Next Article in Journal
Possible Mechanisms of Di(2-ethylhexyl) Phthalate-Induced MMP-2 and MMP-9 Expression in A7r5 Rat Vascular Smooth Muscle Cells
Next Article in Special Issue
De Novo Transcriptome Sequencing Analysis of cDNA Library and Large-Scale Unigene Assembly in Japanese Red Pine (Pinus densiflora)
Previous Article in Journal
Next-Generation Sequencing Workflow for NSCLC Critical Samples Using a Targeted Sequencing Approach by Ion Torrent PGM™ Platform
Previous Article in Special Issue
Omics-Based Comparative Transcriptional Profiling of Two Contrasting Rice Genotypes during Early Infestation by Small Brown Planthopper
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
IJMS
Volume 16
Issue 12
10.3390/ijms161226125
ijms-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Diversity and Inheritance of Intergenic Spacer Sequences of 45S Ribosomal DNA among Accessions of Brassica oleracea L. var. capitata

by
Kiwoung Yang
1,†,
Arif Hasan Khan Robin
1,†,
Go-Eun Yi
1,
Jonghoon Lee
2,
Mi-Young Chung
3,
Tae-Jin Yang
2,* and
Ill-Sup Nou
1,*
1
Department of Horticulture, Sunchon National University, Suncheon 540-950, Korea
2
Department of Plant Science, Seoul National University, Seoul 151-742, Korea
3
Department of Agricultural Education, Sunchon National University, Suncheon 540-950, Korea
*
Authors to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Int. J. Mol. Sci. 2015, 16(12), 28783-28799; https://doi.org/10.3390/ijms161226125
Submission received: 27 October 2015 / Revised: 24 November 2015 / Accepted: 25 November 2015 / Published: 3 December 2015
(This article belongs to the Special Issue Plant Molecular Biology)
Browse Figures
Versions Notes

Abstract

:
Ribosomal DNA (rDNA) of plants is present in high copy number and shows variation between and within species in the length of the intergenic spacer (IGS). The 45S rDNA of flowering plants includes the 5.8S, 18S and 25S rDNA genes, the internal transcribed spacer (ITS1 and ITS2), and the intergenic spacer 45S-IGS (25S-18S). This study identified six different types of 45S-IGS, A to F, which at 363 bp, 1121 bp, 1717 bp, 1969 bp, 2036 bp and 2111 bp in length, respectively, were much shorter than the reported reference IGS sequences in B. oleracea var. alboglabra. The shortest two IGS types, A and B, lacked the transcription initiation site, non-transcribed spacer, and external transcribed spacer. Functional behavior of those two IGS types in relation to rRNA synthesis is a subject of further investigation. The other four IGSs had subtle variations in the transcription termination site, guanine-cytosine (GC) content, and number of tandem repeats, but the external transcribed spacers of these four IGSs were quite similar in length. The 45S IGSs were found to follow Mendelian inheritance in a population of 15 F1s and their 30 inbred parental lines, which suggests that these sequences could be useful for development of new breeding tools. In addition, this study represents the first report of intra-specific (within subspecies) variation of the 45S IGS in B. oleracea.

Graphical Abstract

1. Introduction

Ribosomes of living organisms are essential for protein synthesis, cellular growth, and organismal development. About 50% of all cellular transcription is modulated by ribosomal RNA (rRNA), which accounts for almost 80% of the total RNA in growing cells [1,2]. The presence of multiple copies of ribosomal DNA (rDNA) in eukaryotes in tandem units within the nuclear organizer region (NOR) of one or more chromosomes ensures the required level of ribosome supply [1,3]. Each rDNA repeat unit consists of coding regions for 18S, 5.8S, and 25S rRNAs, and three spacer sequences including an intergenic spacer (IGS) and two internal transcribed spacers, ITS1 and ITS2 [4,5]. The IGS contains the non-transcribed spacer (NTS) and external transcribed spacer (ETS) sequences [4,5,6] and the entire IGS region separates the 25S and 18S rRNA genes in each repeat unit (Figure 1) [5].
Together, the IGS represents a complex regulatory unit that includes repeating elements, repetitive enhancer elements, promoters and terminators of transcription, and a conserved secondary structure [4,5,6,7]. Whereas the coding regions of rDNA are highly conserved, the IGS regions display inter- and intra-specific polymorphism in both sequence and length [8,9,10,11,12,13]. In plants, the length of the IGS region in rDNA varies from 1 kb to more than 12 kb across different species from different genera [8,14]. Variability in the IGS region arises primarily from diversity in the numbers of internal sub-repeats arranged in the IGS. These internal sub-repeats, from 30 to 300 bp in length, contain duplicated core promoter in some eukaryotes [1,15,16,17,18,19]. Imbalanced or unequal crossing over within the repetitive sequences is probably responsible for the variation in copy number of the sub-repeats [17].
The variability in rDNA-IGS creates an opportunity to study interspecific and intraspecific evolutionary divergence [18]. Experimental evidence has suggested that the repeated elements of IGS might play a role in enhancing transcription in plants [20,21,22] and likely contain the signals for processing of pre-rRNAs [22,23,24]. These repeated elements may be involved in RNA polymerase I-mediated transcription [22,25]. The experimental results on the structure and sequence of the IGS also help explain the control of expression of rRNA genes.
The Brassicaceae family is characterized by the diverse nature of its member species and wide variation, even within species, in morphological and phytochemical characteristics. Cabbage (Brassica oleracea var. capitata), a subspecies within the Brassicaceae, is an agriculturally and economically important vegetable that is an integral component of the human diet in many countries of the world. Cabbage has a CC-type genome of approximately 648 Mbp in size, with 2n = 18 [26,27,28]. Genetic variation in functional anti-carcinogenic and anti-oxidant components as well as phenotypic variation among the genotypes within the cabbage subspecies are well established in the literature [29]. The structure of rDNA in B. oleracea along with the intergenic spacer (IGS) is important for achieving high level signals of transcription and processing of rRNAs. In B. oleracea, there are two types of IGS, namely 5S IGS and 45S IGS (Figure 1). The 45S IGS is located in chromosomes C7 and C8 (Figure 1). The structure of IGS regions has been studied in species and subspecies of the Brassicaceae family [18,23,30,31,32,33,34]. The variability in IGS region has not been widely exploited, although it has been used for some analyses. For example, characterization of Eruca-Brassica hybrids using DNA probes was possible using rDNA of E. sativa, which is a wild relative of Brassica species that exhibits resistance to white rust and drought [17,35]. Studies related to IGS length variation have used both DNA gel blot hybridization and PCR. Each of the methods has both advantages and disadvantages; for example, DNA gel blot hybridization uses restriction enzymes and requires a larger amount of DNA initially, whereas PCR primer-based methods cannot amplify a DNA fragments larger than 4 kb but often selectively amplify smaller DNA fragments [19]. The existing IGS sequence of the alboglabra subspecies of B. oleracea in literature is based on DNA gel blot hybridization [30,31].
This study aimed to clone and sequence IGSs of cabbage lines by exploiting PCR-based techniques. We examined IGS length variation across a number of cabbage inbred lines and their hybrids to determine the amount of variation in this trait. This study also characterized the functional elements present in the IGSs, as well as their organization and secondary structure, and finally compared them with those of B. oleracea var. alboglabra and other crop plants. To fulfill these objectives, whole-genome sequencing of rDNA was conducted, and 5S and 45S IGS regions were cloned, sequenced and compared with reference gene annotations (45s IGS sequence of B. oleracea var. alboglabra). The variability observed in the 45S IGS was analyzed and the patterns of inheritance were studied in comparatively larger parent-hybrid populations.
Ijms 16 26125 g001 1024
Figure 1. Ribosomal DNA array and organization of intergenic spacer (IGS) in Brassica oleracea based on Tremousaygue et al. [31] and the present study. Diagram shows position of 45S IGS region in between 25S and 18S rDNA subunits. TTS, transcription termination site; NTS, non-transcribed spacer; TIS, transcription initiation site and ETS, external transcribed spacer.
Figure 1. Ribosomal DNA array and organization of intergenic spacer (IGS) in Brassica oleracea based on Tremousaygue et al. [31] and the present study. Diagram shows position of 45S IGS region in between 25S and 18S rDNA subunits. TTS, transcription termination site; NTS, non-transcribed spacer; TIS, transcription initiation site and ETS, external transcribed spacer.
Ijms 16 26125 g001

2. Results

2.1. Identification of 45S Ribosomal DNA

Whole-genome sequencing generated approximately 6x coverage across four lines sequenced between 3675 Mbp and 4177 Mbp (Table S1). Further analysis of the rDNA region with PHYZEN software confirmed the presence of 45S IGS regions in chromosomes C7 and C8 (Figure 1). As the focus of this study was to explore the diversity in 45s IGS region based on PCR amplification, the whole-genome sequencing data were used as background information only. The 45S IGS region including 25S, 18S, 5.8S, ITS1, and ITS2 subunits accounted for 5802 bp in the four inbred lines. ITS1 and ITS2, measured 257 bp and 187 bp, respectively, and were also identical in the four inbred lines (Acc. KT377452 and KT377454). By contrast to the identical sequences of 5S IGS, ITS1 and ITS2; the 45S-IGS showed wider diversity (Figure S1).

2.2. Variation in 45S-IGS

Cloning and sequencing of the entire 45S-IGS region in five F1 and three inbred lines revealed six different IGS types, which we named A to F (Figure 2). The product sizes of the 45S-IGS region ranged from 363 bp to 2111 bp (Figures S2 and S3; Acc. KT377443, KT377444, KT377445, KT377446, KT377447, KT377448). These six types of IGS had average sequence similarity of 95%, with the D type the most different compared to any other type (Figure 3 and Figure S2). All six types of IGS region were much shorter than that of B. oleracea var. alboglabra [30,31] which are 3567 bp and 3788 bp in length, respectively (Figure 3 and Figure S2A). The F-type IGS was the longest we identified, but was still 1447 bp shorter than X56978, the reference sequence of 45s IGS of B. oleracea var. alboglabra (Figure 3), whereas the A-type one, at only 363 bp, was the shortest (Figure 3 and Figure S2A). The B-type IGS was more than three times longer than the A-type one and its base sequences at the end of 25S were dispersedly distributed compared to the reference sequences (Figure 3 and Figure S1). The C-type IGS had an additional 596 bp compared to the B type, and this IGS was constituted of two comparatively smaller sequences at the end of 25S and one larger sequence at the beginning of the 18S end (Figure 3 and Figure S1). The D-type IGS, 252 bp longer than the C type, was characterized by the presence of some shorter sequences in the middle rather than at the two ends (Figure 3). In addition, its 25S end was much dispersed compared to the C, E and F types but less dispersed compared to the B type (Figure 3 and Figure S1). The most symmetry in sequence organization existed between the E- and F-type IGSs, and these two longer IGS types had only 75 bp differences (Figure 3).
Ijms 16 26125 g002 1024
Figure 2. Different types of IGS (A to F types) identified in cabbage lines. (a) IGS regions identified in three cabbage inbred lines and five F1 plants and (b) cloned bands representing the six types of IGS amplified using specific PCR primers designed at the 25S-end and 18S-start regions.
Figure 2. Different types of IGS (A to F types) identified in cabbage lines. (a) IGS regions identified in three cabbage inbred lines and five F1 plants and (b) cloned bands representing the six types of IGS amplified using specific PCR primers designed at the 25S-end and 18S-start regions.
Ijms 16 26125 g002
Ijms 16 26125 g003 1024
Figure 3. Six types of IGS (A to F) identified at the 25S–18S region after cloning and sequencing based on PCR primers designed at the end of 25S and the beginning of 18S. The 45S IGS region is located in rDNA tandem repeats of nucleolar organizer region (NOR) of chromosomes 7 and 8 of B. oleracea. The PCR amplified IGSs had high sequence similarity with the reference sequences X56978 and X60324 (45s IGS sequence of B. oleracea var. alboglabra). Transcription termination site (TTS) and external transcribed spacer (ETS) were highly conserved.
Figure 3. Six types of IGS (A to F) identified at the 25S–18S region after cloning and sequencing based on PCR primers designed at the end of 25S and the beginning of 18S. The 45S IGS region is located in rDNA tandem repeats of nucleolar organizer region (NOR) of chromosomes 7 and 8 of B. oleracea. The PCR amplified IGSs had high sequence similarity with the reference sequences X56978 and X60324 (45s IGS sequence of B. oleracea var. alboglabra). Transcription termination site (TTS) and external transcribed spacer (ETS) were highly conserved.
Ijms 16 26125 g003
A phylogenic tree revealed in two major clusters for the six types of IGS (Figure S2B). The D and B types, which have dispersed sequences at the 25S end, yielded one cluster, whereas the other four IGS types were in another cluster with the reference sequences (Figure S2B). In the larger cluster, the IGS types E and F formed a close sub-cluster that was similar to the type C. The smallest IGS, A type, was the most distant in that cluster (Figure S2B). The B-type IGS had the lowest guanine-cytosine (GC) percent of 39.5 and the F-type IGS had the highest, 46.8% (Table 1). In general, the GC content was higher at the 25S end of the IGS compared to the 18S end in both B. oleracea and S. alba (Table S2). The similarity in gene size and GC% between these two species supports the validity of our results.
Table
Table 1. Best hit information from Basic Local Alignment Search Tool for nucleotides (BLASTn) of National Center for Biotechnolgoy Information (NCBI).
Table 1. Best hit information from Basic Local Alignment Search Tool for nucleotides (BLASTn) of National Center for Biotechnolgoy Information (NCBI).
IGS TypeDescriptionQuery Cover (%)E ValueIdentityAccessionGC Content (%)
IGS_AB.oleracea 25S & 18S rRNA genes737 × 10−8598%X60324.144.08
IGS_BB.oleracea 25S & 18S rRNA genes440.098%X60324.139.52
IGS_CB.oleracea 25S & 18S rRNA genes1000.096%X60324.146.53
IGS_DB.oleracea 25S & 18S rRNA genes850.087%X60324.144.59
IGS_EB.oleracea 25S & 18S rRNA genes1000.094%X60324.146.37
IGS_FB.oleracea 25S & 18S rRNA genes1000.095%X60324.146.80

2.3. Functional Elements and Domains

In recent studies, the IGS region has been investigated in detail in terms of its organization of functional elements and domains. CLC Main Workbench (http://www.clcbio.com/products/clc-main-workbench/) analyses indicated that tandem repeat regions exist in the C, D, E and F types of IGS (Figure 4). The A and B types of IGS were lacking in tandem repeat regions, TIS and ETS (Figure 4 and Figure S3) but the transcription termination sequence (TTS) was quite similar to those of the other four types of IGS (Table 2). The C to F types of IGS had similar 5’ETS sequences (738–744 bp in length, 46.3 to 49.8 GC%). Their adenine-thymine (AT) rich regions contained more than 68.9% AT, and TISs were adjacent to the AT rich regions (Figure 4, Table 2). However, the length of the repeat sequences of those four IGS types was highly variable (Figure 4, Table 2). The position of repeat sequences was 290–443 bp downstream from the TTS and that was always upstream from the TIS and ETS (Figure 4). The length of repeat sequence was 337, 511, 506 and 580 in C, D, E and F types of IGS, respectively, which were much shorter than those in the reference sequences (2040 and 2255 bp, respectively, in X56978 and X60324; Table 2). Sub-repeat sequences were 12 to 74 bp in length across the four IGS types with 84% to 97% identity among the sub-repeats (Table 2 and Table S3). By contrast, in the two reference 45S IGSs the length of sub-repeats ranged between 12 and 454 bp with 67%–97% identity (Table 2 and Table S3). The lengths of the AT rich regions of the C, E and F types of IGS were the same as in the reference sequences, 329 bp, except for the D-type IGS, which was 322 bp in that region (Table 2). The transcription initiation sequence (TIS) of the C–F IGSs was identical to that of the reference sequences (TATATAAGGGG) except the D type, which had TATATAAAGGG (Table 2). By contrast, the TTSs of the B, C and F types were identical, but one base different from the reference sequences whereas the A-type IGS had an identical TTS to the reference sequences (Table 2). The E-type IGS was one base shorter in the TTS compared to any other type including the references (Table 2). The NTS regions of the C–F types were much shorter compared to the reference sequences (Figure 4). The C-type IGS bore a shorter NTS compared to the other three types (Figure 4). All six IGS types shared 94% or higher similarity with accession number X60324, except the type D which shared 87% sequence similarity (Table 1). Notably, types C, E and F had 100% query coverage with that reference sequence (Table 1).
Table
Table 2. Annotation of variation in 45S-IGS region.
Table 2. Annotation of variation in 45S-IGS region.
IGS TypeTTS Sequence and PositionRepeat PositionConsensus Size of Tandem Repeats (bp)Percent MatchAT-rich Position (AT%)TIS Sequence and PositionETS Size (GC %)
IGS_ACCCTCCCCCTTTCT (1–14)None NoneNoneNone
IGS_BCCCTCCCCCTTTCC (1–14)None NoneNoneNone
IGS_CCCCTCCCCCTTTCC (1–14)304–64012–7285–96634–962 (69.91)TATATAAGGGG (963–973)744 (49.19)
IGS_DCCCTCCCCCATTCC (1–14)395–90519–5885–97899–1220 (68.94)TATATAAAGGG (1221–1231)738 (46.34)
IGS_ECCCTCCCCTTTCC (1–13)454–95912–7284–96953–1281 (69.60)TATATAAGGGG (1282–1292)744 (49.19)
IGS_FCCCTCCCCCTTTCC (1–14)455–103412–7484–961028–1356 (69.60)TATATAAGGGG (1357–1367)744 (49.19)
X56978CCCTCCCCCTTTCT (1–14)456–249512–45468–962489–2817 (70.21)TATATAAGGGG (2818–2828)739 (49.80)
X60324CCCTCCCCCTTTCT (1–14)457–271112–25067–972705–3033 (70.21)TATATAAGGGG (3034–3044)744 (49.33)
Repeat position was obtained using tandem repeat finder (http://tandem.bu.edu/trf/trf.html) comparing with accession no. X60324 of NCBI. AT-rich was identified using CLC Main Workbench 7.5.1.
Ijms 16 26125 g004 1024
Figure 4. Functional elements and domains identified in the six IGS types. The transcription initiation site (TIS) of B. oleracea sequence is TATATAAGGGG (black down-arrow) for C, E, F and reference sequences X56978 and X60324, and that of the D type is TATATAAAGGG. Violet dashed line represents tandem repeat region, green line represents AT-rich region, orange dashed line represents ETS region, red and blue bars respectively represent the locations of GC and AT bases. The A and B types are devoid of tandem repeats, TIS and ETS. Transcription termination site is located at the beginning of 3’ end.
Figure 4. Functional elements and domains identified in the six IGS types. The transcription initiation site (TIS) of B. oleracea sequence is TATATAAGGGG (black down-arrow) for C, E, F and reference sequences X56978 and X60324, and that of the D type is TATATAAAGGG. Violet dashed line represents tandem repeat region, green line represents AT-rich region, orange dashed line represents ETS region, red and blue bars respectively represent the locations of GC and AT bases. The A and B types are devoid of tandem repeats, TIS and ETS. Transcription termination site is located at the beginning of 3’ end.
Ijms 16 26125 g004

2.4. Variable IGS Inheritance

We explored the inheritance of IGS sequence because our above findings of variability within subspecies suggested that this might open a new window of using IGS as a breeding tool. When the heredity of IGS was tested in a population consisting of 15 F1 lines and their 30 parents, all progeny were found to harbor the parental-type IGSs (Figure 5). For eight out of 15 F1 samples, the male and female parents had similar IGSs and the progeny contained the same type (Figure 5). Four F1 progeny produced the male parental type (nos. 1, 4, 28 and 43 in Table 3C) IGS, and three F1s progeny produced the female parental type IGS (nos. 7, 31 and 34 in Table 3C) (Figure 5). Out of 45 parents and F1 progeny, the A-type IGS was found in 29 lines, although some of them had other IGS types coupled with the A type (Figure 5). The A type of IGS was present in F1 progeny 9051 × 3074 (no. 10 in Table 3C), 2409 × 8S8-7 (no. 13), 26S × NC1 (no. 16), 842 × 2409 (no. 37), and 496B × 2409 (no. 40) with both of their parents (Figure 5). The F1 2409 × 8S8-7 (no. 13) and its female parent, F1 832 × 755 (no. 25) and both parents, and F1 337S × 94 (no. 31) and its female parent had the B type of IGS (Figure 5). The F1 832 × 755 (no. 25) and both of its parents bore both C- and D-type IGSs (Figure 5).

3. Discussion

Sequencing of ribosomal spacers involves some difficulties. Firstly, the IGS is a highly folded non- protein-coding region and so is not comparable to commonly used protein or cDNA sequences. Secondly, rDNA units are highly repeated (Figure 4). Thirdly, the IGS sequence is unusually GC-rich. Moreover, next-generation sequencing can sequence 45S rDNA only by excluding its IGS region. For these reasons, we chose PCR-based cloning and sequencing in this study to determine IGS sequences. Interestingly the lengths of all six types of 45S IGS we identified (Figure 2 and Figure 3) were much shorter than the reference sequences GenBank: X56978 [30] and GenBank: X60324 [31]. In addition, one or a few more additional IGS other than the six identified are possible those are larger than 3000 bp (Figure 5). The longest, F-type IGS identified in this study was 1456 bp and 1677 bp shorter than X56978 and X60324, respectively. Both Tremousaygue et al. [30] and Bennett and Smith [31] conducted restriction enzyme-based cloning in B. oleracea var. alboglabra, which is dependent on the recognition site whereas our study was based on specifically-designed PCR primers. Therefore, the differences in IGS sequences are probably partly explained by methodical differences and partly by subspecies differences. It is important to note that the restriction enzymes used in those two studies, EcoR1 and BamH1, also digest some portion of 25S and 18S sequence along with 25S-18S IGS. By contrast, one of the disadvantages of PCR primer-based cloning is selective amplification of small DNA fragments. Therefore, further confirmation is required for the existence of the two smallest types we identified, the A and B types, as these two IGS were devoid of any repeated elements, the ETS and the TIS (Figure 4) even though they had TTS sequence (Table 2). However, nucleotide comparison through BLAST search with NCBI reference sequence confirmed 98% identity for both A and B types compared with reference X60324 of B. oleracea var. alboglabra [31]. It is possible that these two IGSs were subject to large deletions at their downstream end during evolution.
Ijms 16 26125 g005 1024
Figure 5. Different sizes of 45S (25S-18S) IGS sequences observed in 30 inbred lines of cabbage and their 15 F1 progeny. The line numbers correspond to those in Table 3C. Within each red box the first, second, and third lanes represent F1, female parent, and male parent, respectively. M, 100 bp ladder.
Figure 5. Different sizes of 45S (25S-18S) IGS sequences observed in 30 inbred lines of cabbage and their 15 F1 progeny. The line numbers correspond to those in Table 3C. Within each red box the first, second, and third lanes represent F1, female parent, and male parent, respectively. M, 100 bp ladder.
Ijms 16 26125 g005
Sequences of IGS regions are also difficult to elucidate because as one individual cell may retain more than one type of IGS (Figure 2 and Figure 5). Tremousaygue et al. [31] published an updated sequence of the IGS region of B. oleracea var. alboglabra after Bennett and Smith [30] which is 206 bp longer. That variation is explained by the different digestion sites of EcoR1 used by [31] and BamH1 used by [30]. However, Tremousaygue et al. [31] marked internal sequence variation in sequence with that of Bennett and Smith [30] as errors associated with reading errors. In our study, several PCR conditions have been tested and obtained similar bands. The other way to confirm the size of the IGS is to digest total DNA with a restriction enzyme which does not cut within the IGS and to hybridize with the appropriate probe. Such an experiment would further validate the size of the IGS and would confirm its variability.
Intra-specific length and sequence heterogeneity among different types of IGS, sometimes even within an individual plant, as observed in our study (Figure 2 and Figure 3) is a common feature of IGSs in almost all plant species studied. Heterogeneity of IGS in Brassicaceae family was first reported in Arabidopsis [36,37]. During evolutionary development of species, any insertion or deletion of AT-rich or GC-rich sequences in the tandem repeat region may also accelerate the length heterogeneity. Other probable causes are deletions, possibly reflected in the A- and B-type IGSs of our study, or duplications of the sub-repeat regions [38,39,40] or of the ETS [41,42], and duplications of the promoter region [32,39]. The 5’ETS length observed in this study was consistent with those reported for B. oleracea alboglabra and Raphanus sativa [43], while widely variable ETS lengths were recorded in other plant species, for example, 5.8 kb in Medicago [44], 1227 to 1735 bp in Oryza [45], 1155 to 2226 bp in Vigna [25] and 529 to 823 bp in Zea [46].
The length and occurrence of sub-repeats is another source of variation in IGS sequences (Table S3, Figure S3). The length of the repeat elements in our study ranged between 12 to 74 bp in C- to F-type IGSs (Table 2). In some other plant species, the repeat region is much longer, for instance, 130 bp in wheat [47], 200 bp in maize [16], 325 bp in Vicia faba [15], and 460 bp in carrot [48]. In potato, the length of sub-repeats ranged between 20 and 56 bp [49]. Similar to E. sativa [17], Arabidopsis [32], and Sisymbrium irio [50], we found repeat families downstream of the putative TTS in cabbage (Figure 4).
The presence of a TATA box in the core promoter of TIS was the characteristic feature of B. oleracea var. capitata 45S IGS (Table 2), similar to those of B. oleracea var. alboglabra [30,31] and Medicago [43,51]. In the C–F types of IGS, the presence of motifs and domains putatively associated with initiation and termination of rRNA transcription and the presence of rDNA promoters, promoter/enhancer elements and TATA box involved in the transcription by RNA polymerase I, indicated that the structural variants of IGS possess the necessary regulatory elements to be functional [1,20,25,32,39,45,52,53,54]. In addition, the identical sequence of TIS for most of the identified IGS indicated that this sequence is generally conserved (Table 2).
Prediction of secondary structure and associated dG values can indicate at what level IGS sequences are active in producing ribosomes for the biosynthesis of proteins. In secondary structure prediction, mfold estimates free-energy as dG value. The predicted secondary structures and their free energies, as calculated using our results, indicated that the IGS regions form extensive and strong secondary structures with negative free-energy to start spontaneous production of protein. Free energy is available for transcriptional regulation by the non-coding RNA transcripts, initiation of replication at the AT-rich region and production of pre-rRNA transcript at the 5’ETS region. We divided the IGS sequences of the C and D types into four regions: Region 1, TTS and adjacent region; Region 2, NTS region; Region 3, AT-rich region and Region 4, TIS and 5’ETS region (Table 4). Free energies predicted as dG at Region 3 (−46 to −54 kcal·mol−1) and Region 4 (−273 kcal·mol−1 except D-type IGS) were quite similar for the four IGS types and the reference sequences X56978 and X60324 (Table 4). Region 1 was predicted to have much lower dG for E- and F-type IGSs compared to C- and D-type IGSs. The E-type IGS was predicted to form four additional loops in its secondary structure at Region 1 compared to the C-type IGS (Figure 6). The predicted dG value greatly differed at Region 2, the sub-repeat region, among the four IGS types (Table 4). The C-type IGS had an 80 kcal·mol−1 higher dG value that predicted three fewer loops compared to the E type (Figure 6). Low-energy secondary structure models suggest that with their low free-energy levels, the highly conserved structures, for example 5’ETS, possibly act as evolutionary constraints [55].
Ijms 16 26125 g006a 1024Ijms 16 26125 g006b 1024
Figure 6. Predicted secondary structures of (a) TTS and adjacent region (Region 1) and (b) NTS region (Region 2) of C and E type 45S IGS of B. oleracea var. capitata and their minimum free energies.
Figure 6. Predicted secondary structures of (a) TTS and adjacent region (Region 1) and (b) NTS region (Region 2) of C and E type 45S IGS of B. oleracea var. capitata and their minimum free energies.
Ijms 16 26125 g006aIjms 16 26125 g006b
Out of 15 F1 lines, none produced any intermediate or off-parental type offspring. These results are suggestive of complete dominance of the variable IGS (Figure 5). However the issue should be further examined in subsequent segregating generations for confirmation. Our preliminary results suggest that IGS sequence could potentially be used as molecular markers in breeding programs, especially in selection of desired hybrids from a large number of crosses.

4. Materials and Methods

4.1. Plant Materials and DNA Extraction

Seed of three different sets of B. oleracea L. var. capitata subspecies was purchased from Asia Seed Co., Ltd. (Seoul, Korea) (Table 3). A set of four inbred cabbage lines was used for whole-genome sequencing (Table 3A), a set of eight genotypes (three inbred lines and five F1s) was used to study the 5S and 45S IGSs, as well as ITS1 and ITS2 after cloning and sequencing (Table 3B), and a set of thirty inbred lines and their fifteen F1 hybrids were used to test the inheritance pattern of 45S IGS (Table 3C).
Plants were raised under fluorescent lights in a growth chamber for 30 days before leaf samples were collected from theselected plants of each parental line or their F1 progenies. The seedlings were raised in garden soil mixed with peat moss, coco peat, perlite, zeolite, and vermiculite. The fresh leaves were snap frozen with liquid nitrogen and stored at −80 °C until DNA extraction. Genomic DNA of all cabbage genotypes was isolated according to the instructions provided by the manufacturer by using the DNeasy Plant Mini Kit (QIAGEN, Hilden, Germany). Quality and quantity of DNA extracted were monitored by electrophoresis on 1% gel agarose with undigested lambda DNA and confirmed using a Nanodrop ND-1000 spectrophotometer (NanoDrop, Wilmington, DE, USA).

4.2. Whole-Genome Sequencing

Whole-genome sequences of the selected genotypes were acquired via next-generation sequencing (NGS) using the Illumina HiSeq platform (Illumina, San Diego, CA, USA). The sequences obtained after NGS were used to design primers for the ITS1 and ITS2 and IGS regions. Ribosomal DNA was analyzed using PHYZEN (http://phyzen.com).

4.3. PCR Amplification Cloning and Sequencing

Primers were designed to clone the 45s IGS at the 3′ end of 25s rRNA subunit and 5′ end of 18s rRNA subunit based on published reference sequences of Sinapsis alba (Accession nos. 5S: X56866 [56]; 45S: X66325 [57]) and those were also compared with our whole genome sequencing data (Table 5, Figure 1). Primer3 software was used for designing primers (http://primer3.ut.ee/; Table 5). Primers were also designed to clone 5S IGS, ITS1 and ITS2 following the reference sequences of Sinapsis alba (Table 5) [56,57]. Two different intergenic primers were required to develop for D type 45s IGS and C, E and F types 45s IGS as the cloning kit used was only able to clone a sequence smaller than 1000 bp at a time, at the downstream of 3′ end of 25s rRNA subunit and at the upstream of 5′ end of 18s rRNA subunit (Table 5). Both D type and CEF type intergenic primer sequences were designed approximately 900 bp apart from the 3′ end of 25s rRNA subunit. Emerald PCR master mixture (Takara, Shiga, Japan) was used for PCR amplification of rDNA. PCR amplifications were carried out by incubation at 95 °C for 3 min followed by 35 cycles of denaturation, annealing and extension. Denaturation was carried out at 95 °C for 1 min, primer annealing at 55 °C for 1 min and primer extension at 72 °C for 1 min, followed by a final extension step of 5 min at 72 °C in an Eppendorf thermal cycler (Eppendorf AG, Hamburg, Germany). The PCR products were visualized on 1% agarose gels as a single band with a 100 bp ladder DNA. The amplified DNA fragments were purified using Promega Purification kit (Promega, Madison, WI, USA) according to the manufacturer’s instructions. Cloning was performed using the TOPO TA cloning kit (Invitrogen, Carlsbad, CA, USA). The cloning was conducted following the manufacturer’s instructions but the reaction was downscaled to half. Three clones were selected for sequencing against each IGS type. The cloned DNAs were sequenced with the universal primers M13F and M13RpUC using the ABI 3730XL sequencer (Macrogen Co., Seoul, Korea). To eliminate ambiguities, each sequencing reaction was repeated three times, especially in places where there were no reverse primers. Sequences obtained were initially compared with reference sequence Sinapsis alba (Accession nos. 5S: X56866 [56]; 45S: X66325 [57]) to compare gene size and GC content as high similarity exists for rDNA between B. oleracea and S. alba. The 45S IGC sequences were then analyzed using CLC Main Workbench version 7 (CLC, Aarhus, Denmark) coupled with NCBI reference accessions X56978 and X60324 of B. oleracea var. alboglabra.
Table
Table 3. Plant materials obtained from the Asia Seed Co., Ltd. (Seoul, Korea). Materials were used to (A) study whole-genome sequence of rDNA through next-generation sequencing (NGS); (B) clone and sequence ITS1, ITS2, and IGS regions; (C) test 45S IGS variation in 30 inbred lines and their 15 F1s, F = female parent line, M = male parent line.
Table 3. Plant materials obtained from the Asia Seed Co., Ltd. (Seoul, Korea). Materials were used to (A) study whole-genome sequence of rDNA through next-generation sequencing (NGS); (B) clone and sequence ITS1, ITS2, and IGS regions; (C) test 45S IGS variation in 30 inbred lines and their 15 F1s, F = female parent line, M = male parent line.
(A) Inbred Lines for NGS(B) F1 Combination or Parents(C) Lines and F1s to Test 45S IGS Variation
Sl. no.LineSl. no.Lines or cross combinationsTypeSl. No.Lines or cross combinationsTypeSl. No.Lines or cross combinationsTypeSl. No.Lines or cross combinationsType
1Asiaseed-1418352 × 636F111464 × 621F11626S × NC1F131337S × 94F1
2Asiaseed-1722418 × CT5-51F121464F1726SF32337SF
3Asiaseed-283842 × 621F13621M18NC1M3394M
4Asiaseed-31494Inbred line48352 × 636F119337 × P15-41F134IB14 × DWBF1
5IB14Inbred line58352F20337F35IB14F
6842Inbred line6636M21P15-41M36DWBM
7496B × 2409F17225 × 95F1222418 × CT5-51F137842 × 2409F1
89051 × PKT-41F18225F232418F38842F
994M24CT5-51M392409M
109051 × 3074F125632 × 755F140496B × 2409F1
119051F26632F41496BF
123074M27755M422409M
132409 × 8S8-7F128842 × 621F1439051 × PKT-41F1
142409F29842F449051F
158S8-7M30621M45PKT-41M
Table
Table 4. Maximum negative dG (predicted free energies, kcal·mol−1) values obtained during putative secondary structure formation in four different regions (R) of 45S IGS.
Table 4. Maximum negative dG (predicted free energies, kcal·mol−1) values obtained during putative secondary structure formation in four different regions (R) of 45S IGS.
45S IGSTTS + 3’ETS Region, Region 1NTS Region, Region 2AT-rich Region, Region 35’ETS Region, Region 4
C type−62−108−48−273
D type−67−171−46−239
E type−114−188−58−273
F type−113−209−58−273
X56978−110Not obtained−54−277
X60324−107Not obtained−54−276
Table
Table 5. Primers designed using Primer3 software to identify 5S and 45S (25S-18S) IGS, ITS1, and ITS2 of B. oleracea var. capitata.
Table 5. Primers designed using Primer3 software to identify 5S and 45S (25S-18S) IGS, ITS1, and ITS2 of B. oleracea var. capitata.
NameForward and Revers PrimersProduct SizeComment
Bo 5S IGSF: ACTAGGATGGGTGACCTCCCG;4845S-IGS product size
R: CGCTTAACTGCGGAGTTCTGA
Bo ITS1 and 2F: CGCGAGAAGTCCACTAAACC;823Identify sequence differences
R: ACGTCCGATTTTCAAGCTGG
Bo 45S IGSF: ATTCAGCCCTTTGTCGCTAA;variable45S-IGS product size
R: ATGACTACTGGCAGGATCAACCAG
IGS inter-DATCGTGTAGGACCGAGAAGT D type intergenic
IGS inter-CEFGGTAGGCACAAAAGGAATGC C, E and F type intergenic

4.4. Sequence Analysis

The entire IGS region was assembled into a contig file by aligning the overlapped sequences of DNA. The sequences were analyzed using CLC Main Workbench version 7 to identify functional elements and domains of IGS, e.g., ETS, NTS and AT-rich regions. The transcription initiation site (TIS) and transcription termination site (TTS) were compared with those of Fagus and Quercus [58]. Multisequence alignments were generated by the program mVISTA using the ClustalW method [59] with gap opening penalty of 15 and gap extension penalty of 6. Repeat positions in the identified 45S IGS and NCBI reference sequences X56978 and X60324 were determined using tandem repeat finder (http://tandem.bu.edu/trf/trf.html) and the results were prepared using Dot matrix view software from NCBI after a BLAST search [60]. CLC Main Workbench version 7 software was used to generate the maximum-likelihood phylogeny trees tools. The Jukes-Cantor nucleotide distance measure was used for neighbour-joining. Finally, the phylogeny trees were generated using Molecular Evolutionary Genetics Analysis version 6 (MEGA6, http://www.megasoftware.net/) [61]. The secondary structure of 45S IGS was predicted using the mfold Web Server (http://mfold.rna.albany.edu/?q=mfold). The following accession numbers: KT377443–KT377455 were obtained after submitting the nucleotide sequences to the GenBank database.

5. Conclusions

The objective of this study was to examine the rDNA sequence in B. oleracea var. capitata coupled with investigating any variability in 45S IGS sequence (25S-18S IGS) based on PCR-based sequencing. There was no variation in ITS1 and ITS2 sequences in four inbred cabbage lines based on next-generation sequencing. However, our PCR-based cloning and sequencing identified six heterogeneous IGS types. Two IGS types were devoid of any sub-repeats, TISs and ETSs suggesting a major deletion in 45S IGS, but these two IGSs had putative TTSs and BLASTn searches showed up to 98% sequence identity with B. oleracea var. alboglabra. The other four IGS types had comparable ETS, TIS and TTS regions with subtle variation. The length of the repeat region of these four IGS types were remarkably shorter than reference sequences, which is consistent with the strikingly lower number of sub-repeats present in the identified IGSs. The 45S IGS regions identified here in cabbage were polymorphic in 15 F1 lines and their 30 inbred male and female parental lines. The IGS fragments in the F1 generation were of either male or female parental type. The inheritance pattern of IGS supports their potential uses in breeding as molecular markers. Variation of IGSs between cabbage lines and the NCBI reference IGS of B. oleracea var. alboglabra and the existence of polymorphic IGS fragments within genotypes highlight the need for further examination of IGS sequence in B. oleracea. Moreover, the functionality of variable IGS types in rRNA synthesis is a subject of further investigation.
Table
GenBank accession numbers:
GenBank accession numbers:
KT37744345S intergenic spacer (A type)PCR-primer amplified
KT37744445S intergenic spacer (B type)
KT37744545S intergenic spacer (C type)
KT37744645S intergenic spacer (D type)
KT37744745S intergenic spacer (E type)
KT37744845S intergenic spacer (F type)
KT3774505S intergenic spacer
KT377452Internal transcribed spacer 1
KT377454Internal transcribed spacer 2

Supplementary Materials

Supplementary materials can be found at https://www.mdpi.com/1422-0067/16/12/26125/s1.

Acknowledgments

We thank the Asia Seed Co., Ltd., Republic of Korea for providing B. oleracea seeds. This study was supported by the Golden Seed Project (Center for Horticultural Seed Development, No. 213003-04-3-SB110 and 213003-04-3-SB430) of the Ministry of Agriculture, Food and Rural Affairs in the Republic of Korea (MAFRA).

Author Contributions

Ill-Sup Nou, Tae-Jin Yang, Jonghoon Lee and Mi-Young Chung conceived and designed the study. Kiwoung Yang conducted in silico analysis. Go-Eun Yi managed the experimental plants and assisted Kiwoung Yang in sample preparation, DNA isolation, purification, and cloning. Arif Hasan Khan Robin provided technical advice to prepare tables and figures to Go-Eun Yi and Kiwoung Yang, organized data, and wrote the manuscript.

Conflicts of Interest

The authors declare no conflict of interest.

Abbreviations

rDNA: Ribosomal DNA; IGS: Intergenic spacer; ETS: External transcribed spacer; ITS: Internal transcribed spacer; NOR: Nucleolus organizer region; NTS: Non-transcribed spacer; TIS: Transcription initiation site; TTS: Transcription termination site; PCR: Polymerase chain reaction.

References

  1. Moss, T.; Stefanovsky, V.Y. Promotion and regulation of ribosomal transcription in eukaryotes by RNA polymerase 1. Prog. Nucl. Acid Res. Mol. Biol. 1995, 50, 25–66. [Google Scholar]
  2. Paule, M.R.; Lofquist, A.K. Organization and expression of eukaryotic ribosomal RNA genes. In Ribosomal RNA Structure, Evolution, Processing and Function in Protein Biosynthesis; Zimmermann, R.A., Dahlberg, A.E., Eds.; CRC Press: New York, NY, USA, 1996; pp. 395–419. [Google Scholar]
  3. Appels, R.; Honeycutt, R.L. rDNA: evolution over a billion years. In DNA Systematics; Dutta, S.K., Ed.; CRC Press: Boca Raton, FL, USA, 1986; Volume 2, pp. 81–135. [Google Scholar]
  4. Kahl, G. Architecture of Eukaryotic Genes; VCH Verlagsgesellschaft: Weinheim, Germany, 1988. [Google Scholar]
  5. Poczai, P.; Hyvonen, J. Nuclear ribosomal spacer regions in plant phylogenetics: Problems and prospects. Mol. Biol. Rep. 2010, 37, 1897–1912. [Google Scholar] [CrossRef] [PubMed]
  6. Baldridge, G.D.; Dalton, M.W.; Fallon, A.M. Is higher-order structure conserved in eukaryotic ribosomal DNA intergenic spacers? J. Mol. Evol. 1992, 35, 514–523. [Google Scholar] [CrossRef] [PubMed]
  7. Reeder, R.H. Regulatory elements of the generic ribosomal gene. Curr. Opin. Cell Biol. 1989, 1, 466–474. [Google Scholar] [CrossRef]
  8. Rogers, S.O.; Bendich, A.J. Ribosomal RNA genes in plants: Variability in copy number and in the intergenic spacer. Plant Mol. Biol. 1987, 9, 509–520. [Google Scholar] [CrossRef] [PubMed]
  9. Gerstner, J.; Schiebel, K.; von Waldburg, G.; Hemleben, V. Complex organization of the length heterogeneous 50 external spacer of mung bean (Vigna radiata) ribosomal DNA. Genome 1988, 30, 723–733. [Google Scholar] [CrossRef] [PubMed]
  10. Hemleben, V.; Ganal, M.; Gerstner, J.; Schiebel, K.; Torres, R.A. Organization and length heterogeneity of plant ribosomal RNA genes. In The Architecture of Eukaryotic Genes; Kahl, G., Ed.; VHC: Weinheim, Germany, 1988; pp. 371–383. [Google Scholar]
  11. Jorgansen, R.A.; Cluster, P.D. Modes and tempos in the evolution of nuclear ribosomal DNA: New characters for evolutionary studies and new markers for genetic and population studies. Ann. Mo. Bot. Gard. 1988, 75, 1238–1247. [Google Scholar] [CrossRef]
  12. Schaal, B.A.; Learn, G.H.J. Ribosomal DNA variation with and among plant populations. Ann. Mo. Bot. Gard. 1988, 75, 1207–1216. [Google Scholar] [CrossRef]
  13. Weider, L.J.; Elser, J.J.; Crease, T.J.; Mateos, M.; Cotner, J.B. The functional significance of ribosomal (r) DNA variation: Impacts on the evolutionary ecology of organisms. Annu. Rev. Ecol. Evol. Syst. 2005, 36, 219–242. [Google Scholar] [CrossRef]
  14. Kim, K.J.; Mabry, T.J. Phylogenetic and evolutionary implications of nuclear ribosomal DNA variation in dwarf dandelions (Krigia, Lactuceae, Asteraceae). Plant Syst. Evol. 1991, 177, 53–69. [Google Scholar] [CrossRef]
  15. Yakura, K.; Kato, A.; Tanifuji, S. Length heterogeneity in the large spacer of Vicia faba rDNA is due to the differing number of a 325 bp repetitive sequence element. Mol. Gen. Genet. 1984, 193, 400–405. [Google Scholar] [CrossRef]
  16. Toloczyki, C.; Feix, G. Occurrence of nine homologous repeat units in the external spacer of a nuclear maize rRNA gene unit. Nucleic Acids Res. 1986, 14, 4969–4986. [Google Scholar] [CrossRef] [PubMed]
  17. Lakshmikumaran, M.; Negi, M.S. Structural analysis of two length variants of the rDNA intergenic spacer from Eruca sativa. Plant Mol. Biol. 1994, 24, 915–927. [Google Scholar] [CrossRef] [PubMed]
  18. Bhatia, S.; Negi, M.S.; Lakshmikumaran, M. Structural analysis of the rDNA intergenic spacer of Brassica nigra: Evolutionary divergence of the spacers of the three diploid Brassica species. J. Mol. Evol. 1996, 43, 460–468. [Google Scholar] [CrossRef] [PubMed]
  19. Mateos, M.; Markow, T.A. Ribosomal intergenic spacer (IGS) length variation across the Drosophilinae (Diptera: Drosophilidae). BMC Evol. Biol. 2005, 5, 46. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  20. Maggini, F.; Tucci, G.; Demartis, A.; Gelati, M.T.; Avanzi, S. Ribosomal RNA genes of Phaseolus coccineus. I. Plant Mol. Biol. 1992, 18, 1073–1082. [Google Scholar] [CrossRef] [PubMed]
  21. Sardana, R.; O’Dell, M.; Flavell, R.B. Correlation between the size of the intergenic regulatory region, the status of cytosine methylation of rRNA genes and nucleolar expression in wheat. Mol. Gen. Genet. 1993, 236, 155–162. [Google Scholar] [CrossRef] [PubMed]
  22. Hemleben, V.; Zentgraf, U. Structural organization and regulation of transcription by RNA polymerase I of plant nuclear ribosomal RNA genes. In Results and Problems in Cell Differentiation 20. Plant Promoters and Transcription Factors; Nover, L., Ed.; Springer: Berlin, Germany, 1994; pp. 3–24. [Google Scholar]
  23. Da Rocha, P.S.C.F.; Bertrand, H. Structure and comparative analysis of the rDNA intergenic spacer of Brassica rapa: Implications for the function and evolution of the Cruciferae spacer. Eur. J. Biochem. 1995, 229, 550–557. [Google Scholar] [CrossRef] [PubMed]
  24. Fernández, M.; Polanco, C.; Ruiz, M.L.; Pérez De La Vega, M. A comparative study of the structure of the rDNA intergenic spacer of Lens culinaris Medik., and other legume species. Genome 2000, 43, 597–603. [Google Scholar] [CrossRef] [PubMed]
  25. Schiebel, K.; von Waldburg, G.; Gerstner, J.; Hemleben, V. Termination of transcription of ribosomal RNA genes of mung bean occurs within a 175 bp repetitive element of the spacer region. Mol. Gen. Genet. 1989, 218, 302–307. [Google Scholar] [CrossRef] [PubMed]
  26. Warwick, S.I.; Francis, A.; Al-Shehbaz, I.A. Brassicaceae: Species checklist and database on CD-Rom. Plant Syst. Evol. 2006, 259, 249–258. [Google Scholar] [CrossRef]
  27. Johnston, J.S.; Pepper, A.E.; Hall, A.E.; Chen, Z.J.; Hodnett, G.; Drabek, J.; Price, H.J. Evolution of genome size in Brassicaceae. Ann. Bot. 2005, 95, 229–235. [Google Scholar] [CrossRef] [PubMed]
  28. Parkin, A.C.; Koh, H.; Tang, S.J.; Robinson, S.; Kagale, W.E. Transcriptome and methylome profiling reveals relics of genome dominance in the mesopolyploid Brassica oleracea. Genome Biol. 2014, 15, 77. [Google Scholar] [CrossRef] [PubMed]
  29. Yi, G.E.; Robin, A.H.K.; Yang, K.W.; Park, J.I.; Kang, J.G. Identification and Expression Analysis of Glucosinolate Biosynthetic Genes and Estimation of Glucosinolate Contents in Edible Organs of Brassica oleracea subspecies. Molecules 2015, 20, 13089–13111. [Google Scholar] [CrossRef] [PubMed]
  30. Bennett, R.I.; Smith, A.G. The complete nucleotide sequence of the intergenic spacer region of an rDNA operon from Brassica oleracea and its comparison with other crucifers. Plant Mol. Biol. 1991, 16, 1095–1098. [Google Scholar] [CrossRef] [PubMed]
  31. Tremousaygue, D.; Laudie, M.; Grellet, F.; Delseny, M. The Brassica oleracea rDNA spacer revisited. Plant Mol. Biol. 1992, 18, 1013–1018. [Google Scholar] [CrossRef] [PubMed]
  32. Gruendler, P.; Unfried, I.; Pascher, K.; Schweizer, D. rDNA intergenic region from Arabidopsis thaliana Structural analysis, intraspecific variation and functional implications. J. Mol. Biol. 1991, 221, 1209–1222. [Google Scholar] [CrossRef]
  33. Doelling, J.H.; Gaudino, R.J.; Pikaard, C.S. Functional analysis of Arabidopsis thaliana rRNA gene and spacer promoters in vivo and by transient expression. Proc. Natl. Acad. Sci. USA 1993, 90, 7528–7532. [Google Scholar] [CrossRef] [PubMed]
  34. Doelling, J.H.; Pikaard, C.S. The minimal ribosomal RNA gene promoter of Arabidopsis thaliana includes a critical element at the transcription initiation site. Plant J. 1995, 8, 683–692. [Google Scholar] [CrossRef] [PubMed]
  35. Agnihotri, A.; Gupta, V.; Lakshmikumaran, M.; Shivanna, K.R.; Prakash, S. Production of Eruca- Brassica hybrids by embryo rescue. Plant Breed. 1990, 104, 281–289. [Google Scholar] [CrossRef]
  36. Copenhaver, G.P.; Pikaard, C.S. RFLP and physical mapping with an rDNA-specific endonuclease reveals that nucleolus organizer regions of Arabidopsis thaliana adjoin the telomeres on chromosomes 2 and 4. Plant J. 1996, 9, 259–272. [Google Scholar] [CrossRef] [PubMed]
  37. Abou-Ellail, M.; Cooke, R.; Sáez-Vásquez, J. Variations in a team: Major and minor variants of Arabidopsis thaliana rDNA genes. Nucleus 2011, 2, 294–299. [Google Scholar] [CrossRef] [PubMed]
  38. Zentgraf, U.; Ganal, M.; Hemleben, V. Length heterogeneity of the rRNA precursor in cucumber (Cucumis sativus). Plant Mol. Biol. 1990, 15, 465–474. [Google Scholar] [CrossRef] [PubMed]
  39. Bauer, N.; Horvat, T.; Birus, I.; Vicic, V.; Zoldos, V. Nucleotide sequence, structural organization and length heterogeneity of ribosomal DNA intergenic spacer in Quercus petraea (Matt.) Liebl. and Q. robur L. Mol. Genet. Gen. 2009, 281, 207–221. [Google Scholar] [CrossRef] [PubMed]
  40. Ambrose, C.; Crease, T. Evolution of the nuclear ribosomal DNA intergenic spacer in four species of the Daphnia pulex complex. BMC Genet. 2011, 12, 13. [Google Scholar] [CrossRef] [PubMed]
  41. Borisjuk, N.V.; Davidjuk, Y.M.; Kostishin, S.S.; Miroshnichenco, G.P.; Velasco, R. Structural analysis of rDNA in the genus Nicotiana. Plant Mol. Biol. 1997, 35, 655–660. [Google Scholar] [CrossRef] [PubMed]
  42. Komarova, N.Y.; Grabe, T.; Huigen, D.J.; Hemleben, V.; Volkov, R.A. Organization, differential expression and methylation of rDNA in artificial Solanum allopolyploids. Plant Mol. Biol. 2004, 56, 439–463. [Google Scholar] [CrossRef] [PubMed]
  43. Delcasso-Tremousaygue, D.; Grellet, F.; Panabieres, F.; Ananiev, E.D.; Delseny, M. Structural and transcriptional characterization of the external spacer of a ribosomal RNA nuclear gene from a higher plant. Eur. J. Biochem. 1988, 172, 767–776. [Google Scholar] [CrossRef] [PubMed]
  44. Bena, G.; Jubier, M.F.; Olivieri, I.; Lejeune, B. Ribosomal external and internal transcribed spacers: Combined use in the phylogenetic analysis of Medicago (Leguminosae). J. Mol. Evol. 1998, 46, 299–306. [Google Scholar] [CrossRef] [PubMed]
  45. Cordesse, F.; Cooke, R.; Tremousaygue, D.; Grellet, F.; Delseny, M. Fine structure and evolution of the rDNA intergenic spacer in rice and other cereals. J. Mol. Evol. 1993, 36, 369–379. [Google Scholar] [CrossRef] [PubMed]
  46. McMullen, M.D.; Hunter, B.; Philips, R.L.; Rubenstein, I. The structure of the maize ribosomal DNA spacer region. Nucleic Acids Res. 1986, 14, 4953–4969. [Google Scholar] [CrossRef] [PubMed]
  47. Barker, R.F.; Harberd, N.P.; Jarvis, M.G.; Flavell, R.B. Structure and evolution of the intergenic region of a ribosomal DNA repeat unit of wheat. J. Mol. Biol. 1988, 201, 1–17. [Google Scholar] [CrossRef]
  48. Taira, T.; Kato, A.; Tanifuji, S. Difference between two major size classes of carrot rDNA repeating units is due to reiteration of sequences of about 460 bp in the large spacer. Mol. Gen. Genet. 1988, 213, 170–174. [Google Scholar] [CrossRef] [PubMed]
  49. Borisjuk, N.; Hemleben, V. Nucleotide sequence of the potato rDNA intergenic spacer. Plant Mol. Biol. 1993, 21, 381–384. [Google Scholar] [CrossRef] [PubMed]
  50. Grellet, F.; Delcasso-Tremousaygue, D.; Delseny, M. Isolation and characterization of an unusual repeated sequence from the ribosomal intergenic spacer of the crucifer Sisymbrium irio. Plant Mol. Biol. 1989, 12, 695–706. [Google Scholar] [CrossRef] [PubMed]
  51. Galián, J.A.; Rosato, M.; Rosselló, J.A. Incomplete sequence homogenization in 45S rDNA multigene families: intermixed IGS heterogeneity within the single NOR locus of the polyploid species Medicago arborea (Fabaceae). Ann. Bot. 2014, 114, 243–251. [Google Scholar] [CrossRef] [PubMed]
  52. Kelly, R.J.; Siegel, A. The Cucurbita maxima ribosomal DNA intergenic spacer has a complex structure. Gene 1989, 80, 239–248. [Google Scholar] [CrossRef]
  53. Suzuki, A.; Tanifuji, S.; Komeda, Y.; Kato, A. Structural and functional characterization of the intergenic spacer region of the rDNA in Daucus carota. Plant Cell Physiol. 1996, 37, 233–238. [Google Scholar] [CrossRef] [PubMed]
  54. Nickrent, D.L.; Patrick, J.A. The nuclear ribosomal DNA intergenic spacers of wild and cultivated soybean have low variation and cryptic subrepeats. Genome 1998, 41, 183–192. [Google Scholar] [CrossRef] [PubMed]
  55. Wolf, M.; Achtziger, M.; Schultz, J.; Dandekar, T.; Müller, T. Homology modeling revealed more than 20,000 rRNA internal transcribed spacer 2 (ITS2) secondary structures. RNA 2005, 11, 1616–1623. [Google Scholar] [CrossRef] [PubMed]
  56. Capesius, I. Sequence of the 5S rRNA gene from Sinapis alba. Plant Mol. Biol. 1991, 17, 169–170. [Google Scholar] [CrossRef] [PubMed]
  57. Capesius, I. Nucleotide sequence of a 25S rRNA gene from mustard (Sinapis alba). Plant Mol. Biol. 1991, 16, 1093–1094. [Google Scholar] [CrossRef] [PubMed]
  58. Inácio, V.; Rocheta, M.; Morais-Cecílio, L. Molecular Organization of the 25S–18S rDNA IGS of Fagus sylvatica and Quercus suber: A Comparative Analysis. PLoS ONE 2014, 9, 98678. [Google Scholar] [CrossRef] [PubMed]
  59. Loots, G.G.; Ovcharenko, I.; Pachter, L.; Dubchak, I.; Rubin, E.M. rVista for comparative sequence-based discovery of functional transcription factor binding sites. Genome Res. 2002, 12, 832–839. [Google Scholar] [CrossRef] [PubMed]
  60. Tatusova, T.A.; Madden, T.L. Blast 2 sequences—A new tool for comparing protein and nucleotide sequences. FEMS Microbiol. Lett. 1999, 174, 247–250. [Google Scholar] [CrossRef] [PubMed]
  61. Tamura, K.; Stecher, G.; Peterson, D.; Filipski, A.; Kumar, S. MEGA6: Molecular Evolutionary Genetics Analysis Version 6.0. Mol. Biol. Evol. 2013, 30, 2725–2729. [Google Scholar] [CrossRef] [PubMed]

Share and Cite

MDPI and ACS Style

Yang, K.; Robin, A.H.K.; Yi, G.-E.; Lee, J.; Chung, M.-Y.; Yang, T.-J.; Nou, I.-S. Diversity and Inheritance of Intergenic Spacer Sequences of 45S Ribosomal DNA among Accessions of Brassica oleracea L. var. capitata. Int. J. Mol. Sci. 2015, 16, 28783-28799. https://doi.org/10.3390/ijms161226125

AMA Style

Yang K, Robin AHK, Yi G-E, Lee J, Chung M-Y, Yang T-J, Nou I-S. Diversity and Inheritance of Intergenic Spacer Sequences of 45S Ribosomal DNA among Accessions of Brassica oleracea L. var. capitata. International Journal of Molecular Sciences. 2015; 16(12):28783-28799. https://doi.org/10.3390/ijms161226125

Chicago/Turabian Style

Yang, Kiwoung, Arif Hasan Khan Robin, Go-Eun Yi, Jonghoon Lee, Mi-Young Chung, Tae-Jin Yang, and Ill-Sup Nou. 2015. "Diversity and Inheritance of Intergenic Spacer Sequences of 45S Ribosomal DNA among Accessions of Brassica oleracea L. var. capitata" International Journal of Molecular Sciences 16, no. 12: 28783-28799. https://doi.org/10.3390/ijms161226125

Article Metrics

Back to TopTop