CD99 Expression in Glioblastoma Molecular Subtypes and Role in Migration and Invasion
Abstract
:1. Introduction
2. Results
2.1. CD99 Isoforms Expression in Human Astrocytomas and in U87MG Cell Line
2.2. Transcriptome Analysis of CD99-siRNA U87MG
2.3. Functional Analysis of CD99 Involvement in Glioma Cell Migration, Invasion and Adhesion
2.4. CD99 Colocalizes with F-Actin
3. Discussion
3.1. Expression of CD99 Isoforms
3.2. Transcriptome Analysis and Signaling Pathways Modulated by CD99
3.3. Influence of CD99 on Migration, Invasion and Cell Adhesion
3.4. CD99 Is Upregulated in Glioma Cell Line U87MG
4. Materials and Methods
4.1. Cell Cultures
4.2. Casuistry
4.3. Total RNA Extraction and cDNA Synthesis
4.4. Quantitative Real Time PCR
4.5. CD99-siRNA and Library Preparations for NGS Sequencing (RNA-Seq)
4.6. Transcriptome Analysis
4.7. TCGA Data Analysis
4.8. Construction of Recombinant Lentivirus
4.9. Generation of Knockdown Cell Lines
4.10. Western Blotting
4.11. Wound Healing Migration Assay
4.12. Invasion Assay
4.13. Adhesion Assay
4.14. Immunofluorescence
4.15. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Conflicts of Interest
Abbreviations
AGI | Astrocytoma grade I or pilocytic astrocytoma |
AGII | Astrocytoma grade II or low-grade astrocytoma |
AGIII | Astrocytoma grade III or anaplastic astrocytoma |
ATCC | American Type Culture Collection |
CPM | Counts per million |
DMEM | Dulbecco’s Modified Eagle’s medium |
ERM | Ezrin-radixin-moesin |
FAK1 | Focal adhesion kinase 1 |
FBS | Fetal bovine serum |
FERM | 4.1 and ERM |
FC | Fold change |
GBM | Glioblastoma |
GO | Gene Ontology |
NN | Non-neoplastic |
NTC | Non-target control |
RPKM | Reads per kilobase million |
shCD99 | Short hairpin RNA for CD99 |
shRNA | Short hairpin RNA |
siRNA | Small interfering RNA |
TCGA | The Cancer Genome Atlas |
WHO | World Health Organization |
References
- Iacob, G.; Dinca, E.B. Current data and strategy in glioblastoma multiforme. J. Med. Life 2009, 2, 386–393. [Google Scholar] [PubMed]
- Louis, D.N.; Perry, A.; Reifenberger, G.; von Deimling, A.; Figarella-Branger, D.; Cavenee, W.K.; Ohgaki, H.; Wiestler, O.D.; Kleihues, P.; Ellison, D.W. The 2016 World Health Organization Classification of Tumors of the Central Nervous System: A summary. Acta Neuropathol. 2016, 131, 803–820. [Google Scholar] [CrossRef] [PubMed]
- Verhaak, R.G.; Hoadley, K.A.; Purdom, E.; Wang, V.; Qi, Y.; Wilkerson, M.D.; Miller, C.R.; Ding, L.; Golub, T.; Mesirov, J.P.; et al. An integrated genomic analysis identifies clinically relevant subtypes of glioblastoma characterized by abnormalities in PDGFRA, IDH1, EGFR and NF1. Cancer Cell 2010, 17, 98–110. [Google Scholar] [CrossRef] [PubMed]
- Keunen, O.; Taxt, T.; Gruner, R.; Lund-Johansen, M.; Tonn, J.C.; Pavlin, T.; Bjerkvig, R.; Niclou, S.P.; Thorsen, F. Multimodal imaging of gliomas in the context of evolving cellular and molecular therapies. Adv. Drug Deliv. Rev. 2014, 76, 98–115. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Soomro, S.H.; Ting, L.R.; Qing, Y.Y.; Ren, M. Molecular biology of glioblastoma: Classification and mutational locations. J. Pak. Med. Assoc. 2017, 67, 1410–1414. [Google Scholar] [PubMed]
- Qin, R.; Zhou, J.X.; Chen, C.; Xu, T.; Yan, Y.; Ma, Y.S.; Zheng, Z.L.; Shen, Y.P.; Lu, Y.C.; Fu, D.; et al. LIN28 is involved in glioma carcinogenesis and predicts outcomes of glioblastoma multiforme patients. PLoS ONE 2014, 9, e86446. [Google Scholar] [CrossRef] [PubMed]
- Xu, Y.Y.; Gao, P.; Sun, Y.; Duan, Y.R. Development of targeted therapies in treatment of glioblastoma. Cancer Biol. Med. 2015, 12, 223–237. [Google Scholar] [PubMed]
- Zhang, J.G.; Kruse, C.A.; Driggers, L.; Hoa, N.; Wisoff, J.; Allen, J.C.; Zagzag, D.; Newcomb, E.W.; Jadus, R. Tumor antigen precursor protein profiles of adult and pediatric brain tumors identify potential targets for immunotherapy. J. Neurooncol. 2008, 88, 65–76. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Urias, U.; Marie, S.K.; Uno, M.; da Silva, R.; Evagelinellis, M.M.; Caballero, O.L.; Stevenson, B.J.; Silva, W.A.; Simpson, A.J.; Oba-Shinjo, S.M. CD99 is upregulated in placenta and astrocytomas with a differential subcellular distribution according to the malignancy stage. J. Neurooncol. 2014, 119, 59–70. [Google Scholar] [CrossRef] [PubMed]
- Jung, T.Y.; Choi, Y.D.; Kim, Y.H.; Lee, J.J.; Kim, H.S.; Kim, J.S.; Kim, S.K.; Jung, S.; Cho, D. Immunological characterization of glioblastoma cells for immunotherapy. Anticancer Res. 2013, 33, 2525–2533. [Google Scholar] [PubMed]
- Bernard, G.; Raimondi, V.; Alberti, I.; Pourtein, M.; Widjenes, J.; Ticchioni, M.; Bernard, A. CD99 (E2) up-regulates alpha4beta1-dependent T cell adhesion to inflamed vascular endothelium under flow conditions. Eur. J. Immunol. 2000, 30, 3061–3065. [Google Scholar] [CrossRef]
- Hahn, J.H.; Kim, M.K.; Choi, E.Y.; Kim, S.H.; Sohn, H.W.; Ham, D.I.; Chung, D.H.; Kim, T.J.; Lee, W.J.; Park, C.K.; et al. CD99 (MIC2) regulates the LFA-1/ICAM-1-mediated adhesion of lymphocytes, and its gene encodes both positive and negative regulators of cellular adhesion. J. Immunol. 1997, 159, 2250–2258. [Google Scholar] [PubMed]
- Manara, M.C.; Pasello, M.; Scotlandi, K. CD99: A Cell Surface Protein with an Oncojanus Role in Tumors. Genes 2018, 9, 159. [Google Scholar] [CrossRef] [PubMed]
- Persson, O.; Krogh, M.; Saal, L.H.; Englund, E.; Liu, J.; Parsons, R.; Mandahl, N.; Borg, A.; Widegren, B.; Salford, L.G. Microarray analysis of gliomas reveals chromosomal position-associated gene expression patterns and identifies potential immunotherapy targets. J. Neurooncol. 2007, 85, 11–24. [Google Scholar] [CrossRef] [PubMed]
- Alberti, I.; Bernard, G.; Rouquette-Jadanian, A.K.; Pelassy, C.; Pourtein, M.; Aussel, C.; Bernard, A. CD99 isoform expression dictates T-cell functional outcomes. FASEB J. 2002, 16, 1946–1948. [Google Scholar] [CrossRef] [PubMed]
- Zucchini, C.; Manara, M.C.; Pinca, R.S.; De Sanctis, P.; Guerzoni, C.; Sciandra, M.; Lollini, P.L.; Cenacchi, G.; Picci, P.; Valvassori, L.; et al. CD99 suppresses osteosarcoma cell migration through inhibition of ROCK2 activity. Oncogene 2014, 33, 1912–1921. [Google Scholar] [CrossRef] [PubMed]
- Byun, H.J.; Hong, I.K.; Kim, E.; Jin, Y.J.; Jeoung, D.I.; Hahn, J.H.; Kim, Y.M.; Park, S.H.; Lee, H. A splice variant of CD99 increases motility and MMP-9 expression of human breast cancer cells through the AKT-, ERK-, and JNK-dependent AP-1 activation signaling pathways. J. Biol. Chem. 2006, 281, 34833–34847. [Google Scholar] [CrossRef] [PubMed]
- Galatro, T.F.; Sola, P.; Moretti, I.F.; Miura, F.K.; Oba-Shinjo, S.M.; Marie, S.K.; Lerario, A.M. Correlation between molecular features and genetic subtypes of glioblastoma: Critical analysis in 109 cases. Med. Express 2017, 4, M170504. [Google Scholar] [CrossRef]
- Hahn, M.J.; Yoon, S.S.; Sohn, H.W.; Song, H.G.; Park, S.H.; Kim, T.J. Differential activation of MAP kinase family members triggered by CD99 engagement. FEBS Lett. 2000, 470, 350–354. [Google Scholar] [CrossRef] [Green Version]
- Pasello, M.; Manara, M.C.; Scotlandi, K. CD99 at the crossroads of physiology and pathology. J. Cell Commun. Signal. 2018, 12, 55–68. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dworzak, M.N.; Froschl, G.; Printz, D.; De Zen, L.; Gaipa, G.; Ratei, R.; Basso, G.; Biondi, A.; Ludwig, W.D.; Gadner, H. CD99 expression in T-lineage ALL: Implications for flow cytometric detection of minimal residual disease. Leukemia 2004, 18, 703–708. [Google Scholar] [CrossRef] [PubMed]
- Sciandra, M.; Marino, M.T.; Manara, M.C.; Guerzoni, C.; Grano, M.; Oranger, A.; Lucarelli, E.; Lollini, P.-L.; Dozza, B.; Pratelli, L.; et al. CD99 drives terminal differentiation of osteosarcoma cells by acting as a spatial regulator of ERK 1/2. J. Bone Miner. Res. 2014, 29, 1295–1309. [Google Scholar] [CrossRef] [PubMed]
- Kim, S.H.; Shin, Y.K.; Lee, I.S.; Bae, Y.M.; Sohn, H.W.; Suh, Y.H.; Ree, H.J.; Rowe, M.; Park, S.H. Viral latent membrane protein 1 (LMP-1)-induced CD99 down-regulation in B cells leads to the generation of cells with Hodgkin’s and Reed-Sternberg phenotype. Blood 2000, 95, 294–300. [Google Scholar] [PubMed]
- Lou, O.; Alcaide, P.; Luscinskas, F.W.; Muller, W.A. CD99 is a key mediator of the transendothelial migration of neutrophils. J. Immunol. 2007, 178, 1136–1143. [Google Scholar] [CrossRef] [PubMed]
- Lee, H.J.; Kim, E.; Jee, B.; Hahn, J.H.; Han, K.; Jung, K.C.; Park, S.H.; Lee, H. Functional involvement of src and focal adhesion kinase in a CD99 splice variant-induced motility of human breast cancer cells. Exp. Mol. Med. 2002, 34, 177–183. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Manara, M.C.; Terracciano, M.; Mancarella, C.; Sciandra, M.; Guerzoni, C.; Pasello, M.; Grilli, A.; Zini, N.; Picci, P.; Colombo, M.P.; et al. CD99 triggering induces methuosis of Ewing sarcoma cells through IGF-1R/RAS/Rac1 signaling. Oncotarget 2016, 7, 79925–79942. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Çelik, H.; Sciandra, M.; Flashner, B.; Gelmez, E.; Kayraklioglu, N.; Allegakoen, D.V.; Petro, J.R.; Conn, E.J.; Hour, S.; Han, J.; et al. Clofarabine inhibits Ewing sarcoma growth through a novel molecular mechanism involving direct binding to CD99. Oncogene 2018, 37, 2181–2196. [Google Scholar]
- Calderwood, D.A. Integrin activation. J. Cell Sci. 2004, 117, 657–666. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dayel, M.J.; Mullins, R.D. Activation of Arp2/3 complex: Addition of the first subunit of the new filament by a WASP protein triggers rapid ATP hydrolysis on Arp2. PLoS Biol. 2004, 2, E91. [Google Scholar] [CrossRef] [PubMed]
- Lee, K.J.; Kim, Y.; Yoo, Y.H.; Kim, M.S.; Lee, S.H.; Kim, C.G.; Park, K.; Jeoung, D.; Lee, H.; Ko, I.Y.; et al. CD99-Derived Agonist Ligands Inhibit Fibronectin-Induced Activation of β1 Integrin through the Protein Kinase A/SHP2/Extracellular Signal-Regulated Kinase/PTPN12/Focal Adhesion Kinase Signaling Pathway. Mol. Cell Biol. 2017, 37, e00675-16. [Google Scholar] [CrossRef] [PubMed]
- Lee, K.J.; Yoo, Y.H.; Kim, M.S.; Yadav, B.K.; Kim, Y.; Lim, D.; Hwangbo, C.; Moon, K.W.; Kim, D.; Jeoung, D.; et al. CD99 inhibits CD98-mediated beta 1 integrin signaling through SHP2-mediated FAK dephosphorylation. Exp. Cell Res. 2015, 336, 211–222. [Google Scholar] [CrossRef] [PubMed]
- Clucas, J.; Valderrama, F. ERM proteins in cancer progression. J. Cell Sci. 2015, 128, 1253. [Google Scholar] [CrossRef] [PubMed]
- Meng, J. Distinct functions of dynamin isoforms in tumorigenesis and their potential as therapeutic targets in cancer. Oncotarget 2017, 8, 41701–41716. [Google Scholar] [CrossRef] [PubMed]
- MacGrath, S.M.; Koleske, A.J. Cortactin in cell migration and cancer at a glance. J. Cell Sci. 2012, 125, 1621–1626. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhong, J.; Paul, A.; Kellie, S.J.; O’Neill, G.M. Mesenchymal migration as a therapeutic target in glioblastoma. J. Oncol. 2010, 2010, 430142. [Google Scholar] [CrossRef] [PubMed]
- Cha, J.; Kang, S.-G.; Kim, P. Strategies of Mesenchymal Invasion of Patient-derived Brain Tumors: Microenvironmental Adaptation. Sci. Rep. 2016, 6, 24912. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Krakhmal, N.V.; Zavyalova, M.V.; Denisov, E.V.; Vtorushin, S.V.; Perelmuter, V.M. Cancer Invasion: Patterns and Mechanisms. Acta Nat. 2015, 7, 17–28. [Google Scholar]
- Seol, H.J.; Chang, J.H.; Yamamoto, J.; Romagnuolo, R.; Suh, Y.; Weeks, A.; Agnihotri, S.; Smith, C.A.; Rutka, J.T. Overexpression of CD99 Increases the Migration and Invasiveness of Human Malignant Glioma Cells. Genes Cancer 2012, 3, 535–549. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Scotlandi, K.; Zuntini, M.; Manara, M.C.; Sciandra, M.; Rocchi, A.; Benini, S.; Nicoletti, G.; Bernard, G.; Nanni, P.; Lollini, P.L.; et al. CD99 isoforms dictate opposite functions in tumour malignancy and metastases by activating or repressing c-Src kinase activity. Oncogene 2007, 26, 6604–6618. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Schwartz, M.A.; Horwitz, A.R. Integrating adhesion, protrusion, and contraction during cell migration. Cell 2006, 125, 1223–1225. [Google Scholar] [CrossRef] [PubMed]
- DiMilla, P.A.; Barbee, K.; Lauffenburger, D.A. Mathematical model for the effects of adhesion and mechanics on cell migration speed. Biophys. J. 1991, 60, 15–37. [Google Scholar] [CrossRef] [Green Version]
- Palecek, S.P.; Loftus, J.C.; Ginsberg, M.H.; Lauffenburger, D.A.; Horwitz, A.F. Integrin-ligand binding properties govern cell migration speed through cell-substratum adhesiveness. Nature 1997, 385, 537–540. [Google Scholar] [CrossRef] [PubMed]
- Chaturvedi, A.; Hoffman, L.M.; Jensen, C.C.; Lin, Y.-C.; Grossmann, A.H.; Randall, R.L.; Lessnic, S.L.; Welm, A.L.; Beckerle, M.C. Molecular dissection of the mechanism by which EWS/FLI expression compromises actin cytoskeletal integrity and cell adhesion in Ewing sarcoma. Mol. Biol. Cell 2014, 25, 2695–2709. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Dobin, A.; Davis, C.A.; Schlesinger, F.; Drenkow, J.; Zaleski, C.; Jha, S.; Batut, P.; Chaisson, M.; Gingeras, T.R. STAR: Ultrafast universal RNA-seq aligner. Bioinformatics 2013, 29, 15–21. [Google Scholar] [CrossRef] [PubMed]
- Li, B.; Dewey, C.N. RSEM: Accurate transcript quantification from RNA-Seq data with or without a reference genome. BMC Bioinform. 2011, 12, 323. [Google Scholar] [CrossRef] [PubMed]
- Liao, Y.; Smyth, G.K.; Shi, W. featureCounts: An efficient general purpose program for assigning sequence reads to genomic features. Bioinformatics 2014, 30, 923–930. [Google Scholar] [CrossRef] [PubMed]
- Wagner, G.P.; Kin, K.; Lynch, V.J. Measurement of mRNA abundance using RNA-seq data: RPKM measure is inconsistent among samples. Theory Biosci. 2012, 131, 281–285. [Google Scholar] [CrossRef] [PubMed]
- Ritchie, M.E.; Phipson, B.; Wu, D.; Hu, Y.; Law, C.W.; Shi, W.; Smyth, G.K. limma powers differential expression analyses for RNA-sequencing and microarray studies. Nucleic Acids Res. 2015, 43, e47. [Google Scholar] [CrossRef] [PubMed]
- DeLuca, D.S.; Levin, J.Z.; Sivachenko, A.; Fennell, T.; Nazaire, M.D.; Williams, C.; Reich, M.; Winckler, W.; Getz, G. RNA-SeQC: RNA-seq metrics for quality control and process optimization. Bioinformatics 2012, 28, 1530–1532. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Huang, D.W.; Sherman, B.T.; Lempicki, R.A. Bioinformatics enrichment tools: Paths toward the comprehensive functional analysis of large gene lists. Nucleic Acids Res. 2009, 37, 1–13. [Google Scholar] [CrossRef] [PubMed]
- Huang, D.W.; Sherman, B.T.; Lempicki, R.A. Systematic and integrative analysis of large gene lists using DAVID bioinformatics resources. Nat. Protoc. 2009, 4, 44–57. [Google Scholar] [CrossRef] [PubMed]
- Huang, D.W.; Sherman, B.T.; Tan, Q.; Collins, J.R.; Alvord, W.G.; Roayaei, J.; Stephens, R.; Baseler, M.W.; Lane, H.C.; Lempicki, R.A. The DAVID Gene Functional Classification Tool: A novel biological module-centric algorithm to functionally analyze large gene lists. Genome Biol. 2007, 8, R183. [Google Scholar] [CrossRef] [PubMed]
- Genomica Data Commons Data Portal. Available online: https://portal.gdc.cancer.gov/ (accessed on 9 November 2017).
- Abramoff, M.D. Image processing with ImageJ. Biophot. Int. 2004, 11, 36–42. [Google Scholar]
Gene | PCR Product (bp) | Orientation | Primer (5′–3′) |
---|---|---|---|
CD99 isoform 1 | 106 | Forward | GATTGTGGGGGCTGTCGT |
Reverse | CACCTCCCCTTGTTCTGCATT | ||
CD99 isoform 2 | 108 | Forward | GATTGTGGGGGCTGTCGT |
Reverse | TCCCTAGGTCTTCAGCCATCATT | ||
GUSB | 101 | Forward | GAAAATACGTGGTTGGAGAGCTCATT |
Reverse | CCGAGTGAAGATCCCCTTTTTA | ||
HPRT | 118 | Forward | TGAGGATTTGGAAAGGGTGT |
Reverse | GAGCACACAGAGGGCTACAA | ||
BCRP | 67 | Forward | CCTTCGACGTCAATAACAAGGAT |
Reverse | CCTGCGATGGCGTTCAC |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Cardoso, L.C.; Soares, R.d.S.; Laurentino, T.d.S.; Lerario, A.M.; Marie, S.K.N.; Oba-Shinjo, S.M. CD99 Expression in Glioblastoma Molecular Subtypes and Role in Migration and Invasion. Int. J. Mol. Sci. 2019, 20, 1137. https://doi.org/10.3390/ijms20051137
Cardoso LC, Soares RdS, Laurentino TdS, Lerario AM, Marie SKN, Oba-Shinjo SM. CD99 Expression in Glioblastoma Molecular Subtypes and Role in Migration and Invasion. International Journal of Molecular Sciences. 2019; 20(5):1137. https://doi.org/10.3390/ijms20051137
Chicago/Turabian StyleCardoso, Lais C., Roseli da S. Soares, Talita de S. Laurentino, Antonio M. Lerario, Suely K. N. Marie, and Sueli Mieko Oba-Shinjo. 2019. "CD99 Expression in Glioblastoma Molecular Subtypes and Role in Migration and Invasion" International Journal of Molecular Sciences 20, no. 5: 1137. https://doi.org/10.3390/ijms20051137