184–21553.530.50000.43300.34770.2070
R: TGTTTAATTCATGCCTAGGTTTAGT
Sin158JQ804812(CA)13F: TGAGAACTGCCTGAGCCGAG
R: CTGCAGAGCCGTGGAGACTA210–24854.530.90620.53030.41450.0000 *
Sin159JQ804813(TG)13F: CGCTGATCGCTCTGTGCTCCC196–23453.550.68750.76140.71080.7259
R: ACACGGAAGCTGGTGAGCGG199–23356.050.96880.63790.56820.0000 *
Sin160JQ804814(TG)13F: CCACTGGAGCCCACATGGCA307–36055.550.81250.67110.61230.0151
R: TGAGTGGGCGCTACTGTGTGT291–33154.550.78120.76590.71370.5928
Sin162JQ804815(TA)13F: TGCTTTGCTGGTTGGCAGGCT294–36853.550.18750.62700.56511.0000
R: CGTGGAGGTGCGACGCGTAA
Sin163JQ804817(CA)13F: ACAGCCAGGCTCCTCCACCT230–26953.580.68750.84820.81340.9597
R: TCTTTCACAGGCAAACCACTGCT225–27353.560.46880.78030.73921.0000
Sin166JQ804819(GA)13F: GAAATTGAAGAAGACAAGGTGATG204–23153.530.25000.45040.40120.9998
R: CTGCTTTTGGCAGGAGCTAA
Sin169JQ804822(AC)13F: TGACAAATCACTGGGTTTACTCCT214–28453.550.56250.64430.57900.9164
R: GACATGCTGCTCTCCGATCC
Sin170JQ804823(GT)13F: CTTGAGTGGTTGATTGTGCCCT242–27055.540.71880.54910.49900.0015
R: GCAGACATTGCTGAGGGATGAA
For each locus the information in the top row refers to S. chuatsi and the second row refers to S. scherzeri. Ta corresponds to annealing temperature; Na is number of alleles; HO and HE are observed and expected heterozygosity, respectively; PIC is the polymorphic information content.
*indicates significant deviation from HWE after Bonferroni correction; no polymorphism for each locus is denoted by “—”.
Table 2. Cross-species amplification for the 46 polymorphic EST-SSR markers in four species of sinipercine fishes.
Table 2. Cross-species amplification for the 46 polymorphic EST-SSR markers in four species of sinipercine fishes.
Species

LocusS. undulateS. obscuraS. kneriC. whiteheadi
Sin10954.554.554.554.5
Sin11054.554.554.554.5
Sin11254.554.554.554.5
Sin11354.554.554.554.5
Sin11454.554.554.554.5
Sin11654.554.554.5
Sin11754.554.554.5
Sin11854.554.554.554.5
Sin11954.554.554.554.5
Sin12054.554.554.554.5
Sin12254.554.554.554.5
Sin12354.554.554.554.5
Sin12454.554.554.554.5
Sin12554.554.554.554.5
Sin12754.554.554.554.5
Sin12854.554.554.5
Sin12954.554.554.5
Sin13054.554.554.554.5
Sin13154.554.554.554.5
Sin13454.554.554.554.5
Sin13554.554.554.5
Sin13654.554.554.554.5
Sin13754.554.554.554.5
Sin13854.554.554.554.5
Sin13954.554.554.554.5
Sin14054.554.554.554.5
Sin14254.554.554.554.5
Sin14354.554.554.554.5
Sin14654.554.554.5
Sin14754.554.554.554.5
Sin14854.554.554.554.5
Sin15154.554.554.554.5
Sin15254.554.554.554.5
Sin15354.554.554.554.5
Sin15454.554.554.554.5
Sin155
Sin15654.554.554.554.5
Sin15754.554.554.554.5
Sin15854.554.554.554.5
Sin15954.554.554.552.8
Sin16054.554.554.5
Sin16254.554.557.051.1
Sin16354.554.554.552.8
Sin16654.554.554.554.5
Sin16954.554.554.554.5
Sin17054.554.554.554.5
The annealing temperature for each locus was shown. Unsuccessful amplification of PCR products for each locus is denoted by “—”.

Share and Cite

MDPI and ACS Style

Qu, C.; Liang, X.; Huang, W.; Cao, L. Isolation and Characterization of 46 Novel Polymorphic EST-Simple Sequence Repeats (SSR) Markers in Two Sinipercine Fishes (Siniperca) and Cross-Species Amplification. Int. J. Mol. Sci. 2012, 13, 9534-9544. https://doi.org/10.3390/ijms13089534

AMA Style

Qu C, Liang X, Huang W, Cao L. Isolation and Characterization of 46 Novel Polymorphic EST-Simple Sequence Repeats (SSR) Markers in Two Sinipercine Fishes (Siniperca) and Cross-Species Amplification. International Journal of Molecular Sciences. 2012; 13(8):9534-9544. https://doi.org/10.3390/ijms13089534

Chicago/Turabian Style

Qu, Chunmei, Xufang Liang, Wei Huang, and Liang Cao. 2012. "Isolation and Characterization of 46 Novel Polymorphic EST-Simple Sequence Repeats (SSR) Markers in Two Sinipercine Fishes (Siniperca) and Cross-Species Amplification" International Journal of Molecular Sciences 13, no. 8: 9534-9544. https://doi.org/10.3390/ijms13089534

APA Style

Qu, C., Liang, X., Huang, W., & Cao, L. (2012). Isolation and Characterization of 46 Novel Polymorphic EST-Simple Sequence Repeats (SSR) Markers in Two Sinipercine Fishes (Siniperca) and Cross-Species Amplification. International Journal of Molecular Sciences, 13(8), 9534-9544. https://doi.org/10.3390/ijms13089534

Article Metrics

Back to TopTop