Next Article in Journal
Cannibalism Affects Core Metabolic Processes in Helicoverpa armigera Larvae—A 2D NMR Metabolomics Study
Next Article in Special Issue
Current Status of Long Non-Coding RNAs in Human Breast Cancer
Previous Article in Journal
Preparation of Silk Sericin/Lignin Blend Beads for the Removal of Hexavalent Chromium Ions
Previous Article in Special Issue
A Long Noncoding RNA ZEB1-AS1 Promotes Tumorigenesis and Predicts Poor Prognosis in Glioma
 
 
Retraction published on 27 November 2025, see Int. J. Mol. Sci. 2025, 26(23), 11476.
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

RETRACTED: MicroRNA-378 Alleviates Cerebral Ischemic Injury by Negatively Regulating Apoptosis Executioner Caspase-3

1
Department of Human Anatomy, School of Basic Medical Sciences, Capital Medical University, Beijing 100069, China
2
Department of Neurobiology and Center of Stroke, Beijing Institute for Brain Disorders, Capital Medical University, Beijing 100069, China
*
Author to whom correspondence should be addressed.
Int. J. Mol. Sci. 2016, 17(9), 1427; https://doi.org/10.3390/ijms17091427
Submission received: 22 July 2016 / Revised: 14 August 2016 / Accepted: 19 August 2016 / Published: 2 September 2016 / Retracted: 27 November 2025
(This article belongs to the Collection Regulation by Non-coding RNAs)

Abstract

miRNAs have been linked to many human diseases, including ischemic stroke, and are being pursued as clinical diagnostics and therapeutic targets. Among the aberrantly expressed miRNAs in our previous report using large-scale microarray screening, the downregulation of miR-378 in the peri-infarct region of middle cerebral artery occluded (MCAO) mice can be reversed by hypoxic preconditioning (HPC). In this study, the role of miR-378 in the ischemic injury was further explored. We found that miR-378 levels significantly decreased in N2A cells following oxygen-glucose deprivation (OGD) treatment. Overexpression of miR-378 significantly enhanced cell viability, decreased TUNEL-positive cells and the immunoreactivity of cleaved-caspase-3. Conversely, downregulation of miR-378 aggravated OGD-induced apoptosis and ischemic injury. By using bioinformatic algorithms, we discovered that miR-378 may directly bind to the predicted 3′-untranslated region (UTR) of Caspase-3 gene. The protein level of caspase-3 increased significantly upon OGD treatment, and can be downregulated by pri-miR-378 transfection. The luciferase reporter assay confirmed the binding of miR-378 to the 3′-UTR of Caspase-3 mRNA and repressed its translation. In addition, miR-378 agomir decreased cleaved-caspase-3 ratio, reduced infarct volume and neural cell death induced by MCAO. Furthermore, caspase-3 knockdown could reverse anti-miR-378 mediated neuronal injury. Taken together, our data demonstrated that miR-378 attenuated ischemic injury by negatively regulating the apoptosis executioner, caspase-3, providing a potential therapeutic target for ischemic stroke.

Graphical Abstract

1. Introduction

Stroke represents a major cause of disability and the second leading cause of death worldwide, with an incidence of about 17 million per year. It is estimated that on average, every 40 s, someone in the United States has a stroke, of which 87% are ischemic stroke [1]. Currently, intravenous recombinant tissue plasminogen activator (tPA) is the only effective therapeutic strategy for ischemic stroke [2]. However, beyond the 4.5-h window, the risk of intracranial bleeding may outweigh the benefits [3]. Extensive research has demonstrated that stroke triggers complex cellular biochemical events, and ultimately leads to neuronal cell acute necrosis, programmed necrosis (necroptosis), apoptosis, and autophagy in the ischemic brain [4,5]. Nevertheless, it is still unclear the precise mechanisms underlying stroke-induced cell death and neurological dysfunction. To elucidate the cellular and molecular mechanisms of neural death will doubtless benefit the development of neuroprotective drugs for stroke.
MicroRNAs (miRNAs) are endogenous, small (containing about 22 nucleotides) non-coding single-stranded RNAs, with high conservation between species [6]. In posttranscriptional gene silencing, it functions by partially complementing with the 3′-untranslated region (UTR) of the target mRNAs, leading to translational repression [7]. Consequently, many cellular processes might be regulated by miRNAs, including metabolism, proliferation, differentiation, and death[8]. Just as miRNAs are involved in the normal functioning of eukaryotic cells, so have dysregulation of miRNAs been associated with neurological diseases, such as Alzheimer’s disease [9,10], Parkinson’s disease [11], Multiple sclerosis [12], and stroke [13]. In the last decade, many reports showed the miRNA expression profiling in stroke in vivo and in vitro [14], indicated miRNAs as key mediators in both pathogenic and pathological of ischemic stroke.
In our previous study, we have found many differentially expressed miRNAs in the brain of mice to be related with hypoxic preconditioning (HPC) and/or focal cerebral ischemia by using large-scale microarray screening of miRNA [15]. Among the aberrantly expressed miRNAs, the downregulation of miR-378 in the peri-infarct region of middle cerebral artery occluded (MCAO) mice can be reversed by HPC pretreatment. This study is designed to further elucidate the role of miR-378 in the N2A cell ischemic model in vitro and the mouse focal ischemic stroke model in vivo. We found that the expression of miR-378 significantly decreased upon OGD treatment. Overexpression of miR-378 could protect the neural cells against OGD or MCAO induced ischemic injury by targeting the apoptosis executioner caspase-3.

2. Results

2.1. Effect of miR-378 on OGD-Induced Ischemic Injury in N2A Cells

In accordance with the changes of miR-378 in the peri-infarct region of MCAO mice [15], we examined the miR-378 expression in N2A cells during reoxygenation after 3 h OGD exposure. The cells were collected and analyzed at 0, 6, 12, 24, and 48 h after 3 h OGD by quantitative real-time PCR. The results showed that miR-378 expression level decreased gradually and reached the platform at 24 h reoxygenation compared with the normoxic control (Figure 1A, p < 0.05, n = 5 per group).
To determine the role of miR-378 in OGD-induced cell injury, we used pri-miR-378 and anti-miR-378 to alter miR-378 levels in cultured N2A cells. As shown in Figure 1B, transfection of pri-miR-378 or anti-miR-378, but not their negative controls, significantly increased or decreased miR-378 levels in normoxia and 3 h OGD followed by 24 h reoxygenation (p < 0.05, n = 5 per group). Later, methylthiazolyldiphenyl-tetrazolium bromide (MTT) and lactate dehydrogenase (LDH) assays were employed to evaluate the effect of miR-378 on OGD-induced cell survival and cell death, respectively. 3 h OGD/24 h reoxygenation resulted in obvious N2A cell death. Overexpression of miR-378 substantially suppressed the cell death, whereas transfection of anti-miR-378 aggravated the N2A cell death induced by 3 h OGD/24 h reoxygenation (Figure 1C–F, p < 0.05, n = 6 per group). To confirm whether miR-378 could affect 3 h OGD/24 h reoxygenation-induced N2A cell apoptosis, a TUNEL assay was performed. TUNEL-positive cells were rarely seen in the normoxic group, whereas 3 h OGD/24 h reoxygenation increased the number of TUNEL-positive cells. Transfection of pri-miR-378 could significantly attenuate, while anti-miR-378 enhanced the number of TUNEL-positive cells. (Figure 2A,B, p < 0.05, n = 6 per group). As we know that TUNEL-positive cells also include some necroptotic cells, we further examined the activation of caspase-3 using a cleaved-caspase-3 specific antibody. The results confirmed that transfection of pri-miR-378 attenuated 3 h OGD/24 h reoxygenation induced cell apoptosis, while anti-miR-378 aggravated 3 h OGD/24 h reoxygenation induced cell apoptosis (Figure 2C).

2.2. Effect of miR-378 on the mRNA and Protein Expression Levels of Its Target Gene Caspase-3

As described by the previous report, miR-378 could inhibit caspase-3 protein expression and attenuated ischemic injury in cardiomyocytes [16]. To examine whether caspase-3 is responsible for OGD-induced N2A cell apoptosis, we analyzed the possibility of caspase-3 being a putative target of miR-378 by bioinformatics algorithms. We found that there were potential binding sites between mmu-miR-378 and the 3′-UTR of Caspase-3 mRNA. In partial agreement with this prediction, we found that caspase-3 protein levels increased significantly in N2A cells at 0–24 h of reoxygenation after 3 h of OGD (Figure 3A,B, p < 0.05, n = 5 per group). In addition, pri-miR-378 effectively decreased the expression of caspase-3, whereas anti-miR-378 increased the expression of caspase-3 in mouse N2A cells exposed to 3 h OGD/24 h reoxygenation (Figure 3C,D, p < 0.05, n = 3 per group). However, pri-miR-378 and anti-miR-378 had no effect on Caspase-3 mRNA levels (Figure 3F, p < 0.05, n = 5 per group).
To verify whether miR-378 can directly bind the 3′-UTR of Caspase-3 mRNA, we cloned a luciferase reporter encoding Caspase-3 3′-UTR, which contains the putative miR-378 binding sequences. A mutant Caspase-3 3′-UTR containing luciferase reporter was also generated as negative control. We then co-transfected these luciferase reporter vectors with pri-miR-378, pri-miR-378 ctrl, anti-miR-378, anti-miR-378 ctrl respectively into N2A cells. As shown in Figure 3E, the pri-miR-378 significantly decreased luciferase activity of the reporter vector containing 3′-UTR of Caspase-3 mRNA, but had no effect on the mutated reporter vector (p < 0.05, n = 6 per group). These data indicated that miR-378 directly regulated caspase-3 expression by binding to the 3′-UTR of Caspase-3 mRNA.

2.3. Effect of miR-378 Overexpression on Transient Focal Cerebral Ischemic Injury of Mice

To further evaluate the biological role of miR-378 in cerebral ischemic injury in vivo, we employed a micro infusion pump to continuously deliver miR-378 agomir into the lateral ventricle to increase miR-378 expression. Western blot analysis showed that miR-378 agomir but not its negative control could downregulate caspase-3 protein level and cleaved-caspase-3 ratio in cerebral ischemic cortex of mice after 1 h MCAO/24 h reperfusion (Figure 4A–C p < 0.05, n = 4 per group).Then we examined the effect of miR-378 overexpression on MCAO-induced infarction and neural cell loss by TTC and Nissl staining, respectively. Consequently, miR-378 agomir effectively attenuated infarction size (Figure 4D) and neuronal cell loss (Figure 4E–G, p < 0.05, n = 4 per group) in ischemic brain of MCAO mice. The above results indicated that miR-378 can exert neuroprotective effect partially by reducing caspase-3 associated cell apoptosis.

2.4. Caspase-3 Knockdown Blocked Anti-miR-378-Mediated Neuronal Injury in N2A Cells

To further analyze the contribution of miR-378 targeting caspase-3 to the biological function of miR-378 in OGD-induced N2A cell injury, we performed siRNA-mediated inhibition of caspase-3 protein expression. As shown in Figure 5A,B, caspase-3 protein levels decreased significantly following 48 h transfection of caspase-3 siRNAs in both normoxia and 3 h OGD/24 h reoxygenation-treated N2A cells (p < 0.05, n = 3 per group). MTT results showed that caspase-3 siRNA had the ability to block anti-miR-378-mediated neuronal injury induced by OGD treatment (Figure 5C, p < 0.05, n = 6 per group).

3. Discussion

In the present study, we found that miR-378 was downregulated during reoxygenation in OGD-induced N2A cell ischemic model, which is consistent with the changes in the peri-infarct region of MCAO mice found by large-scale microarray screening in our previous report. Most importantly, we found that miR-378 could induce neuroprotection through negatively regulating caspase-3 associated apoptosis.
Over the last decade, it has been established by many studies that neurons in the ischemic areas undergo necrotic and apoptotic cell death after a stroke incident [17]. In contrast to necrosis, apoptosis appears mainly in the peri-infarct region which could be salvaged by treatments [18]. Both the mitochondria and cell death receptor-mediated apoptotic pathways are shown to activate executioner caspases in cerebral ischemia [19]. Caspase-3 is the most important member of executioner caspases, which are present in the cytoplasm as inactive forms (zymogens), and activated by proteolysis [20]. Accumulated studies have shown that caspase-3 expression is modulated by miRNAs. It is reported that let-7c-5p directly targeted to the 3′-UTR of the caspase-3 mRNA to reduce caspase-3 levels, which may suppress the microglial activation and be involved in the protection against ischemic damage [21]. Researchers also found that caspase-3 activity was inhibited by miR-22 in cerebral ischemic/reperfusion injury [22]. In their study, miR-22 overexpression can also increase the expression of the anti-apoptosis gene Bcl-2 and decrease the pro-apoptosis gene Bax, which attributed to a reduction in apoptosis. In addition, they also found that miR-22 overexpression resulted in a reduction in inflammatory cytokines, such as TNF-α, IL-6, COX-2, and iNOS [22]. As the inflammatory cascade reaction is the main cause of aggravation of cerebral injury, the anti-inflammatory effect might also be one of the mechanisms underlying miR-22 mediated neuroprotection. Besides the involvement in cerebral ischemia, miRNAs also play important roles in the improvement of myocardial ischemic injury. Ham et al. searched the miRNAs that target caspase-3 mRNA by a Software TargetScan (Whitehead Institute for Biomedical Research, Cambridge, MA, USA) in mesenchymal stem cells (MSCs), which have therapeutic potential for the repair of myocardial injury [23]. Six candidate miRNAs were found to target caspase-3, among which transfection of let-7b into MSCs could markedly enhance left ventricular function and reduce the infarct size. The function of miRNAs in post-transcriptional regulation of gene expression is known to act through interacting with the 3′-UTR regions of the target mRNAs [8]. In the present study, we used TargetScan to identify caspase-3 as the target gene of miR-378. Experimentally, the expression of caspase-3 gradually increased at different reoxygenation times after OGD treatment, which is converse with the changes of miR-378 level. In addition, protein expression of caspase-3 is significantly downregulated by miR-378 overexpression in the OGD-treated N2A cells. Moreover, the luciferase reporter gene assay indicated that miR-378 targeted the 3′-UTR region of caspase-3 to decrease the protein level of the target gene. Taken together, these results suggest that miR-378 directly regulated caspase-3 expression, which might be involved in the neuroprotection of miR-378.
Recently, several miRNA profiling were analyzed using samples extracted from both animal models of stroke [24] and human stroke patients [25]. However, either due to the differences in the extent of ischemic infarction, or because of the tissue and species distinction, the result is not consistent with each other. In our previous study, we employed the HPC induced endogenous neuroprotective model and MCAO induced focal cerebral ischemic model to investigate miRNA profiling. We found that, among the significantly changed miRNAs, the reduced expression of miR-378 in the peri-infarct region of MCAO mice could be reversed by HPC pretreatment, indicating that miR-378 might be a key molecule in the development of neuroprotection. Recently, the potential role of miR-378 in cardiac remodeling [26], neural stem cell proliferation [27], and the progression of various carcinoma had been discovered. It is shown that expression of miR-378 can enhance cell survival, reduce caspase-3 activity, and promote tumor growth and angiogenesis [28]. In bovine corpus luteum tissue, miR-378 may suppress luteal cell apoptosis by targeting the interferon gamma receptor 1 gene [29]. Extensive evidence showed that miR-378 attenuated ischemic injury in cardiomyocytes by inhibiting caspase-3 expression, representing a potential novel treatment for apoptosis and ischemic heart disease [16]. However, until now, no evidence was known about the functional significance of miR-378 in cerebral ischemic injuries. The present study showed that miR-378 level significantly decreased in N2A cells after OGD treatment. Overexpression of miR-378 substantially suppressed the OGD-induced N2A cell death, whereas transfection of anti-miR-378 aggravated the cell death. We also noticed that miR-378 could attenuate apoptosis examined by TUNEL and cleaved-caspase-3 staining. Furthermore, the biological role of miR-378 was evaluated in an in vivo cerebral ischemic injury model. Continuous delivery of the miR-378 agomir effectively attenuated MCAO-induced apoptosis, cerebral infarction, and neural cell loss. In addition, caspase-3 knockdown could reverse anti-miR-378 mediated neural injury. To our knowledge, this is the first report described the involvement of miR-378 in the in vitro and in vivo cerebral ischemic models.

4. Materials and Methods

4.1. Animals

All chemicals and reagents were purchased from Sigma-Aldrich (St. Louis, MO, USA) unless specified. Adult (8–10 weeks), male C57BL/6J mice (18–22 g) purchased from Experimental Animal Center of Chinese Academy of Medical Sciences, People’s Republic of China, were maintained in cages at room temperature (23 ± 1 °C), with a constant humidity (55% ± 5%), with access to food and water ad libitum. All animal protocols were consistent with the NIH Guide for the care and use of laboratory animals (NIH Publication No. 80-23).

4.2. Middle Cerebral Artery Occluded (MCAO)-Induced Transient Focal Cerebral Ischemic Stroke Model

The transient focal cerebral ischemic stroke was conducted as described previously, with minor modifications [30,31]. Briefly, after the mice were anesthetized with pentobarbital sodium (0.06 g/kg i.p.), the left common and external carotid artery were exposed and ligated. A blunt-tipped 5-0 surgical nylon filament (0.23 mm in diameter) was inserted though the external carotid artery into the internal carotid artery to a point approximately 12 mm distal to the carotid bifurcation, thereby occluding the origin of middle cerebral artery. After 1 h of MCAO, the filament was carefully removed and the mice were allowed to recover for 24 or 72 h. We maintained the rectal temperature at 37.0 ± 0.5 °C with a heating pad, and monitored the respiratory rate continuously during the surgical procedures. Mice with no acute neurological deficit or with hemorrhage were excluded follow-up analysis. In sham group, mice received the same surgical procedure without the filament insertion. At time periods 24 or 72 h after reperfusion, the brains were quickly isolated and subjected to Western blot analysis, Nissl and TTC staining.
The intracerebroventricular infusion of miR-378 agomir and its negative control was performed two days before MCAO as described [32,33]. Briefly, the mice were anesthetized with pentobarbital sodium (0.06 g/kg i.p.) and positioned in a stereotaxic apparatus. Continuous infusion of mouse mmu-miR-378 (13314114400) agomir and its negative control (5 pmol/µL, 1 µL/h, Ribobio, Guangzhou, China) was conducted through a infusion cannula, which was stereotaxically implanted into the left lateral ventricle of the brain (Bregma: −2.2 mm, dorsoventral: 3 mm, lateral: 1 mm). The micro-osmotic pump (Alzet 1003D, DURECT Corporation, Cupertino, CA, USA) connected to a brain infusion cannula was placed in a subcutaneous pocket on the neck of the mouse. The agomir and negative control were placed into micro-osmotic minipumps and incubated at 37 °C overnight before implantation.

4.3. OGD-Induced Ischemic Injury of N2A Cells

Mouse N2A neuroblastoma cells, which were a kind gift from Dr. Yun Wang (Peking University), were grown to 50% confluence in Dulbecco’s modified Eagle’s medium (DMEM; Gibco, Grandisland, NY, USA) containing 10% fetal bovine serum (FBS) in a 37 °C anaerobic chamber (Thermo Electron LED GmbH, Langenselbold, Germany) under normoxic conditions (5% CO2, 95% O2). To mimic the in vitro ischemic-like condition, cells were exposed to OGD treatment, in which the culture medium was replaced by glucose-free DMEM, and cells were maintained in the hypoxic chamber (5% CO2, 1% O2, 94% N2) for 3 h. After OGD exposure, N2A cells were returned to glucose-containing DMEM under normoxic conditions for 0–24 h reoxygenation.
In specific experiments, mouse N2A cells were plated in 96-well or six-well plates and transfected with miR precursor (pri-miR-378), miR-378 antisence (anti-miR-378), and their negative controls (JIKAI, Shanghai, China) at a final concentration of 30 nM, or Caspase-3 and its negative control siRNAs (Gene Pharma, Shanghai, China) at a final concentration of 20 µM by using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. The transfection medium was replaced by growth culture medium after 6 h transfection and cells were subjected to OGD 24 h after transfection, cell survival and death rates were assessed by methylthiazolyldiphenyl-tetrazolium bromide (MTT; 0.5 mg/mL; Applichem, Omaha, NE, USA) and the CytoTox 96 Non-Radioactive Cytotoxicity Assay (LDH; Promega, Madison, WI, USA), respectively.

4.4. Plasmid Construction and Luciferase Reporter Assays

A 668-bp segment from the 3′-UTR of the Caspase-3 gene containing miR-378 binding sites was amplified by PCR from 3T3 cell genomic DNA, and then cloned into the pmiR-RB-REPORT™ vector (Guangzhou RiboBio Co., Guangzhou, China). The following primer sets were used to generate specific fragments: Caspase-3-UTR forward, 5′CCGCTCGAGGTCCATGCTCACGAAAGAACTG3′, Caspase-3-UTR reverse, 5′GAATGCGGCCGCTGCACACGGTTTTCCTCTCACA3′. We also generated a mutant 3′-UTR of the Caspase-3 gene with substitution of 6 bp from seed region of the predicted mmu-miR-378 binding site. Both wild type and mutant inserts were confirmed by sequencing.
For luciferase reporter assay, N2A cells were plated at 0.5 × 104 cells per well in 96-well plates. The following day, cells were co-transfected with 100 ng pmiR-RB-REPORT™ vector, including the 3′-UTR of Caspase-3 (with either wild-type or mutant miR-378 binding sites), and 100 ng pri-miR-378 or anti-miR-378 by using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA). Luciferase assays were performed by using the Dual-Luciferase Reporter Assay System (Promega, Madison, WI, USA) 48 h after transfection.

4.5. Western Blot Analysis

Total protein was isolated from N2A cells or the cerebral cortex as described previously [30]. Samples (40–80 μg of protein) were electrophoresed onto a 10%–15% sodium dodecyl sulfate-polyacrylamide gel (SDS-PAGE), and transferred to polyvinylidene difluoride membrane (PVDF, GE Health Care, Little Chalfont, UK) at 4 °C. The membranes were blocked with 10% nonfat milk in 20 mM Tris-Cl, pH 7.5, 0.15 M NaCl, and 0.05% Tween-20 (TTBS) for 1 h and then incubated with the primary rabbit antibody against Caspase-3 (1:1000; Cell Signaling Techology, Danvers, MA, USA) for 3 h, or rabbit antibody against β-Tublin (1:10,000; Proteintech Company, Rosemont, IL, USA) for 1 h. The membranes were washed with TTBS 3 times at 10 min intervals, incubated with secondary antibody (1:5000, goat anti-rabbit IgG conjugated with the horseradish peroxidase, Stressgen Biotechnologies, Victoria, BC, Canada) for 1 h, washed 3 times each at 10 min intervals with TTBS, and the signal bands were visualized by enhanced chemiluminescence (ECL) kit (GE Healthcare, Little Chalfont, UK).

4.6. Isolation of Total RNA and Quantitative Real-Time RT-PCR Analyses

Total RNA was isolated from N2A cells using the mirVana™ miRNA Isolation Kit (Ambion, Austin, TX, USA). The concentration of RNA was determined by NanoDropND-1000 spectrophotometry (NanoDrop Tech., Wilmington, DE, USA). Reverse transcription (RT) was performed with the miRCURY LNA™ Universal RT microRNA PCR (Exiqon A/S, Vedbaek, Denmark). The 20 μL RT reaction solutions were composed of 25–50 ng RNA in 14 μL, 5× reaction buffer in 4 μL and enzyme mix in 2 μL. The reaction solutions were incubated for 60 min at 42 °C, followed by heat inactivation of the reverse transcriptase for 5 min at 95 °C. Then we conducted PCR amplification using the Mx3000P™ system (Agilent Technologies Inc., Santa Clara, CA, USA) and the kit mentioned above. Each reaction system contained 10 μL SYBR Green master mix, 2 μL LNA PCR primer mix, and 8 μL diluted cDNA template 80× in nuclease-free water in a total volume of 20 μL. The real-time PCR was conducted as follows: polymerase activation/denaturation (95 °C for 10 min), 40 amplification cycles (95 °C for 10 s and 60 °C for 1 min). Measurements were normalized to U6 (ΔCt) value, and relative gene expression between treatments was then calculated using the following equation: 2−(ΔCt sample− ΔCt control) [32,34].

4.7. TUNEL, Immunofluorescent, TTC, and Nissl Staining

TUNEL positive cells were detected by using the In Situ Cell Death Detection Kit (Roche, Indianapolis, IN, USA), which could label the nicked TdT-mediated dUTP. N2A cells were seeded onto poly-l-lysine-coated glass coverslips, and fixed in 4% paraformaldehyde (PFA) for 30 min until they grown to 50% confluence. Equilibration buffer was added to the coverslips, followed by incubating them with nucleotide mix and rTdT enzyme at 37 °C for 1 h. After stopping the reaction with a 2× saline-sodium citrate buffer, we converted the signal to a diaminobenzidine signal by the addition of converter- horse-radish peroxidase (POD) at 37 °C for 1 h. The images (3 images per coverslip) were visualized by light microscopy (Nikon 50i, Nikon, Tokyo, Japan).
Cell apoptosis was assessed by immunofluorescent staining of cleaved caspase-3, which detects endogenous levels of the large fragment of activated caspase-3, but not full length caspase-3. Briefly, cells grown on cover slips were fixed with 4% PFA for 20 min and incubated in 3% hydrogen peroxide for 10 min to block endogenous peroxidase activity. Slides were then washed in PBS and incubated with rabbit polyclonal anti-cleaved-Caspase-3 antibody (1:400; Cell Signaling Techology, Danvers, MA, USA) in a humidified chamber at 4 °C overnight. After washing, goat anti-rabbit secondary antibody (1:500, Invitrogen, Carlsbad, CA, USA) was added for 20 min. Sections were also co-stained with 4′,6-diamidino-2-phenylindole (DAPI) (1:2, Invitrogen) for nuclei. Images (3 images per cover slip) were acquired with a fluorescence microscope system (Leica DM4000B, Wetzlar, Germany).
Brain infarction was visualized by 2,3,5-triphenyltetrazolium chloride (TTC) staining. Mice were decapitated 24 or 72 h after the removal of the filament. The brains were cut into 2 mm thickness coronal sections and immersed in 1% TTC (Sigma-Aldrich, St. Louis, MO, USA) solution at 37 °C for 10 min in the dark. Normal brain tissues were stained red, while infarct tissues were not stained (white). Finally, the slices were soaked in 4% PFA phosphate buffer for 30 min and scanned into a computer.
Neural cell damage in brain sections was determined by Nissl staining. Mice were transcardially perfused with 100 mM phosphate-buffered saline (PBS) followed by 4% paraformaldehyde. Brains were postfixed in 4% paraformaldehyde followed by dehydration with graded sucrose solutions (20% for 24 h and 30% for another 24 h). The brains were cut coronally at 20 μm thickness. Sections were washed in fresh PBS, and stained with 0.04% cresyl violet (Sigma-Aldrich) dissolved in acetate buffer for 1 h. Three views per section from five randomly selected sections per animal were visualized under a light microscopy (Nikon 50i, Nikon, Tokyo, Japan).

4.8. Statistical Analysis

The GelDoc-2000 Imaging System (Bio-Rad Laboratories, Hercules, CA, USA) was used to perform the quantitative analysis of Western blot results. The protein level (band density of protein/band density of β-tubulin) was expressed as 100% in the control group, and other groups were represented as a percentage of control group. Statistical analysis was performed by one-way analysis of variance (ANOVA), followed by all pairwise multiple-comparison procedures using the Bonferroni test. All data were expressed as mean ± S.E., and p < 0.05 was considered as statistically significant.

5. Conclusions

In conclusion, we reported for the first time that the protective role of miR-378 in N2A cells after OGD in vitro and mouse brain following the MCAO-induced ischemic stroke in vivo through downregulating caspase-3 protein levels. This research points out a novel mechanism for the miR-378 induced neuroprotection by targeting caspase-3, which may become a potential therapeutic option for ischemic stroke. However, other possible targets of miR-378 and the upstream regulation of miR-378 by transcriptional factors must also be investigated to fully understand the neuroprotective effect of miR-378 in the development of ischemic stroke.

Acknowledgments

This work was supported by grants from the Seed Grant of International Alliance of Translational Neuroscience (PXM2014-014226-000006), Beijing Municipal Program for Hundred-Thousand-Ten Thousand Excellent Talents of New Century (Li Junfa), Beijing Natural Science Foundation (7141001), National Natural Science Foundation of China (31471142 and 81601014), Beijing Outstanding Talent Training Program for Youth Backbone Individuals (2015000020124G110), and Natural Science Foundation of Capital Medical University (2016ZR11).

Author Contributions

All authors had full access to all the data in the study and take responsibility for the integrity of the data and the accuracy of the data analysis. Nan Zhang and Junfa Li conceived and designed the experiments; Jie Zhong and Yun Li performed the experiments; Yanling Yin analyzed the data; Song Han contributed reagents/materials/analysis tools; Nan Zhang and Jie Zhong wrote the paper; Junfa Li and Nan Zhang obtained the funding.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Mozaffarian, D.; Benjamin, E.J.; Go, A.S.; Arnett, D.K.; Blaha, M.J.; Cushman, M.; Das, S.R.; de Ferranti, S.; Despres, J.P.; Fullerton, H.J.; et al. Heart disease and stroke statistics-2016 update: A report from the american heart association. Circulation 2016, 133, e38–e60. [Google Scholar] [CrossRef] [PubMed]
  2. Marsh, J.D.; Keyrouz, S.G. Stroke prevention and treatment. J. Am. Coll. Cardiol. 2010, 56, 683–691. [Google Scholar] [CrossRef] [PubMed]
  3. Lees, K.R.; Bluhmki, E.; von Kummer, R.; Brott, T.G.; Toni, D.; Grotta, J.C.; Albers, G.W.; Kaste, M.; Marler, J.R.; Hamilton, S.A.; et al. Time to treatment with intravenous alteplase and outcome in stroke: An updated pooled analysis of ecass, atlantis, ninds, and epithet trials. Lancet 2010, 375, 1695–1703. [Google Scholar] [CrossRef]
  4. Rami, A.; Kogel, D. Apoptosis meets autophagy-like cell death in the ischemic penumbra: Two sides of the same coin? Autophagy 2008, 4, 422–426. [Google Scholar] [CrossRef] [PubMed]
  5. Fayaz, S.M.; Suvanish Kumar, V.S.; Rajanikant, G.K. Necroptosis: Who knew there were so many interesting ways to die? CNS Neurol. Disord. Drug Targets 2014, 13, 42–51. [Google Scholar] [CrossRef] [PubMed]
  6. Bartel, D.P. MicroRNAs: Genomics, biogenesis, mechanism, and function. Cell 2004, 116, 281–297. [Google Scholar] [CrossRef]
  7. Ha, M.; Kim, V.N. Regulation of microRNA biogenesis. Nat. Rev. Mol. Cell Biol. 2014, 15, 509–524. [Google Scholar] [CrossRef] [PubMed]
  8. Hammond, S.M. An overview of microRNAs. Adv. Drug Deliv. Rev. 2015, 87, 3–14. [Google Scholar] [CrossRef] [PubMed]
  9. Delay, C.; Mandemakers, W.; Hebert, S.S. MicroRNAs in Alzheimer’s disease. Neurobiol. Dis. 2012, 46, 285–290. [Google Scholar] [CrossRef] [PubMed]
  10. Femminella, G.D.; Ferrara, N.; Rengo, G. The emerging role of microRNAs in Alzheimer’s disease. Front. Physiol. 2015, 6, 40. [Google Scholar] [CrossRef] [PubMed]
  11. Mouradian, M.M. MicroRNAs in Parkinson’s disease. Neurobiol. Dis. 2012, 46, 279–284. [Google Scholar] [CrossRef] [PubMed]
  12. Ma, X.; Zhou, J.; Zhong, Y.; Jiang, L.; Mu, P.; Li, Y.; Singh, N.; Nagarkatti, M.; Nagarkatti, P. Expression, regulation and function of microRNAs in multiple sclerosis. Int. J. Med. Sci. 2014, 11, 810–818. [Google Scholar] [CrossRef] [PubMed]
  13. Bhalala, O.G.; Srikanth, M.; Kessler, J.A. The emerging roles of microRNAs in CNS injuries. Nat. Rev. Neurol. 2013, 9, 328–339. [Google Scholar] [CrossRef] [PubMed]
  14. Liu, D.Z.; Tian, Y.; Ander, B.P.; Xu, H.; Stamova, B.S.; Zhan, X.; Turner, R.J.; Jickling, G.; Sharp, F.R. Brain and blood microRNA expression profiling of ischemic stroke, intracerebral hemorrhage, and kainate seizures. J. Cereb. Blood Flow Metab. 2010, 30, 92–101. [Google Scholar] [CrossRef] [PubMed]
  15. Liu, C.; Peng, Z.; Zhang, N.; Yu, L.; Han, S.; Li, D.; Li, J. Identification of differentially expressed microRNAs and their PKC-isoform specific gene network prediction during hypoxic pre-conditioning and focal cerebral ischemia of mice. J. Neurochem. 2012, 120, 830–841. [Google Scholar] [CrossRef] [PubMed]
  16. Fang, J.; Song, X.W.; Tian, J.; Chen, H.Y.; Li, D.F.; Wang, J.F.; Ren, A.J.; Yuan, W.J.; Lin, L. Overexpression of microRNA-378 attenuates ischemia-induced apoptosis by inhibiting caspase-3 expression in cardiac myocytes. Apoptosis Int. J. Program. Cell Death 2012, 17, 410–423. [Google Scholar] [CrossRef] [PubMed]
  17. Dirnagl, U.; Iadecola, C.; Moskowitz, M.A. Pathobiology of ischaemic stroke: An integrated view. Trends Neurosci. 1999, 22, 391–397. [Google Scholar] [CrossRef]
  18. Doyle, K.P.; Simon, R.P.; Stenzel-Poore, M.P. Mechanisms of ischemic brain damage. Neuropharmacology 2008, 55, 310–318. [Google Scholar] [CrossRef] [PubMed]
  19. Friedlander, R.M. Apoptosis and caspases in neurodegenerative diseases. N. Engl. J. Med. 2003, 348, 1365–1375. [Google Scholar] [CrossRef] [PubMed]
  20. Porter, A.G.; Janicke, R.U. Emerging roles of caspase-3 in apoptosis. Cell Death Differ. 1999, 6, 99–104. [Google Scholar] [CrossRef] [PubMed]
  21. Ni, J.; Wang, X.; Chen, S.; Liu, H.; Wang, Y.; Xu, X.; Cheng, J.; Jia, J.; Zhen, X. MicroRNA let-7c-5p protects against cerebral ischemia injury via mechanisms involving the inhibition of microglia activation. Brain Behav. Immun. 2015, 49, 75–85. [Google Scholar] [CrossRef] [PubMed]
  22. Yu, H.; Wu, M.; Zhao, P.; Huang, Y.; Wang, W.; Yin, W. Neuroprotective effects of viral overexpression of microRNA-22 in rat and cell models of cerebral ischemia-reperfusion injury. J. Cell. Biochem. 2015, 116, 233–241. [Google Scholar] [CrossRef] [PubMed]
  23. Ham, O.; Lee, S.Y.; Lee, C.Y.; Park, J.H.; Lee, J.; Seo, H.H.; Cha, M.J.; Choi, E.; Kim, S.; Hwang, K.C. Let-7b suppresses apoptosis and autophagy of human mesenchymal stem cells transplanted into ischemia/reperfusion injured heart 7by targeting caspase-3. Stem Cell Res. Ther. 2015, 6, 147. [Google Scholar] [CrossRef] [PubMed]
  24. Lim, K.Y.; Chua, J.H.; Tan, J.R.; Swaminathan, P.; Sepramaniam, S.; Armugam, A.; Wong, P.T.; Jeyaseelan, K. MicroRNAs in cerebral ischemia. Transl. Stroke Res. 2010, 1, 287–303. [Google Scholar] [CrossRef] [PubMed]
  25. Sorensen, S.S.; Nygaard, A.B.; Nielsen, M.Y.; Jensen, K.; Christensen, T. MiRNA expression profiles in cerebrospinal fluid and blood of patients with acute ischemic stroke. Transl. Stroke Res. 2014, 5, 711–718. [Google Scholar] [CrossRef] [PubMed]
  26. Nagalingam, R.S.; Sundaresan, N.R.; Noor, M.; Gupta, M.P.; Solaro, R.J.; Gupta, M. Deficiency of cardiomyocyte-specific microRNA-378 contributes to the development of cardiac fibrosis involving a transforming growth factor β (TGFΒ1)-dependent paracrine mechanism. J. Biol. Chem. 2014, 289, 27199–27214. [Google Scholar] [CrossRef] [PubMed]
  27. Huang, Y.; Liu, X.; Wang, Y. MicroRNA-378 regulates neural stem cell proliferation and differentiation in vitro by modulating tailless expression. Biochem. Biophys. Res. Commun. 2015, 466, 214–220. [Google Scholar] [CrossRef] [PubMed]
  28. Lee, D.Y.; Deng, Z.; Wang, C.H.; Yang, B.B. MicroRNA-378 promotes cell survival, tumor growth, and angiogenesis by targeting sufu and FUS-1 expression. Proc. Natl. Acad. Sci. USA 2007, 104, 20350–20355. [Google Scholar] [CrossRef] [PubMed]
  29. Ma, T.; Jiang, H.; Gao, Y.; Zhao, Y.; Dai, L.; Xiong, Q.; Xu, Y.; Zhao, Z.; Zhang, J. Microarray analysis of differentially expressed microRNAs in non-regressed and regressed bovine corpus luteum tissue; microRNA-378 may suppress luteal cell apoptosis by targeting the interferon γ receptor 1 gene. J. Appl. Genet. 2011, 52, 481–486. [Google Scholar] [CrossRef] [PubMed]
  30. Wang, P.; Zhang, N.; Liang, J.; Li, J.; Han, S.; Li, J. Micro-RNA-30a regulates ischemia-induced cell death by targeting heat shock protein HSPA5 in primary cultured cortical neurons and mouse brain after stroke. J. Neurosci. Res. 2015, 93, 1756–1768. [Google Scholar] [CrossRef] [PubMed]
  31. Yang, X.; Zhang, X.; Li, Y.; Han, S.; Howells, D.W.; Li, S.; Li, J. Conventional protein kinase Cβ-mediated phosphorylation inhibits collapsin response-mediated protein 2 proteolysis and alleviates ischemic injury in cultured cortical neurons and ischemic stroke-induced mice. J. Neurochem. 2016, 137, 446–459. [Google Scholar] [CrossRef] [PubMed]
  32. Peng, Z.; Li, J.; Li, Y.; Yang, X.; Feng, S.; Han, S.; Li, J. Downregulation of mir-181b in mouse brain following ischemic stroke induces neuroprotection against ischemic injury through targeting heat shock protein A5 and ubiquitin carboxyl-terminal hydrolase isozyme L1. J. Neurosci. Res. 2013, 91, 1349–1362. [Google Scholar] [CrossRef] [PubMed]
  33. Krutzfeldt, J.; Rajewsky, N.; Braich, R.; Rajeev, K.G.; Tuschl, T.; Manoharan, M.; Stoffel, M. Silencing of microRNAs in vivo with “antagomirs”. Nature 2005, 438, 685–689. [Google Scholar] [CrossRef] [PubMed]
  34. Dharap, A.; Bowen, K.; Place, R.; Li, L.C.; Vemuganti, R. Transient focal ischemia induces extensive temporal changes in rat cerebral microRNAome. J. Cereb. Blood Flow Metab. 2009, 29, 675–687. [Google Scholar] [CrossRef] [PubMed]
Figure 1. Effect of miR-378 on oxygen-glucose deprivation (OGD)-induced ischemic injury in N2A cells. (A) miR expression decreased in cultured N2A cells exposed to 3 h OGD following different reoxygenation times. * p < 0.05 vs. normoxia, n = 5 per group; (B) Transfection of pri-miR-378 or anti-miR-378 significantly increased or decreased the level of miR-378 in normoxia and 3 h OGD/24 h reoxygenation treatments, * p < 0.05 vs. normoxic non-trans, # p < 0.05 vs. OGD non-trans, n = 5 per group; (C,D) MTT assay showed that pri-miR-378 and anti-miR-378 transfection significantly increased or decreased cell survival, respectively, following OGD treatment; (E,F) LDH assay showed that overexpression of miR-378 substantially suppressed the cell death, while transfection of anti-miR-378 aggravated cell death induced by 3 h OGD/24 h reoxygenation, * p < 0.05 vs. normoxic non-trans, # p < 0.05 vs. OGD non-trans, n = 6 per group.
Figure 1. Effect of miR-378 on oxygen-glucose deprivation (OGD)-induced ischemic injury in N2A cells. (A) miR expression decreased in cultured N2A cells exposed to 3 h OGD following different reoxygenation times. * p < 0.05 vs. normoxia, n = 5 per group; (B) Transfection of pri-miR-378 or anti-miR-378 significantly increased or decreased the level of miR-378 in normoxia and 3 h OGD/24 h reoxygenation treatments, * p < 0.05 vs. normoxic non-trans, # p < 0.05 vs. OGD non-trans, n = 5 per group; (C,D) MTT assay showed that pri-miR-378 and anti-miR-378 transfection significantly increased or decreased cell survival, respectively, following OGD treatment; (E,F) LDH assay showed that overexpression of miR-378 substantially suppressed the cell death, while transfection of anti-miR-378 aggravated cell death induced by 3 h OGD/24 h reoxygenation, * p < 0.05 vs. normoxic non-trans, # p < 0.05 vs. OGD non-trans, n = 6 per group.
Figure 2. Pri-miR-378 transfection significantly reduced 3 h OGD/24h reoxygenation- induced N2A cell apoptosis. (A,B) Representative TUNEL staining and statistical analysis showed that transfection of pri-miR-378 significantly attenuated, while anti-miR-378 increased the number of TUNEL-positive cells, * p < 0.05 vs. OGD non-trans, n = 6 per group; (C) Cleaved caspase-3 staining showed that overexpression of miR-378 could attenuate OGD-induced neuronal apoptosis, while anti-miR-378 aggravated N2A cell apoptosis induced by 3 h OGD/24 h reoxygenation. Scale bar = 50 µm.
Figure 2. Pri-miR-378 transfection significantly reduced 3 h OGD/24h reoxygenation- induced N2A cell apoptosis. (A,B) Representative TUNEL staining and statistical analysis showed that transfection of pri-miR-378 significantly attenuated, while anti-miR-378 increased the number of TUNEL-positive cells, * p < 0.05 vs. OGD non-trans, n = 6 per group; (C) Cleaved caspase-3 staining showed that overexpression of miR-378 could attenuate OGD-induced neuronal apoptosis, while anti-miR-378 aggravated N2A cell apoptosis induced by 3 h OGD/24 h reoxygenation. Scale bar = 50 µm.
Figure 3. Effect of miR-378 on the mRNA and protein expression levels of its target gene Caspase-3. (A,B) Representative Western blot and quantitative analysis showed the caspase-3 protein levels increased significantly in N2A cells at 0–24 h of reoxygenation after 3 h of OGD, * p < 0.05, n = 5 per group; (C,D) Transfection of pri-miR-378 effectively decreased the expression of caspase-3, whereas anti-miR-378 increased the expression of caspase-3 in mouse N2A cells exposed to 3 h OGD/24 h reoxygenation, * p < 0.05 vs. OGD non-trans, n = 3 per group; (E) Upper panel, construction of luciferase reporter system; Lower panel, pri-miR-378 decreased luciferase activity of the reporter vector containing 3′-UTR of caspase-3, but had no effect on the mutated reporter vector, * p < 0.05, n = 6 per group; (F) Pri-miR-378 and anti-miR-378 had no effect on Caspase-3 mRNA levels, n = 5 per group.
Figure 3. Effect of miR-378 on the mRNA and protein expression levels of its target gene Caspase-3. (A,B) Representative Western blot and quantitative analysis showed the caspase-3 protein levels increased significantly in N2A cells at 0–24 h of reoxygenation after 3 h of OGD, * p < 0.05, n = 5 per group; (C,D) Transfection of pri-miR-378 effectively decreased the expression of caspase-3, whereas anti-miR-378 increased the expression of caspase-3 in mouse N2A cells exposed to 3 h OGD/24 h reoxygenation, * p < 0.05 vs. OGD non-trans, n = 3 per group; (E) Upper panel, construction of luciferase reporter system; Lower panel, pri-miR-378 decreased luciferase activity of the reporter vector containing 3′-UTR of caspase-3, but had no effect on the mutated reporter vector, * p < 0.05, n = 6 per group; (F) Pri-miR-378 and anti-miR-378 had no effect on Caspase-3 mRNA levels, n = 5 per group.
Figure 4. Effect of miR-378 overexpression on cerebral ischemia/reperfusion injury of mice following 1 h MCAO/24 h reperfusion. (A–C) Western blot analysis showed that intracerebroventricular administration of miR-378 agomir, but not its negative control, could downregulate caspase-3 protein level and the ratio of cleaved caspase-3 in cerebral ischemic cortex of mice at 24 h after transient MCAO, * p < 0.05, n = 4 per group; (D) Representative TTC staining slices showed that miR-378 agomir effectively attenuated infarction size of mice following transient focal cerebral ischemia; (E–G) Nissl staining showed that administration of miR-378 agomir decreased neural cell loss in ischemic brain of mice at 24 and 72 h of reperfusion following 1 h MCAO, * p < 0.05 vs. sham, # p < 0.05 vs. none, n = 4 per group. Scale bar = 50 µm.
Figure 4. Effect of miR-378 overexpression on cerebral ischemia/reperfusion injury of mice following 1 h MCAO/24 h reperfusion. (A–C) Western blot analysis showed that intracerebroventricular administration of miR-378 agomir, but not its negative control, could downregulate caspase-3 protein level and the ratio of cleaved caspase-3 in cerebral ischemic cortex of mice at 24 h after transient MCAO, * p < 0.05, n = 4 per group; (D) Representative TTC staining slices showed that miR-378 agomir effectively attenuated infarction size of mice following transient focal cerebral ischemia; (E–G) Nissl staining showed that administration of miR-378 agomir decreased neural cell loss in ischemic brain of mice at 24 and 72 h of reperfusion following 1 h MCAO, * p < 0.05 vs. sham, # p < 0.05 vs. none, n = 4 per group. Scale bar = 50 µm.
Figure 5. Caspase-3 siRNAs blocked anti-miR-378-mediated neuronal injury in N2A cells. (A,B) Caspase-3 siRNA, but not its negative control effectively decreased caspase-3 protein expression in normoxia and OGD-treated groups, * p < 0.05 vs. non-OGD vehicle, # p < 0.05 vs. OGD vehicle, n = 3 per group; (C) MTT results showed that caspase-3 siRNAs had the ability to block anti-miR-378-mediated neuronal injury induced by OGD treatment, * p < 0.05 vs. OGD, # p < 0.05 vs. caspase-3 siRNA ctrl, n = 6 per group.
Figure 5. Caspase-3 siRNAs blocked anti-miR-378-mediated neuronal injury in N2A cells. (A,B) Caspase-3 siRNA, but not its negative control effectively decreased caspase-3 protein expression in normoxia and OGD-treated groups, * p < 0.05 vs. non-OGD vehicle, # p < 0.05 vs. OGD vehicle, n = 3 per group; (C) MTT results showed that caspase-3 siRNAs had the ability to block anti-miR-378-mediated neuronal injury induced by OGD treatment, * p < 0.05 vs. OGD, # p < 0.05 vs. caspase-3 siRNA ctrl, n = 6 per group.

Share and Cite

MDPI and ACS Style

Zhang, N.; Zhong, J.; Han, S.; Li, Y.; Yin, Y.; Li, J. RETRACTED: MicroRNA-378 Alleviates Cerebral Ischemic Injury by Negatively Regulating Apoptosis Executioner Caspase-3. Int. J. Mol. Sci. 2016, 17, 1427. https://doi.org/10.3390/ijms17091427

AMA Style

Zhang N, Zhong J, Han S, Li Y, Yin Y, Li J. RETRACTED: MicroRNA-378 Alleviates Cerebral Ischemic Injury by Negatively Regulating Apoptosis Executioner Caspase-3. International Journal of Molecular Sciences. 2016; 17(9):1427. https://doi.org/10.3390/ijms17091427

Chicago/Turabian Style

Zhang, Nan, Jie Zhong, Song Han, Yun Li, Yanling Yin, and Junfa Li. 2016. "RETRACTED: MicroRNA-378 Alleviates Cerebral Ischemic Injury by Negatively Regulating Apoptosis Executioner Caspase-3" International Journal of Molecular Sciences 17, no. 9: 1427. https://doi.org/10.3390/ijms17091427

APA Style

Zhang, N., Zhong, J., Han, S., Li, Y., Yin, Y., & Li, J. (2016). RETRACTED: MicroRNA-378 Alleviates Cerebral Ischemic Injury by Negatively Regulating Apoptosis Executioner Caspase-3. International Journal of Molecular Sciences, 17(9), 1427. https://doi.org/10.3390/ijms17091427

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop