Identification of Gene Responsible for Conferring Resistance against Race KN2 of Podosphaera xanthii in Melon
Abstract
:1. Introduction
2. Results
2.1. Pathogen Isolate and Determination of Physiological Race
2.2. Inheritance of Resistance
2.3. Molecular Analysis of Resistance against Powdery Mildew Race KN2
3. Discussion
4. Materials and Methods
4.1. Plant Material and Screening against Pathogen
4.2. Mapping Population
4.3. Pathogen Isolate
4.4. Inoculation and Disease Assessment
4.5. DNA Extraction
4.6. Genotyping with the Reported Molecular Markers
4.7. Identification of Candidate Genes
4.8. Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Garcia-Mas, J.; Benjak, A.; Sanseverino, W.; Bourgeois, M.; Mir, G.; González, V.M.; Hénaff, E.; Câmara, F.; Cozzuto, L.; Lowy, E.; et al. The genome of melon (Cucumis melo L.). Proc. Natl. Acad. Sci. USA 2012, 109, 11872–11877. [Google Scholar] [CrossRef]
- Food and Agriculture Organization of the United Nations. The FAO Statistical Database-Agriculture. 2023. Available online: https://www.fao.org/statistics/en/ (accessed on 11 April 2023).
- Agrios, G. How plants defend themselves against pathogens. Plant Pathol. 2005, 93, 114. [Google Scholar]
- Damm, U.; Cannon, P.F.; Liu, F.; Barreto, R.W.; Guatimosim, E.; Crous, P.W. The Colletotrichum orbiculare species complex: Important pathogens of field crops and weeds. Fungal Divers. 2013, 61, 29–59. [Google Scholar] [CrossRef]
- Wang, Y.-H.; Wu, D.-H.; Huang, J.-H.; Tsao, S.-J.; Hwu, K.-K.; Lo, H.-F. Mapping quantitative trait loci for fruit traits and powdery mildew resistance in melon (Cucumis melo). Bot. Stud. 2016, 57, 19. [Google Scholar] [CrossRef] [PubMed]
- Kasiamdari, R.S.; Riefani, M.K.; Daryono, B.S. The occurrence and identification of powdery mildew on melon in Java, Indonesia. In Proceedings of the 4th International Conference on Biological Science, Yogyakarta, Indonesia, 18–19 September 2015; p. 020050. [Google Scholar]
- Epinat, C.; Pitrat, M.; Bertrand, F. Genetic analysis of resistance of five melon lines to powdery mildews. Euphytica 1992, 65, 135–144. [Google Scholar] [CrossRef]
- Mohamed, Y.F.; Bardin, M.; Nicot, P.C.; Pitrat, M. Causal Agents of Powdery Mildew of Cucurbits in Sudan. Plant Dis. 1995, 79, 634–636. [Google Scholar] [CrossRef]
- McCreight, J.D.; Pitrat, M.; Thomas, C.E.; Kishaba, A.N.; Bohn, G.W. Powdery Mildew Resistance Genes in Muskmelon. J. Am. Soc. Hortic. Sci. 1987, 112, 156–160. [Google Scholar] [CrossRef]
- Cohen, Y.; Eyal, H. Differential expression of resistance to powdery mildew incited by race 1 or 2 ofsphaerotheca fuliginea in Cucumis melo genotypes at various stages of plant development. Phytoparasitica 1995, 23, 223–230. [Google Scholar] [CrossRef]
- Hosoya, K.; Narisawa, K.; Pitrat, M.; Ezura, H. Race identification in powdery mildew (Sphaerotheca fuliginea) on melon (Cucumis melo) in Japan. Plant Breed. 1999, 118, 259–262. [Google Scholar] [CrossRef]
- Hosoya, K.; Kuzuya, M.; Murakami, T.; Kato, K.; Narisawa, K.; Ezura, H. Impact of resistant melon cultivars on Sphaerotheca fuliginea. Plant Breed. 2000, 119, 286–288. [Google Scholar] [CrossRef]
- Robinson, R.W.; Decker-Walters, D.S. Diseases and nematodes. In Cucurbits; CAB International: Wallingford, UK, 1997; pp. 164–189. [Google Scholar]
- McCreight, J.D. Genes for Resistance to Powdery Mildew Races 1 and 2U.S. in Melon PI 313970. HortScience 2003, 38, 591–594. [Google Scholar] [CrossRef]
- Kacem, K.; Chikh-Rouhou, H. Preliminary Selection and Phenotypic Characterization of Melon Landraces Exhibiting Re-sistance to Powdery Mildew. Int. J. Phytopathol. 2022, 11, 115–123. [Google Scholar] [CrossRef]
- McGrath, M.T.; Thomas, C.E. Powdery mildew. In Compendium of Cucurbit Diseases; Zitter, T.A., Hopkins, D.L., Thomas, C.E., Eds.; Springer: Berlin/Heidelberg, Germany; pp. 28–30.
- Křístková, E.; Lebeda, A.; Sedláková, B. Species spectra, distribution and host range of cucurbit powdery mildews in the Czech Republic, and in some other European and Middle Eastern countries. Phytoparasitica 2009, 37, 337–350. [Google Scholar] [CrossRef]
- McCreight, J.D. Melon-Powdery Mildew Interactions Reveal Variation in Melon Cultigens and Podosphaera xanthii Races 1 and 2. J. Am. Soc. Hortic. Sci. 2006, 131, 59–65. [Google Scholar] [CrossRef]
- Kim, H.-T.; Park, J.-I.; Robin, A.H.K.; Ishikawa, T.; Kuzuya, M.; Horii, M.; Yashiro, K.; Nou, I.-S. Identification of a New Race and Development of DNA Markers Associated with Powdery Mildew in Melon. Plant Breed. Biotechnol. 2016, 4, 225–233. [Google Scholar] [CrossRef]
- Hong, Y.-J.; Hossain, M.R.; Kim, H.-T.; Park, J.-I.; Nou, I.-S. Identification of Two New Races of Podosphaera xanthii Causing Powdery Mildew in Melon in South Korea. Plant Pathol. J. 2018, 34, 182–190. [Google Scholar] [CrossRef]
- Bardin, M.; Carlier, J.; Nicot, P.C. Genetic differentiation in the French population of Erysiphe cichoracearum, a causal agent of powdery mildew of cucurbits. Plant Pathol. 1999, 48, 531–540. [Google Scholar] [CrossRef]
- Rabelo, H.D.O.; Santos, L.D.S.; Diniz, G.M.M.; Marin, M.V.; Braz, L.T.; McCreight, J.D. Cucurbits powdery mildew race identity and reaction of melon genotypes1. Pesqui. Agropecuária Trop. 2017, 47, 440–447. [Google Scholar] [CrossRef]
- Ning, X.; Wang, X.; Gao, X.; Zhang, Z.; Zhang, L.; Yan, W.; Li, G. Inheritance and location of powdery mildew resistance gene in melon PMR6. PMRActa Hortic Sin. 2015, 42, 1121. [Google Scholar]
- Wang, X.; Li, G.; Gao, X.; Xiong, L.; Wang, W.; Han, R. Powdery mildew resistance gene (Pm-AN) located in a segregation distortion region of melon LGV. Euphytica 2011, 180, 421–428. [Google Scholar] [CrossRef]
- Hollomon, D.W.; Wheeler, I.E. Controlling powdery mildews with chemistry. In The Powdery Mildews: A Comprehensive Treatise; CABI: Wallingford, UK, 2002; pp. 249–255. [Google Scholar]
- Lebeda, A.; McGrath, M.T.; Sedláková, B. Fungicide resistance in cucurbit powdery mildew fungi. Fungicides 2010, 11, 221–246. [Google Scholar]
- Ning, X.; Wang, X.; Gao, X.; Zhang, Z.; Zhang, L.; Yan, W.; Li, G. Inheritances and location of powdery mildew resistance gene in melon Edisto47. Euphytica 2013, 195, 345–353. [Google Scholar] [CrossRef]
- Yuste-Lisbona, F.J.; Capel, C.; Gómez-Guillamón, M.L.; Capel, J.; López-Sesé, A.I.; Lozano, R. Codominant PCR-based markers and candidate genes for powdery mildew resistance in melon (Cucumis melo L.). Theor. Appl. Genet. 2011, 122, 747–758. [Google Scholar] [CrossRef]
- Yuste-Lisbona, F.J.; Capel, C.; Sarria, E.; Torreblanca, R.; Gómez-Guillamón, M.L.; Capel, J.; Lozano, R.; López-Sesé, A.I. Genetic linkage map of melon (Cucumis melo L.) and localization of a major QTL for powdery mildew resistance. Mol. Breed. 2010, 27, 181–192. [Google Scholar] [CrossRef]
- Daryono, B.S.; Yambise, H.C. Deteksi Gen Ketahanan Terhadap Powdery Mildew Pada Melon (Cucumis melo L. ‘Aramis’). Biog. J. Ilm. Biol. 2018, 6, 124–130. [Google Scholar] [CrossRef]
- McCreight, J.D. Reactions of 20 melon cultigens to powdery mildew race 2U. In Cucurbitaceae Proceedings 2002; Crop Improvement and Protection Research: Salinas, CA, USA, 2002; pp. 72–77. [Google Scholar]
- McCreight, J.D.; Coffey, M.D.; Turini, T.A.; Matheron, M.E. Field Evidence for a New Race of Powdery Mildew on Melon. HortScience 2005, 40, 888a-888. [Google Scholar] [CrossRef]
- Cohen, Y.; Eyal, H.; Hanania, J. Ultrastructure, autofluorescence, callose deposition and lignification in susceptible and resistant muskmelon leaves infected with the powdery mildew fungus Sphaerotheca fuliginea. Physiol. Mol. Plant Pathol. 1990, 36, 191–204. [Google Scholar] [CrossRef]
- Dogimont, C. 2011 gene list for melon. Cucurbit Genetics Cooperative Report. HortScience 2010, 33, 104–133. [Google Scholar]
- Périn, C.; Hagen, L.; De Conto, V.; Katzir, N.; Danin-Poleg, Y.; Portnoy, V.; Baudracco-Arnas, S.; Chadoeuf, J.; Dogimont, C.; Pitrat, M. A reference map of Cucumis melo based on two recombinant inbred line populations. Theor. Appl. Genet. 2002, 104, 1017–1034. [Google Scholar] [CrossRef] [PubMed]
- Pitrat, M. Linkage Groups in Cucumis melo L. J. Hered. 1991, 82, 406–411. [Google Scholar] [CrossRef]
- Dallagnol, L.J.; Fazza, A.C.; Monteiro, C.C.; de Lima, B.M.; Wassano, D.T.; Camargo, L.E.A. Mapping of resistance genes to races 1, 3 and 5 of Podosphaera xanthii in melon PI 414723. Crop. Breed. Appl. Biotechnol. 2013, 13, 349–355. [Google Scholar] [CrossRef]
- Zhang, C.; Ren, Y.; Guo, S.; Zhang, H.; Gong, G.; Du, Y.; Xu, Y. Application of comparative genomics in developing markers tightly linked to the Pm-2F gene for powdery mildew resistance in melon (Cucumis melo L.). Euphytica 2012, 190, 157–168. [Google Scholar] [CrossRef]
- Fukino, N.; Ohara, T.; Monforte, A.J.; Sugiyama, M.; Sakata, Y.; Kunihisa, M.; Matsumoto, S. Identification of QTLs for resistance to powdery mildew and SSR markers diagnostic for powdery mildew resistance genes in melon (Cucumis melo L.). Theor. Appl. Genet. 2008, 118, 165–175. [Google Scholar] [CrossRef]
- Perchepied, L.; Bardin, M.; Dogimont, C.; Pitrat, M.; Branham, S.; Kousik, C.S.; Mandal, M.; Wechter, P.; Haonan, C.; Zhuo, D.; et al. Relationship Between Loci Conferring Downy Mildew and Powdery Mildew Resistance in Melon Assessed by Quantitative Trait Loci Mapping. Phytopathology 2005, 95, 556–565. [Google Scholar] [CrossRef]
- Li, B.; Zhao, Y.; Zhu, Q.; Zhang, Z.; Fan, C.; Amanullah, S.; Gao, P.; Luan, F. Mapping of powdery mildew resistance genes in melon (Cucumis melo L.) by bulked segregant analysis. Sci. Hortic. 2017, 220, 160–167. [Google Scholar] [CrossRef]
- McCreight, J.D.; Coffey, M.D. Inheritance of Resistance in Melon PI 313970 to Cucurbit Powdery Mildew Incited by Podosphaera xanthii Race S. HortScience 2011, 46, 838–840. [Google Scholar] [CrossRef]
- McDowell, J.M.; Woffenden, B.J. Plant disease resistance genes: Recent insights and potential applications. Trends Biotechnol. 2003, 21, 178–183. [Google Scholar] [CrossRef] [PubMed]
- Van der Hoorn, R.A.L.; Kruijt, M.; Roth, R.; Brandwagt, B.F.; Joosten, M.H.A.J.; De Wit, P.J.G.M. Intragenic recombination generated two distinct Cf genes that mediate AVR9 recognition in the natural population of Lycopersicon pimpinellifolium. Proc Natl. Acad. Sci. USA 2001, 98, 10493–10498. [Google Scholar] [CrossRef]
- Dodds, P.N.; Lawrence, G.J.; Catanzariti, A.-M.; Teh, T.; Wang, C.-I.A.; Ayliffe, M.A.; Kobe, B.; Ellis, J.G. Direct protein interaction underlies gene-for-gene specificity and coevolution of the flax resistance genes and flax rust avirulence genes. Proc. Natl. Acad. Sci. USA 2006, 103, 8888–8893. [Google Scholar] [CrossRef] [PubMed]
- Tao, Y.; Yuan, F.; Leister, R.T.; Ausubel, F.M.; Katagiri, F. Mutational Analysis of the Arabidopsis Nucleotide Binding Site–Leucine-Rich Repeat Resistance Gene RPS2. Plant Cell 2000, 12, 2541–2554. [Google Scholar] [CrossRef] [PubMed]
- Hwang, C.-F.; Bhakta, A.V.; Truesdell, G.M.; Pudlo, W.M.; Williamson, V.M. Evidence for a Role of the N Terminus and Leucine-Rich Repeat Region of the Mi Gene Product in Regulation of Localized Cell Death. Plant Cell 2000, 12, 1319–1329. [Google Scholar] [CrossRef] [PubMed]
- Zhu, X.; Lu, C.; Du, L.; Ye, X.; Liu, X.; Coules, A.; Zhang, Z. The wheat NB-LRR gene TaRCR1 is required for host defence response to the necrotrophic fungal pathogen Rhizoctonia cerealis. Plant Biotechnol. J. 2017, 15, 674–687. [Google Scholar] [CrossRef] [PubMed]
- Zhang, C.; Chen, H.; Cai, T.; Deng, Y.; Zhuang, R.; Zhang, N.; Zeng, Y.; Zheng, Y.; Tang, R.; Pan, R.; et al. Overexpression of a novel peanut NBS-LRR gene AhRRS5 enhances disease resistance to Ralstonia solanacearum in tobacco. Plant Biotechnol. J. 2016, 15, 39–55. [Google Scholar] [CrossRef] [PubMed]
- Xu, Y.; Liu, F.; Zhu, S.; Li, X. The Maize NBS-LRR Gene ZmNBS25 Enhances Disease Resistance in Rice and Arabidopsis. Front. Plant Sci. 2018, 9, 1033. [Google Scholar] [CrossRef] [PubMed]
- Wang, W.; Chen, L.; Fengler, K.; Bolar, J.; Llaca, V.; Wang, X.; Clark, C.B.; Fleury, T.J.; Myrvold, J.; Oneal, D.; et al. A giant NLR gene confers broad-spectrum resistance to Phytophthora sojae in soybean. Nat. Commun. 2021, 12, 6263. [Google Scholar] [CrossRef] [PubMed]
- Zhou, L.; Deng, S.; Xuan, H.; Fan, X.; Sun, R.; Zhao, J.; Wang, H.; Guo, N.; Xing, H. A novel TIR-NBS-LRR gene regulates immune response to Phytophthora root rot in soybean. Crop. J. 2022, 10, 1644–1653. [Google Scholar] [CrossRef]
- Yang, H.; Wang, H.; Jiang, J.; Liu, M.; Liu, Z.; Tan, Y.; Zhao, T.; Zhang, H.; Chen, X.; Li, J.; et al. The Sm gene conferring resistance to gray leaf spot disease encodes an NBS-LRR (nucleotide-binding site-leucine-rich repeat) plant resistance protein in tomato. Theor. Appl. Genet. 2022, 135, 1467–1476. [Google Scholar] [CrossRef]
- Lester, G.E.; Eischen, F. Beta-carotene content of postharvest orange-fleshed muskmelon fruit: Effect of cultivar, growing location and fruit size. Plant Foods Hum. Nutr. 1996, 49, 191–197. [Google Scholar] [CrossRef] [PubMed]
- Lester, G.E.; Crosby, K.M. Ascorbic Acid, Folic Acid, and Potassium Content in Postharvest Green-flesh Honeydew Muskmelons: Influence of Cultivar, Fruit Size, Soil Type, and Year. J. Am. Soc. Hortic. Sci. 2002, 127, 843–847. [Google Scholar] [CrossRef]
- Lester, G.E. Antioxidant, Sugar, Mineral, and Phytonutrient Concentrations across Edible Fruit Tissues of Orange-Fleshed Honeydew Melon (Cucumis melo L.). J. Agric. Food Chem. 2008, 56, 3694–3698. [Google Scholar] [CrossRef] [PubMed]
- Kim, H.-T.; Park, J.-I.; Nou, I.-S. Identification of fungal races that cause powdery mildew in melon (Cucumis melo L.) and selection of resistant commercial melon cultivars against the identified races in Korea. J. Plant Biotechnol. 2016, 43, 58–65. [Google Scholar] [CrossRef]
- Varshney, R.K.; Ribaut, J.-M.; Buckler, E.S.; Tuberosa, R.; Rafalski, J.A.; Langridge, P. Can genomics boost productivity of orphan crops? Nat. Biotechnol. 2012, 30, 1172–1176. [Google Scholar] [CrossRef] [PubMed]
- Lebeda, A.; Krístková, E.; Sedláková, B.; Coffey, M.D.; McCreight, J.D. Gaps and perspectives of pathotype and race determination in Golovinomyces cichoracearum and Podosphaera xanthii. Mycoscience 2011, 52, 159–164. [Google Scholar] [CrossRef]
- Alvarez, J.; Gómez-Guillamón, M.; Torés, N.; Cánovas, I.; Floris, E. Virulence Differences Between Two Spanish Isolates of Sphaerotheca Fuliginea Race 2 On Melon. Acta. Hortic. 2000, 510, 67–70. [Google Scholar] [CrossRef]
- Bertrand, F. AR Hale’s Best Jumbo, a new differential melon variety for Sphaerotheca fuliginea races in leaf disk test. In Cucur-bitaceae; ASHS Press: Alexandria, VA, USA, 2002; pp. 234–237. [Google Scholar]
- Cohen, R.; Burger, Y.; Shraiber, S. Physiological races of Sphaerotheca fuliginea: Factors affecting their identification and the sig-nificance of this knowledge. In Cucurbitaceae 2002; ASHS Press: Alexandria, VA, USA, 2002; pp. 181–187. [Google Scholar]
- Floris, E.; Alvarez, J.M. Genetic analysis of resistance of three melon lines to Sphaerotheca fuliginea. Euphytica 1995, 81, 181–186. [Google Scholar] [CrossRef]
- Harwood, R.R.; Markarian, D. A Genetic Survey of Resistance to Powdery Mildew in Muskmelon. J. Hered. 1968, 59, 213–217. [Google Scholar] [CrossRef]
- Jagger, I.C. A new biologic form of powdery mildew on muskmelons in the Imperial Valley of California. Plant Dis. Rep. 1938, 22, 275–276. [Google Scholar]
- Pitrat, M.; Dogimont, C.; Bardin, M. Resistance to fungal diseases of foliage in melon. In Cucurbitaceae; ASHS Press: Alexandria, VA, USA, 1998; pp. 167–173. [Google Scholar]
- Sowell, G.; Corley, W.L. Severity of Race 2 of Sphaerotheca fuliginea (Schlecht.) Poll. on Muskmelon Introductions Reported Resistant to Powdery Mildew1. HortScience 1974, 9, 398–399. [Google Scholar] [CrossRef]
- Thomas, C.E. A new biological race of powdery mildew [Sphaerotheca fuliginea] of cantaloups. Plant Dis. Rep. 1978, 62, 223. [Google Scholar]
- López-Martín, M.; Pérez-De-Castro, A.; Picó, B.; Gómez-Guillamón, M.L. Advanced Genetic Studies on Powdery Mildew Resistance in TGR-1551. Int. J. Mol. Sci. 2022, 23, 12553. [Google Scholar] [CrossRef]
- Hong, J.-E.; Hossain, M.R.; Jung, H.-J.; Nou, I.-S. Inheritance of Resistance to Race 5 of Powdery Mildew Fungus Podosphaera xanthii in Melon and Development of Race 5-Specific High Resolution Melting Markers. Plant Breed. Biotechnol. 2022, 10, 272–281. [Google Scholar] [CrossRef]
- Teixeira, A.P.M.; Barreto, F.A.d.S.; Camargo, L.E.A. An AFLP marker linked to the Pm-1 gene that confers resistance to Podosphaera xanthii race 1 in Cucumis melo. Genet. Mol. Biol. 2008, 31, 547–550. [Google Scholar] [CrossRef]
- Liu, L.; Chen, Y.; Su, Z.; Zhang, H.; Zhu, W. A Sequence-amplified Characterized Region Marker for a Single, Dominant Gene in Melon PI 134198 that Confers Resistance to a Unique Race of Podosphaera xanthii in China. HortScience 2010, 45, 1407–1410. [Google Scholar] [CrossRef]
- Howlader, J.; Hong, Y.; Natarajan, S.; Sumi, K.R.; Kim, H.-T.; Park, J.-I.; Nou, I.-S. Development of powdery mildew race 5-specific SNP markers in Cucumis melo L. using whole-genome resequencing. Hortic. Environ. Biotechnol. 2020, 61, 347–357. [Google Scholar] [CrossRef]
- Majee, M.; Kumar, S.; Kathare, P.K.; Wu, S.; Gingerich, D.; Nayak, N.R.; Salaita, L.; Dinkins, R.; Martin, K.; Goodin, M.; et al. KELCH F-BOX protein positively influences Arabidopsis seed germination by targeting Phytochrome-Interacting Factor1. Proc. Nat. Acad. Sci. Biol. 2018, 115, E4120–E4129. [Google Scholar] [CrossRef] [PubMed]
- McSteen, P.; Zhao, Y. Plant Hormones and Signaling: Common Themes and New Developments. Dev. Cell 2008, 14, 467–473. [Google Scholar] [CrossRef] [PubMed]
- Kepinski, S.; Leyser, O. The Arabidopsis F-box protein TIR1 is an auxin receptor. Nature 2005, 435, 446–451. [Google Scholar] [CrossRef] [PubMed]
- Dill, A.; Thomas, S.G.; Hu, J.; Steber, C.M.; Sun, T.-P. The Arabidopsis F-Box Protein SLEEPY1 Targets Gibberellin Signaling Repressors for Gibberellin-Induced Degradation. Plant Cell 2004, 16, 1392–1405. [Google Scholar] [CrossRef]
- Binder, B.M.; Walker, J.M.; Gagne, J.M.; Emborg, T.J.; Hemmann, G.; Bleecker, A.B.; Vierstra, R.D. The Arabidopsis EIN3 Binding F-Box Proteins EBF1 and EBF2 Have Distinct but Overlapping Roles in Ethylene Signaling. Plant Cell 2007, 19, 509–523. [Google Scholar] [CrossRef]
- Thines, B.; Katsir, L.; Melotto, M.; Niu, Y.; Mandaokar, A.; Liu, G.; Nomura, K.; He, S.Y.; Howe, G.A.; Browse, J. JAZ repressor proteins are targets of the SCFCOI1 complex during jasmonate signalling. Nature 2007, 448, 661–665. [Google Scholar] [CrossRef]
- Song, J.B.; Wang, Y.X.; Li, H.B.; Li, B.W.; Zhou, Z.S.; Gao, S.; Yang, Z.M. The F-box family genes as key elements in response to salt, heavy mental, and drought stresses in Medicago truncatula. Funct. Integr. Genom. 2015, 15, 495–507. [Google Scholar] [CrossRef]
- Zhou, S.-M.; Kong, X.-Z.; Kang, H.-H.; Sun, X.-D.; Wang, W. The Involvement of Wheat F-Box Protein Gene TaFBA1 in the Oxidative Stress Tolerance of Plants. PLoS ONE 2015, 10, e0122117. [Google Scholar] [CrossRef]
- Bu, Q.; Lv, T.; Shen, H.; Luong, P.; Wang, J.; Wang, Z.; Huang, Z.; Xiao, L.; Engineer, C.; Kim, T.H.; et al. Regulation of Drought Tolerance by the F-Box Protein MAX2 in Arabidopsis. Plant Physiol. 2013, 164, 424–439. [Google Scholar] [CrossRef]
- Jain, M.; Nijhawan, A.; Arora, R.; Agarwal, P.; Ray, S.; Sharma, P.; Kapoor, S.; Tyagi, A.K.; Khurana, J.P. F-Box Proteins in Rice. Genome-Wide Analysis, Classification, Temporal and Spatial Gene Expression during Panicle and Seed Development, and Regulation by Light and Abiotic Stress. Plant Physiol. 2007, 143, 1467–1483. [Google Scholar] [CrossRef]
- Kim, H.S.; Delaney, T.P. Arabidopsis SON1 is an F-Box Protein That Regulates a Novel Induced Defense Response Independent of Both Salicylic Acid and Systemic Acquired Resistance. Plant Cell 2002, 14, 1469–1482. [Google Scholar] [CrossRef]
- Calderón-Villalobos, L.I.A.; Nill, C.; Marrocco, K.; Kretsch, T.; Schwechheimer, C. The evolutionarily conserved Arabidopsis thaliana F-box protein AtFBP7 is required for efficient translation during temperature stress. Gene 2007, 392, 106–116. [Google Scholar] [CrossRef]
- Cao, Y.; Yang, Y.; Zhang, H.; Li, D.; Zheng, Z.; Song, F. Overexpression of a rice defense-related F-box protein gene OsDRF1 in tobacco improves disease resistance through potentiation of defense gene expression†. Physiol. Plant. 2008, 134, 440–452. [Google Scholar] [CrossRef] [PubMed]
- Piisilä, M.; A Keceli, M.; Brader, G.; Jakobson, L.; Jõesaar, I.; Sipari, N.; Kollist, H.; Palva, E.T.; Kariola, T. The F-box protein MAX2 contributes to resistance to bacterial phytopathogens in Arabidopsis thaliana. BMC Plant Biol. 2015, 15, 53. [Google Scholar] [CrossRef]
- Stefanowicz, K.; Lannoo, N.; Zhao, Y.; Eggermont, L.; Van Hove, J.; Al Atalah, B.; Van Damme, E.J.M. Glycan-binding F-box protein from Arabidopsis thaliana protects plants from Pseudomonas syringae infection. BMC Plant Biol. 2016, 16, 213. [Google Scholar] [CrossRef]
- Zhang, X.; Abrahan, C.; Colquhoun, T.A.; Liu, C.-J. A Proteolytic Regulator Controlling Chalcone Synthase Stability and Flavonoid Biosynthesis in Arabidopsis. Plant Cell 2017, 29, 1157–1174. [Google Scholar] [CrossRef]
- Kim, Y.Y.; Jung, K.W.; Jeung, J.U.; Shin, J.S. A novel F-box protein represses endothecial secondary wall thickening for anther dehiscence in Arabidopsis thaliana. J. Plant Physiol. 2012, 169, 212–216. [Google Scholar] [CrossRef]
- Chen, Y.; Xu, Y.; Luo, W.; Li, W.; Chen, N.; Zhang, D.; Chong, K. The F-Box Protein OsFBK12 Targets OsSAMS1 for Degradation and Affects Pleiotropic Phenotypes, Including Leaf Senescence, in Rice. Plant Physiol. 2013, 163, 1673–1685. [Google Scholar] [CrossRef]
- Harris, C.J.; Slootweg, E.J.; Goverse, A.; Baulcombe, D.C. Stepwise artificial evolution of a plant disease resistance gene. Proc. Nat. Acad. Sci. Biol. 2013, 110, 21189–21194. [Google Scholar] [CrossRef]
- Kourelis, J.; Van Der Hoorn, R.A.L. Defended to the Nines: 25 Years of Resistance Gene Cloning Identifies Nine Mechanisms for R Protein Function. Plant Cell 2018, 30, 285–299. [Google Scholar] [CrossRef] [PubMed]
- Zou, S.; Wang, H.; Li, Y.; Kong, Z.; Tang, D. The NB-LRR gene Pm60 confers powdery mildew resistance in wheat. New Phytol. 2017, 218, 298–309. [Google Scholar] [CrossRef] [PubMed]
- Jin, Y.; Liu, H.; Gu, T.; Xing, L.; Han, G.; Ma, P.; Li, X.; Zhou, Y.; Fan, J.; Li, L.; et al. PM2b, a CC-NBS-LRR protein, interacts with TaWRKY76-D to regulate powdery mildew resistance in common wheat. Front. Plant Sci. 2022, 13, 973065. [Google Scholar] [CrossRef] [PubMed]
- Mihalyov, P.D.; Garfinkel, A.R. Discovery and Genetic Mapping of PM1, a Powdery Mildew Resistance Gene in Cannabis sativa L. Front. Agron. 2021, 3, 720215. [Google Scholar] [CrossRef]
S. No. | Melon Line | Podosphaera xanthii |
---|---|---|
KN2 | ||
1. | SCNU1154 | S |
2. | PMR45 | S |
3. | WMR29 | S |
4. | PI414723 | S |
5. | PMR5 | R |
6. | MR-1 | R |
7. | PI124112 | R |
8. | Edisto 47 | R |
Materials | Plant Type | Resistant | Susceptible | Expected Ratio (R:S) | Chi-Square | p Value |
---|---|---|---|---|---|---|
IML107 | P1 | 15 | 0 | - | - | - |
IML197 | P2 | 0 | 15 | - | - | - |
IML107 × IML197 | F1 | 15 | 0 | - | -- | |
IML107 × IML197 | F2 | 100 | 38 | 3:1 | 0.17 | 0.68 |
No. | Marker Name | ‘F’-Sequence | ‘R’-Sequence | Product Size (bp) |
---|---|---|---|---|
1 | MELO C2-1 | GAAGGAGGTGAGGTTGGATAAG | TTTGGAACTGCTTGGGAAATG | 997 |
2 | MELO C2-6 | ACTTGGTTGCCGTCCATTAT | GGTGTCTGGTAGCCTTGTTAG | 360 |
3 | MELO C2-13 | GCGGAGGGATTGGCTTATT | CAGCATGCACCCGTATTCTA | 805 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kheng, S.; Choe, S.-H.; Sahu, N.; Park, J.-I.; Kim, H.-T. Identification of Gene Responsible for Conferring Resistance against Race KN2 of Podosphaera xanthii in Melon. Int. J. Mol. Sci. 2024, 25, 1134. https://doi.org/10.3390/ijms25021134
Kheng S, Choe S-H, Sahu N, Park J-I, Kim H-T. Identification of Gene Responsible for Conferring Resistance against Race KN2 of Podosphaera xanthii in Melon. International Journal of Molecular Sciences. 2024; 25(2):1134. https://doi.org/10.3390/ijms25021134
Chicago/Turabian StyleKheng, Sopheak, San-Ha Choe, Nihar Sahu, Jong-In Park, and Hoy-Taek Kim. 2024. "Identification of Gene Responsible for Conferring Resistance against Race KN2 of Podosphaera xanthii in Melon" International Journal of Molecular Sciences 25, no. 2: 1134. https://doi.org/10.3390/ijms25021134