A C2H2-Type Zinc-Finger Protein from Millettia pinnata, MpZFP1, Enhances Salt Tolerance in Transgenic Arabidopsis
Abstract
:1. Introduction
2. Results
2.1. Cloning and Sequence Analysis of MpZFP1
2.2. MpZFP1 Localizes in the Nucleus
2.3. Expression of MpZFP Is Induced by NaCl
2.4. Heterologous Expression of MpZFP1 Strongly Enhances Salt Tolerance in Arabidopsis
2.5. Heterologous Expression of MpZFP1 in Arabidopsis Enhances the Expression of Stress-Responsive Genes
2.6. Heterologous Expression of MpZFP1 in Arabidopsis Improves ROS Scavenging
3. Discussion
4. Materials and Methods
4.1. Plant Materials and Growth Conditions
4.2. Full-Length cDNA Cloning, Motif Prediction and Phylogenetic Analysis
4.3. Subcellular Localization Analysis
4.4. RNA Extraction and Quantitative Real-Time PCR
4.5. Phenotype Analysis of Wild-Type and 35S:MpZFP1 Transgenic Arabidopsis Plants
4.6. DAB and NBT Staining
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Conflicts of Interest
References
- Jamil, A.; Riaz, S.; Ashraf, M.; Foolad, M.R. Gene Expression Profiling of Plants under Salt Stress. Crit. Rev. Plant Sci. 2011, 30, 435–458. [Google Scholar] [CrossRef]
- Munns, R.; Tester, M. Mechanisms of Salinity Tolerance. Annu. Rev. Plant Biol. 2008, 59, 651–681. [Google Scholar] [CrossRef] [Green Version]
- Wang, L.; Mu, M.; Li, X.; Lin, P.; Wang, W. Differentiation between true mangroves and mangrove associates based on leaf traits and salt contents. J. Plant Ecol. 2011, 4, 292–301. [Google Scholar] [CrossRef] [Green Version]
- Marriboina, S.; Sengupta, D.; Kumar, S.; Reddy, A.R. Physiological and molecular insights into the high salinity tolerance of Pongamia pinnata (L.) pierre, a potential biofuel tree species. Plant Sci. 2017, 258, 102–111. [Google Scholar] [CrossRef] [PubMed]
- Marriboina, S.; Reddy, A.R. Hydrophobic cell-wall barriers and vacuolar sequestration of Na+ ions are among the key mechanisms conferring high salinity tolerance in a biofuel tree species, Pongamia pinnata L. pierre. Environ. Exp. Bot. 2020, 171, 103949. [Google Scholar] [CrossRef]
- Marriboina, S.; Sharma, K.; Sengupta, D.; Yadavalli, A.D.; Sharma, R.P.; Attipalli, R.R. Evaluation of high salinity tolerance in Pongamia pinnata (L.) Pierre by a systematic analysis of hormone-metabolic network. Physiol. Plant. 2021. [Google Scholar] [CrossRef] [PubMed]
- Huang, J.; Lu, X.; Yan, H.; Chen, S.; Zhang, W.; Huang, R.; Zheng, Y. Transcriptome characterization and sequencing-based identification of salt-responsive genes in Millettia pinnata, a semi-mangrove plant. DNA Res. 2012, 19, 195–207. [Google Scholar] [CrossRef]
- Wegrzyn, J.L.; Whalen, J.; Kinlaw, C.S.; Harry, D.E.; Puryear, J.; Loopstra, C.A.; Gonzalez-Ibeas, D.; Vasquez-Gross, H.A.; Famula, R.A.; Neale, D.B. Transcriptomic profile of leaf tissue from the leguminous tree, Millettia pinnata. Tree Genet. Genomes 2016, 12, 44. [Google Scholar] [CrossRef]
- Wang, H.; Hu, T.; Huang, J.; Lu, X.; Huang, B.; Zheng, Y. The expression of Millettia pinnata chalcone isomerase in Saccharomyces cerevisiae salt-sensitive mutants enhances salt-tolerance. Int. J. Mol. Sci. 2013, 14, 8775–8786. [Google Scholar] [CrossRef] [Green Version]
- Zhang, Y.; Huang, J.; Hou, Q.; Liu, Y.; Wang, J.; Deng, S. Isolation and Functional Characterization of a Salt-Responsive Calmodulin-Like Gene MpCML40 from Semi-Mangrove Millettia pinnata. Int. J. Mol. Sci. 2021, 22, 3475. [Google Scholar] [CrossRef]
- Han, G.; Lu, C.; Guo, J.; Qiao, Z.; Sui, N.; Qiu, N.; Wang, B. C2H2 Zinc Finger Proteins: Master Regulators of Abiotic Stress Responses in Plants. Front. Plant Sci. 2020, 11, 115. [Google Scholar] [CrossRef] [Green Version]
- Takatsuji, H.; Mori, M.; Benfey, P.N.; Ren, L.; Chua, N.H. Characterization of a zinc finger DNA-binding protein expressed specifically in Petunia petals and seedlings. EMBO J. 1992, 11, 241–249. [Google Scholar] [CrossRef]
- Riechmann, J.L.; Heard, J.; Martin, G.; Reuber, L.; Jiang, C.; Keddie, J.; Adam, L.; Pineda, O.; Ratcliffe, O.J.; Samaha, R.R.; et al. Arabidopsis transcription factors: Genome-wide comparative analysis among eukaryotes. Science 2000, 290, 2105–2110. [Google Scholar] [CrossRef]
- Miller, J.; McLachlan, A.D.; Klug, A. Repetitive zinc-binding domains in the protein transcription factor IIIA from Xenopus oocytes. EMBO J. 1985, 4, 1609–1614. [Google Scholar] [CrossRef]
- Xie, M.; Sun, J.; Gong, D.; Kong, Y. The Roles of Arabidopsis C1-2i Subclass of C2H2-type Zinc-Finger Transcription Factors. Genes 2019, 10, 653. [Google Scholar] [CrossRef] [Green Version]
- Englbrecht, C.C.; Schoof, H.; Böhm, S. Conservation, diversification and expansion of C2H2 zinc finger proteins in the Arabidopsis thaliana genome. BMC Genom. 2004, 5, 39. [Google Scholar] [CrossRef] [Green Version]
- Hu, X.; Zhu, L.; Zhang, Y.; Xu, L.; Li, N.; Zhang, X.; Pan, Y. Genome-wide identification of C2H2 zinc-finger genes and their expression patterns under heat stress in tomato (Solanum lycopersicum L.). PeerJ 2019, 7, e7929. [Google Scholar] [CrossRef] [Green Version]
- Sakamoto, H.; Maruyama, K.; Sakuma, Y.; Meshi, T.; Iwabuchi, M.; Shinozaki, K.; Yamaguchi-Shinozaki, K. Arabidopsis Cys2/His2-type zinc-finger proteins function as transcription repressors under drought, cold, and high-salinity stress conditions. Plant Physiol. 2004, 136, 2734–2746. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wang, F.; Tong, W.; Zhu, H.; Kong, W.; Peng, R.; Liu, Q.; Yao, Q. A novel Cys2/His2 zinc finger protein gene from sweetpotato, IbZFP1, is involved in salt and drought tolerance in transgenic Arabidopsis. Planta 2016, 243, 783–797. [Google Scholar] [CrossRef] [PubMed]
- Wang, K.; Ding, Y.; Cai, C.; Chen, Z.; Zhu, C. The role of C2H2 zinc finger proteins in plant responses to abiotic stresses. Physiol Plant 2019, 165, 690–700. [Google Scholar] [CrossRef] [PubMed]
- Agarwal, P.; Arora, R.; Ray, S.; Singh, A.K.; Singh, V.P.; Takatsuji, H.; Kapoor, S.; Tyagi, A.K. Genome-wide identification of C2H2 zinc-finger gene family in rice and their phylogeny and expression analysis. Plant Mol. Biol. 2007, 65, 467–485. [Google Scholar] [CrossRef]
- Yuan, S.; Li, X.; Li, R.; Wang, L.; Zhang, C.; Chen, L.; Hao, Q.; Zhang, X.; Chen, H.; Shan, Z.; et al. Genome-Wide Identification and Classification of Soybean C2H2 Zinc Finger Proteins and Their Expression Analysis in Legume-Rhizobium Symbiosis. Front. Microbiol. 2018, 9, 126. [Google Scholar] [CrossRef] [Green Version]
- Mittler, R.; Kim, Y.; Song, L.; Coutu, J.; Coutu, A.; Ciftci-Yilmaz, S.; Lee, H.; Stevenson, B.; Zhu, J.K. Gain- and loss-of-function mutations in Zat10 enhance the tolerance of plants to abiotic stress. FEBS Lett. 2006, 580, 6537–6542. [Google Scholar] [CrossRef] [Green Version]
- Davletova, S.; Schlauch, K.; Coutu, J.; Mittler, R. The zinc-finger protein Zat12 plays a central role in reactive oxygen and abiotic stress signaling in Arabidopsis. Plant Physiol. 2005, 139, 847–856. [Google Scholar] [CrossRef] [Green Version]
- Vogel, J.T.; Zarka, D.G.; Van Buskirk, H.A.; Fowler, S.G.; Thomashow, M.F. Roles of the CBF2 and ZAT12 transcription factors in configuring the low temperature transcriptome of Arabidopsis. Plant J. Cell Mol. Biol. 2005, 41, 195–211. [Google Scholar] [CrossRef]
- Huang, J.; Sun, S.-J.; Xu, D.-Q.; Yang, X.; Bao, Y.-M.; Wang, Z.-F.; Tang, H.-J.; Zhang, H. Increased tolerance of rice to cold, drought and oxidative stresses mediated by the overexpression of a gene that encodes the zinc finger protein ZFP245. Biochem. Biophys. Res. Commun. 2009, 389, 556–561. [Google Scholar] [CrossRef] [PubMed]
- Huang, J.; Zhang, H.-S. The plant TFⅢA-type zinc finger proteins and their roles in abiotic stress tolerance. Yi Chuan 2007, 29, 915–922. [Google Scholar] [CrossRef] [PubMed]
- Sun, S.J.; Guo, S.Q.; Yang, X.; Bao, Y.M.; Tang, H.J.; Sun, H.; Huang, J.; Zhang, H.S. Functional analysis of a novel Cys2/His2-type zinc finger protein involved in salt tolerance in rice. J. Exp. Bot. 2010, 61, 2807–2818. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Xu, D.-Q.; Huang, J.; Guo, S.-Q.; Yang, X.; Bao, Y.-M.; Tang, H.-J.; Zhang, H.-S. Overexpression of a TFIIIA-type zinc finger protein gene ZFP252 enhances drought and salt tolerance in rice (Oryza sativa L.). FEBS Lett. 2008, 582, 1037–1043. [Google Scholar] [CrossRef] [Green Version]
- Kim, J.C.; Lee, S.H.; Cheong, Y.H.; Yoo, C.M.; Lee, S.I.; Chun, H.J.; Yun, D.J.; Hong, J.C.; Lee, S.Y.; Lim, C.O.; et al. A novel cold-inducible zinc finger protein from soybean, SCOF-1, enhances cold tolerance in transgenic plants. Plant J. Cell Mol. Biol. 2001, 25, 247–259. [Google Scholar] [CrossRef]
- Kim, Y.H.; Kim, M.D.; Park, S.C.; Yang, K.S.; Jeong, J.C.; Lee, H.S.; Kwak, S.S. SCOF-1-expressing transgenic sweetpotato plants show enhanced tolerance to low-temperature stress. Plant Physiol. Biochem. PPB 2011, 49, 1436–1441. [Google Scholar] [CrossRef]
- Sun, Z.; Liu, R.; Guo, B.; Huang, K.; Wang, L.; Han, Y.; Li, H.; Hou, S. Ectopic expression of GmZAT4, a putative C2H2-type zinc finger protein, enhances PEG and NaCl stress tolerances in Arabidopsis thaliana. 3 Biotech 2019, 9, 166. [Google Scholar] [CrossRef]
- Luo, X.; Bai, X.; Zhu, D.; Li, Y.; Ji, W.; Cai, H.; Wu, J.; Liu, B.; Zhu, Y. GsZFP1, a new Cys2/His2-type zinc-finger protein, is a positive regulator of plant tolerance to cold and drought stress. Planta 2012, 235, 1141–1155. [Google Scholar] [CrossRef]
- Luo, X.; Cui, N.; Zhu, Y.; Cao, L.; Zhai, H.; Cai, H.; Ji, W.; Wang, X.; Zhu, D.; Li, Y.; et al. Over-expression of GsZFP1, an ABA-responsive C2H2-type zinc finger protein lacking a QALGGH motif, reduces ABA sensitivity and decreases stomata size. J. Plant Physiol. 2012, 169, 1192–1202. [Google Scholar] [CrossRef] [PubMed]
- Tang, L.; Cai, H.; Ji, W.; Luo, X.; Wang, Z.; Wu, J.; Wang, X.; Cui, L.; Wang, Y.; Zhu, Y.; et al. Overexpression of GsZFP1 enhances salt and drought tolerance in transgenic alfalfa (Medicago sativa L.). Plant Physiol. Biochem. PPB 2013, 71, 22–30. [Google Scholar] [CrossRef]
- Chang, J.; Yu, T.; Yang, Q.; Li, C.; Xiong, C.; Gao, S.; Xie, Q.; Zheng, F.; Li, H.; Tian, Z.; et al. Hair, encoding a single C2H2 zinc-finger protein, regulates multicellular trichome formation in tomato. Plant J. Cell Mol. Biol. 2018, 96, 90–102. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, Y.; Chu, Z.; Luo, J.; Zhou, Y.; Cai, Y.; Lu, Y.; Xia, J.; Kuang, H.; Ye, Z.; Ouyang, B. The C2H2 zinc-finger protein SlZF3 regulates AsA synthesis and salt tolerance by interacting with CSN5B. Plant Biotechnol. J. 2018, 16, 1201–1213. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Shang, L.; Song, J.; Yu, H.; Wang, X.; Yu, C.; Wang, Y.; Li, F.; Lu, Y.; Wang, T.; Ouyang, B.; et al. A mutation in a C2H2-type zinc finger transcription factor contributed to the transition towards self-pollination in cultivated tomato. Plant Cell 2021, koab201. [Google Scholar] [CrossRef]
- Gao, H.; Song, A.; Zhu, X.; Chen, F.; Jiang, J.; Chen, Y.; Sun, Y.; Shan, H.; Gu, C.; Li, P.; et al. The heterologous expression in Arabidopsis of a chrysanthemum Cys2/His2 zinc finger protein gene confers salinity and drought tolerance. Planta 2012, 235, 979–993. [Google Scholar] [CrossRef]
- Kim, S.H.; Hong, J.K.; Lee, S.C.; Sohn, K.H.; Jung, H.W.; Hwang, B.K. CAZFP1, Cys2/His2-type zinc-finger transcription factor gene functions as a pathogen-induced early-defense gene in Capsicum annuum. Plant Mol. Biol. 2004, 55, 883–904. [Google Scholar] [CrossRef]
- Clough, S.J.; Bent, A.F. Floral dip: A simplified method for Agrobacterium -mediated transformation of Arabidopsis thaliana. Plant J. 1998, 16, 735–743. [Google Scholar] [CrossRef] [Green Version]
- Kiełbowicz-Matuk, A. Involvement of plant C2H2-type zinc finger transcription factors in stress responses. Plant Sci. 2012, 185–186, 78–85. [Google Scholar] [CrossRef] [PubMed]
- Kazan, K. Negative regulation of defence and stress genes by EAR-motif-containing repressors. Trends Plant Sci. 2006, 11, 109–112. [Google Scholar] [CrossRef] [PubMed]
- Ma, N.L.; Rahmat, Z.; Lam, S.S. A review of the "Omics" approach to biomarkers of oxidative stress in Oryza sativa. Int. J. Mol. Sci. 2013, 14, 7515–7541. [Google Scholar] [CrossRef] [PubMed]
- Stothard, P. The sequence manipulation suite: JavaScript programs for analyzing and formatting protein and DNA sequences. BioTechniques 2000, 28, 1102–1104. [Google Scholar] [CrossRef] [Green Version]
- Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular Evolutionary Genetics Analysis across Computing Platforms. Mol. Biol. Evol. 2018, 35, 1547–1549. [Google Scholar] [CrossRef] [PubMed]
Name | Sequences (5′–3′) | Description |
---|---|---|
MpActin_F | AGAGCAGTTCTTCAGTTGAG | RT-PCR |
MpActin_R | TCCTCCAATCCAGACACTAT | RT-PCR |
Mp18s_RtF | GCTCGTAGTTGGACCTTG | RT-PCR |
Mp18s_RtR | TTCGCAGTTGTTCGTCTT | RT-PCR |
MpZFP1_RtF | TTTGCTGTAGGACAAGCTTTGGGA | RT-PCR |
MpZFP1_RtR | CGGGAAACAAAATTGATCTCTTGCT | RT-PCR |
RD22_RtF | ACGTCAGGGCTGTTTCCAC | RT-PCR |
RD22_RtR | TACTTCTGTTTGTGACACACC | RT-PCR |
RD29A_RtF | TTCCGTTGAAGAGTCTCCAC | RT-PCR |
RD29A_RtR | AACAAAACACACATAAACATCC | RT-PCR |
RD29B_RtF | CCACGGTCCGTTGAAGAGTC | RT-PCR |
RD29B_RtR | CAAAAACACAAACATTCAAAAGC | RT-PCR |
AtAct2_RtF | GACCTTTAACTCTCCCGCTATG | RT-PCR |
AtAct2_RtR | GAGACACACCATCACCAGAAT | RT-PCR |
Long-UPM | CTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCA | RACE |
Short-UPM | CTAATACGACTCACTATAGGGC | RACE |
NUP | AAGCAGTGGTATCAACGCAGAGT | RACE |
MpZFP1_5′GSP | TGGCTTCTTATGGCTTGCACGGT | RACE |
MpZFP1_5′NGSP | TGGCGGTTACATGTCTTGCACTCGAAG | RACE |
MpZFP1_3′GSP | GGACAAGCTTTGGGAGGCCACATGA | RACE |
MpZFP1_BamHIF | TATGGATCCATGAAGAGAGAAAGGGAAGGT | clone |
MpZFP1_SacIR | CACGAGCTCTCAATTGAAACAATGAACCAAAG | clone |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yu, Z.; Yan, H.; Liang, L.; Zhang, Y.; Yang, H.; Li, W.; Choi, J.; Huang, J.; Deng, S. A C2H2-Type Zinc-Finger Protein from Millettia pinnata, MpZFP1, Enhances Salt Tolerance in Transgenic Arabidopsis. Int. J. Mol. Sci. 2021, 22, 10832. https://doi.org/10.3390/ijms221910832
Yu Z, Yan H, Liang L, Zhang Y, Yang H, Li W, Choi J, Huang J, Deng S. A C2H2-Type Zinc-Finger Protein from Millettia pinnata, MpZFP1, Enhances Salt Tolerance in Transgenic Arabidopsis. International Journal of Molecular Sciences. 2021; 22(19):10832. https://doi.org/10.3390/ijms221910832
Chicago/Turabian StyleYu, Zhonghua, Hao Yan, Ling Liang, Yi Zhang, Heng Yang, Wei Li, Jaehyuck Choi, Jianzi Huang, and Shulin Deng. 2021. "A C2H2-Type Zinc-Finger Protein from Millettia pinnata, MpZFP1, Enhances Salt Tolerance in Transgenic Arabidopsis" International Journal of Molecular Sciences 22, no. 19: 10832. https://doi.org/10.3390/ijms221910832