Amelioration of Hepatic Steatosis by the Androgen Receptor Inhibitor EPI-001 in Mice and Human Hepatic Cells Is Associated with the Inhibition of CYP2E1
Abstract
:1. Introduction
2. Results
2.1. EPI-001 Blocks Lipid Accumulation in Human Hepatic Cells
2.2. EPI-001 Protects against HFHSD-Induced Hepatic Steatosis in Mice
2.3. EPI-001 Decreases the mRNA Level of Lipid Synthesis-Related Genes
2.4. The role of EPI-001 in Blocking Lipid Accumulation Is Related to CYP2E1 Inhibition and Oxidation Protection
3. Discussion
4. Materials and Methods
4.1. Cell Culture and CCK8 Assay
4.2. Analysis of Lipid Accumulation in Human Hepatic Cells
4.3. Animal, Diets, and Treatment
4.4. Biochemistry Examination
4.5. Histological Examination of Mouse Liver
4.6. RNA Isolation and RT-qPCR Analysis
4.7. Western Blot Analysis
4.8. Detection of Oxidative Stress-Related Indicators
4.9. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Chalasani, N.; Younossi, Z.; Lavine, J.E.; Charlton, M.; Cusi, K.; Rinella, M.; Harrison, S.A.; Brunt, E.M.; Sanyal, A.J. The diagnosis and management of nonalcoholic fatty liver disease: Practice guidance from the American association for the study of liver diseases. Hepatology 2018, 67, 328–357. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rinella, M.E. Nonalcoholic fatty liver disease: A systematic review. JAMA 2015, 313, 2263–2273. [Google Scholar] [CrossRef] [PubMed]
- El Hadi, H.; Vincenzo, A.D.; Vettor, R.; Rossato, M. Cardio-metabolic disorders in non-alcoholic fatty liver disease. Int. J. Mol. Sci. 2019, 20, 2215. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Younossi, Z.; Anstee, Q.M.; Marietti, M.; Hardy, T.; Henry, L.; Eslam, M.; George, J.; Bugianesi, E. Global burden of NAFLD and NASH: Trends, predictions, risk factors and prevention. Nature reviews. J. Gastroenterol. Hepatol. 2018, 15, 11–20. [Google Scholar]
- Eslam, M.; Sanyal, A.J.; George, J.; International Consensus Panel. MAFLD: A consensus-driven proposed nomenclature for metabolic associated fatty liver disease. Gastroenterology 2020, 158, 999–2014. [Google Scholar] [CrossRef]
- Vuittonet, C.L.; Halse, M.; Leggio, L.; Fricchione, S.B.; Brickley, M.; Haass-Koffler, C.L.; Tavares, T.; Swift, R.M.; Kenna, G.A. Pharmacotherapy for alcoholic patients with alcoholic liver disease. Am. J. Health-Syst. Pharm. 2014, 71, 1265–1276. [Google Scholar] [CrossRef] [Green Version]
- Yang, H.; Yang, T.; Heng, C.; Zhou, Y.; Jiang, Z.; Qian, X.; Du, L.; Mao, S.; Yin, X.; Lu, Q. Quercetin improves nonalcoholic fatty liver by ameliorating inflammation, oxidative stress, and lipid metabolism in db/db mice. Phytother. Res. 2019, 33, 3140–3152. [Google Scholar] [CrossRef]
- Masarone, M.; Rosato, V.; Dallio, M.; Gravina, A.G.; Aglitti, A.; Loguercio, C.; Federico, A.; Persico, M. Role of oxidative stress in pathophysiology of nonalcoholic fatty liver disease. Oxid. Med. Cell Longev. 2018, 2018, 9547613. [Google Scholar] [CrossRef]
- Chen, Z.; Tian, R.; She, Z.; Cai, J.; Li, H. Role of oxidative stress in the pathogenesis of nonalcoholic fatty liver disease. Free Radic. Biol. Med. 2020, 152, 116–141. [Google Scholar] [CrossRef]
- Simões, I.C.M.; Fontes, A.; Pinton, P.; Zischka, H.; Wieckowski, M.R. Mitochondria in non-alcoholic fatty liver disease. Int. J. Biochem. Cell Biol. 2018, 95, 93–99. [Google Scholar] [CrossRef]
- Basaranoglu, M.; Basaranoglu, G.; Sentürk, H. From fatty liver to fibrosis: A tale of “second hit”. World J. Gastroenterol. 2013, 19, 1158–1165. [Google Scholar] [CrossRef]
- Jian, T.; Ding, X.; Wu, Y.; Ren, B.; Li, W.; Lv, H.; Chen, J. Hepatoprotective effect of loquat leaf flavonoids in PM2.5-induced Non-alcoholic fatty liver disease via regulation of IRs-1/Akt and CYP2E1/JNK pathways. Int. J. Mol. Sci. 2018, 19, 3005. [Google Scholar] [CrossRef] [Green Version]
- Aubert, J.; Begriche, K.; Knockaert, L.; Robin, M.A.; Fromenty, B. Increased expression of cytochrome P450 2E1 in nonalcoholic fatty liver disease: Mechanisms and pathophysiological role. Clin. Res. Hepatol. Gastroenterol. 2011, 35, 630–637. [Google Scholar] [CrossRef]
- Andersen, R.J.; Mawji, N.R.; Wang, J.; Wang, G.; Haile, S.; Myung, J.K.; Watt, K.; Tam, T.; Yang, Y.C.; Bañuelos, C.A.; et al. Regression of castrate-recurrent prostate cancer by a small-molecule inhibitor of the amino-terminus domain of the androgen receptor. Cancer Cell 2010, 17, 535–546. [Google Scholar] [CrossRef] [Green Version]
- Myung, J.K.; Banuelos, C.A.; Fernandez, J.G.; Mawji, N.R.; Wang, J.; Tien, A.H.; Yang, Y.C.; Tavakoli, I.; Haile, S.; Watt, K.; et al. An androgen receptor N-terminal domain antagonist for treating prostate cancer. J. Clin. Investig. 2013, 123, 2948–2960. [Google Scholar] [CrossRef] [Green Version]
- Crona, D.J.; Milowsky, M.I.; Whang, Y.E. Androgen receptor targeting drugs in castration-resistant prostate cancer and mechanisms of resistance. Clin. Pharmacol. Ther. 2015, 98, 582–589. [Google Scholar] [CrossRef] [Green Version]
- Sadar, M.D.; Williams, D.E.; Mawji, N.R.; Patrick, B.O.; Wikanta, T.; Chasanah, E.; Irianto, H.E.; Soest, R.V.; Andersen, R.J. Sintokamides A to E, chlorinated peptides from the sponge Dysidea sp. that inhibit transactivation of the N-terminus of the androgen receptor in prostate cancer cells. Org. Lett. 2008, 10, 4947–4950. [Google Scholar] [CrossRef]
- Brand, L.J.; Olson, M.E.; Ravindranathan, P.; Guo, H.; Kempema, A.M.; Andrews, T.E.; Chen, X.; Raj, G.V.; Harki, D.A.; Dehm, S.M. EPI-001 is a selective peroxisome proliferator-activated receptor-gamma modulator with inhibitory effects on androgen receptor expression and activity in prostate cancer. Oncotarget 2015, 6, 3811–3824. [Google Scholar] [CrossRef] [Green Version]
- Gawrieh, S.; Noureddin, M.; Loo, N.; Mohseni, R.; Awasty, V.; Cusi, K.; Kowdley, K.V.; Lai, M.; Schiff, E.; Parmar, D.; et al. Saroglitazar, a PPAR-α/γ agonist, for treatment of NAFLD: A randomized controlled double-blind phase 2 trial. Hepatology 2021, 74, 1809–1824. [Google Scholar] [CrossRef]
- Wang, Y.; Nakajima, T.; Gonzalez, F.J.; Tanaka, N. PPARs as metabolic regulators in the liver: Lessons from liver-specific PPAR-null mice. Int. J. Mol. Sci. 2020, 21, 2061. [Google Scholar] [CrossRef] [Green Version]
- Farzanegi, P.; Dana, A.; Ebrahimpoor, Z.; Asadi, M.; Azarbayjani, M.A. Mechanisms of beneficial effects of exercise training on non-alcoholic fatty liver disease (NAFLD): Roles of oxidative stress and inflammation. Eur. J. Sport Sci. 2019, 19, 994–1003. [Google Scholar] [CrossRef] [PubMed]
- Wang, K.; Tan, W.; Liu, X.; Deng, L.; Huang, L.; Wang, X.; Gao, X. New insight and potential therapy for NAFLD: CYP2E1 and flavonoids. Biomed. Pharmacother. 2021, 137, 111326. [Google Scholar] [CrossRef] [PubMed]
- Lonardo, A.; Ballestri, S.; Marchesini, G.; Angulo, P.; Loria, P. Nonalcoholic fatty liver disease: A precursor of the metabolic syndrome. Dig. Liver Dis. 2015, 47, 181–190. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Day, C.P.; Saksena, S. Non-alcoholic steatohepatitis: Definitions and pathogenesis. J. Gastroenterol. Hepatol. 2002, 17 (Suppl. S3), S377–S384. [Google Scholar] [CrossRef] [PubMed]
- Sanyal, A.J.; American Gastroenterological Association. AGA technical review on nonalcoholic fatty liver disease. Gastroenterology 2002, 123, 1705–1725. [Google Scholar] [CrossRef]
- Hoffmann, L.S.; Etzrodt, J.; Willkomm, L.; Sanyal, A.; Scheja, L.; Fischer, A.W.C.; Stasch, J.P.; Bloch, W.; Friebe, A.; Heeren, J.; et al. Stimulation of soluble guanylyl cyclase protects against obesity by recruiting brown adipose tissue. Nat. Commun. 2015, 6, 7235. [Google Scholar] [CrossRef] [Green Version]
- Aljomah, G.; Baker, S.S.; Liu, W.; Kozielski, R.; Oluwole, J.; Lupu, B.; Baker, R.D.; Zhu, L. Induction of CYP2E1 in non-alcoholic fatty liver diseases. Exp. Mol. Pathol. 2015, 99, 677–681. [Google Scholar] [CrossRef] [Green Version]
- Novak, R.E.; Woodcroft, K.J. The alcohol-inducible form of cytochrome P450 (CYP2E1): Role in toxicology and regulation of expression. Arch. Pharmacol. Res. 2000, 23, 267–282. [Google Scholar] [CrossRef]
- Norris, S.M.; Bombardier, E.; Smith, I.C.; Vigna, C.; Tupling, A.R. ATP consumption by sarcoplasmic reticulum Ca2+ pumps accounts for 50% of resting metabolic rate in mouse fast and slow twitch skeletal muscle. Am. J. Physiol. 2012, 298, C521–C529. [Google Scholar] [CrossRef] [Green Version]
- Samuel, W.F. The importance of CYP2E1 in the pathogenesis of alcoholic liver disease and drug toxicity and the role of the proteasome. Subcell. Biochem. 2013, 67, 145–164. [Google Scholar]
- Liu, H.; Baliga, R. Cytochrome P450 2E1 null mice provide novel protection against cisplatin-induced nephrotoxicity and apoptosis. Kidney Int. 2003, 63, 1687–1696. [Google Scholar] [CrossRef] [Green Version]
- Neuman, M.G.; Seitz, H.K.; French, S.W.; Malnick, S.; Tsukamoto, H.; Cohen, L.B.; Hoffman, P.; Tabakoff, B.; Fasullo, M.; Nagy, L.E.; et al. Alcoholic-Hepatitis, links to brain and microbiome: Mechanisms, clinical and experimental research. Biomedicines 2020, 8, 63. [Google Scholar] [CrossRef]
- Toda-Oti, K.S.; Stefano, J.T.; Cavaleiro, A.M.; Carrilho, F.J.; Correa-Gianella, M.L.; Oliveira, C. Association of UCP3 polymorphisms with nonalcoholic steatohepatitis and metabolic syndrome in nonalcoholic fatty liver disease brazilian patients. Metab. Syndr. Relat. Disord. 2022, 20, 114–123. [Google Scholar] [CrossRef]
- Leung, T.M.; Nieto, N. CYP2E1 and oxidant stress in alcoholic and non-alcoholic fatty liver disease. J. Hepatol. 2013, 58, 395–398. [Google Scholar] [CrossRef] [Green Version]
- Lu, Y.; Zhuge, J.; Wang, X.; Bai, J.; Cederbaum, A.I. Cytochrome P450 2E1 contributes to ethanol-induced fatty liver in mice. Hepatology 2008, 47, 1483–1494. [Google Scholar] [CrossRef]
- Ceni, E.; Mello, T.; Galli, A. Pathogenesis of alcoholic liver disease: Role of oxidative metabolism. World J. Gastroenterol. 2014, 20, 17756–17772. [Google Scholar] [CrossRef]
- Natalia, N.; Friedman, S.L.; Cederbaum, A.I. Cytochrome P450 2E1-derived reactive oxygen species mediate paracrine stimulation of collagen I protein synthesis by hepatic stellate cells. J. Biol. Chem. 2002, 277, 9853–9864. [Google Scholar]
- Jian, T.; Yu, C.; Ding, X.; Chen, J.; Li, J.; Zuo, Y.; Ren, B.; Lv, H.; Li, W. Hepatoprotective effect of seed coat of Euryale ferox extract in Non-alcoholic fatty liver disease induced by high-fat diet in mice by increasing IRs-1 and inhibiting CYP2E1. J. Oleo Sci. 2019, 68, 581–589. [Google Scholar] [CrossRef] [Green Version]
- Diesinger, T.; Buko, V.; Lautwein, A.; Dvorsky, R.; Belonovskaya, E.; Lukivskaya, O.; Naruta, E.; Kirko, S.; Andreev, V.; Buckert, D.; et al. Drug targeting CYP2E1 for the treatment of early-stage alcoholic steatohepatitis. PLoS ONE 2020, 15, e0235990. [Google Scholar] [CrossRef]
- Zelber-Sagi, S.; Lotan, R.; Shlomai, A.; Webb, M.; Harrari, G.; Buch, A.; Kaluski, D.N.; Halpern, Z.; Oren, R. Predictors for incidence and remission of NAFLD in the general population during a seven-year prospective follow-up. J. Hepatol. 2012, 56, 1145–1151. [Google Scholar] [CrossRef]
- Wong, V.W.; Wong, G.L.; Yeung, D.K.; Lau, T.K.; Chan, C.K.; Chim, A.M.; Abrigo, J.M.; Chan, R.S.; Woo, J.; Tse, Y.K.; et al. Incidence of non-alcoholic fatty liver disease in Hong Kong: A population study with paired proton-magnetic resonance spectroscopy. J. Hepatol. 2015, 62, 182–189. [Google Scholar] [CrossRef] [PubMed]
- Yun, K.E.; Nam, G.E.; Lim, J.; Park, H.S.; Chang, Y.; Jung, H.S.; Kim, C.W.; Ko, B.J.; Chung, E.C.; Shin, H.; et al. Waist gain is associated with a higher incidence of nonalcoholic fatty liver disease in korean adults: A cohort study. PLoS ONE 2016, 11, e0158710. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lonardo, A.; Bellentani, S.; Argo, C.K.; Ballestri, S.; Byrne, C.D.; Caldwell, S.H.; Cortez-Pinto, H.; Grieco, A.; Machado, M.V.; Miele, L.; et al. Epidemiological modifiers of non-alcoholic fatty liver disease: Focus on high-risk groups. Dig. Liver Dis. 2015, 47, 997–1006. [Google Scholar] [CrossRef] [PubMed]
- Lonardo, A.; Carani, C.; Carulli, N.; Loria, P. ‘Endocrine NAFLD’ a hormonocentric perspective of nonalcoholic fatty liver disease pathogenesis. J. Hepatol. 2006, 44, 1196–1207. [Google Scholar] [CrossRef] [PubMed]
- Ballestri, S.; Nascimbeni, F.; Baldelli, E.; Marrazzo, A.; Romagnoli, D.; Lonardo, A. NAFLD as a sexual dimorphic disease: Role of gender and reproductive status in the development and progression of nonalcoholic fatty liver disease and inherent cardiovascular risk. Adv. Ther. 2017, 34, 1291–1326. [Google Scholar] [CrossRef]
- Konstandi, M.; Cheng, J.; Gonzalez, F.J. Sex steroid hormones regulate constitutive expression of Cyp2e1 in female mouse liver. Am. J. Physiol. Endocrinol. Metab. 2013, 304, E1118–E1128. [Google Scholar] [CrossRef] [Green Version]
- Xu, H.; Zhou, Y.; Liu, Y.; Ping, J.; Shou, Q.; Chen, F.; Ruo, R. Metformin improves hepatic IRS2/PI3K/Akt signaling in insulin-resistant rats of NASH and cirrhosis. J. Endocrinol. 2016, 229, 133–144. [Google Scholar] [CrossRef] [Green Version]
- Li, X.; Chen, Y.T.; Josson, S.; Mukhopadhyay, N.K.; Kim, J.; Freeman, M.R.; Huang, W.C. MicroRNA-185 and 342 inhibit tumorigenicity and induce apoptosis through blockade of the SREBP metabolic pathway in prostate cancer cells. PLoS ONE 2013, 8, e70987. [Google Scholar] [CrossRef]
- Ren, T.; Zhu, J.; Zhu, L.; Cheng, M. The Combination of Blueberry Juice and Probiotics Ameliorate Non-Alcoholic Steatohepatitis (NASH) by Affecting SREBP-1c/PNPLA-3 Pathway via PPAR-α. Nutrients 2017, 9, 198. [Google Scholar] [CrossRef] [Green Version]
- Browning, J.D.; Kumar, K.S.; Saboorian, M.H.; Thiele, D.L. Ethnic differences in the prevalence of cryptogenic cirrhosis. Am. J. Gastroenterol. 2004, 99, 292–298. [Google Scholar] [CrossRef]
- Kleiner, D.E.; Brunt, E.M.; Van Natta, M.; Behling, C.; Contos, M.J.; Cummings, O.W.; Ferrell, L.D.; Liu, Y.C.; Torbenson, M.S.; Unalp-Arida, A.; et al. Design and validation of a histological scoring system for nonalcoholic fatty liver disease. Hepatology 2005, 41, 1313–1321. [Google Scholar] [CrossRef]
Gene | Forward Primer | Reverse Primer |
---|---|---|
FAS Human Mouse | GGACCCAGAATACCAAGTGCAG CTGCGATTCTCCTGGCTGTGAA | GTTGCTGGTGAGTGTGCATTCC CAACAACCATAGGCGATTTCTGG |
SREBP-1c Human Mouse | GCGCCTTGACAGGTGAAGTC CGACTACATCCGCTTCTTGCAG | GCCAGGGAAGTCACTGTCTTG CCTCCATAGACACATCTGTGCC |
ACC1 Human Mouse | TTCACTCCACCTTGTCAGCGGA GTTCTGTTGGACAACGCCTTCAC | GTCAGAGAAGCAGCCCATCACT GGAGTCACAGAAGCAGCCCATT |
PPARα Human Mouse | TCGGCGAGGATAGTTCTGGAAG ACCACTACGGAGTTCACGCATG | GACCACAGGATAAGTCACCGAG GAATCTTGCAGCTCCGATCACAC |
CYP2E1 Human Mouse | GAGCACCATCAATCTCTGGACC AGGCTGTCAAGGAGGTGCTACT | CACGGTGATACCGTCCATTGTG AAAACCTCCGCACGTCCTTCCA |
AR Human Mouse | ATGGTGAGCAGAGTGCCCTATC TCCAAGACCTATCGAGGAGCG | ATGGTCCCTGGCAGTCTCCAAA GTGGGCTTGAGGAGAACCAT |
GAPDH Human Mouse | GTCTCCTCTGACTTCAACAGCG CATCACTGCCACCCAGAAGACTG | ACCACCCTGTTGCTGTAGCCAA ATGCCAGTGAGCTTCCCGTTCAG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, S.; Li, X.; Xu, W.; Gao, J.; Wang, Y.; Jia, X.; Li, G.; Pan, Q.; Chen, K. Amelioration of Hepatic Steatosis by the Androgen Receptor Inhibitor EPI-001 in Mice and Human Hepatic Cells Is Associated with the Inhibition of CYP2E1. Int. J. Mol. Sci. 2022, 23, 16063. https://doi.org/10.3390/ijms232416063
Wang S, Li X, Xu W, Gao J, Wang Y, Jia X, Li G, Pan Q, Chen K. Amelioration of Hepatic Steatosis by the Androgen Receptor Inhibitor EPI-001 in Mice and Human Hepatic Cells Is Associated with the Inhibition of CYP2E1. International Journal of Molecular Sciences. 2022; 23(24):16063. https://doi.org/10.3390/ijms232416063
Chicago/Turabian StyleWang, Shuqin, Xue Li, Weizhe Xu, Jing Gao, Yin Wang, Xiaoyuan Jia, Gongchu Li, Qiuwei Pan, and Kan Chen. 2022. "Amelioration of Hepatic Steatosis by the Androgen Receptor Inhibitor EPI-001 in Mice and Human Hepatic Cells Is Associated with the Inhibition of CYP2E1" International Journal of Molecular Sciences 23, no. 24: 16063. https://doi.org/10.3390/ijms232416063