Evaluation of Lipopolysaccharide and Interleukin-6 as Useful Screening Tool for Chronic Endometritis
Abstract
1. Introduction
2. Results
2.1. Effect of LPS on Proliferation of EM Cells
2.2. LPS Promotes Cell Proliferation of EM Cells
2.3. Effects of LPS Administration on Mouse Uterus In Vivo
2.4. Correlation between LPS and Inflammatory Genes in Human Endometrial Tissues
2.5. Correlation between LPS and Cell Cycle Genes in Human Endometrial Tissues
2.6. Relationship between LPS and CE
3. Discussion
4. Materials and Methods
4.1. Cell Culture
4.2. Cell Proliferation Assay
4.3. Animal Treatment
4.4. Real-Time PCR
4.5. Histological Analysis
4.6. Ethical Considerations
4.7. Study Participants and Design
4.8. LPS Measurement Using Limulus Amebocyte Lysate (LAL) Assay
4.9. Statistical Analysis
5. Patents
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Li, Y.; Xu, Y.; Yu, S.; Lin, S.; Chen, W.; Lian, R.; Diao, L.; Sun, H.; Ding, L.; Zeng, Y. Chronic endometritis impairs embryo implantation in patients with repeated implantation failure: A retrospective study. Taiwan J. Obstet. Gynecol. 2022, 61, 984–988. [Google Scholar] [CrossRef] [Scilit]
- Cicinelli, E.; Matteo, M.; Tinelli, R.; Lepera, A.; Alfonso, R.; Indraccolo, U.; Marrocchella, S.; Greco, P.; Resta, L. Prevalence of chronic endometritis in repeated unexplained implantation failure and the IVF success rate after antibiotic therapy. Hum. Reprod. 2015, 30, 323–330. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kitaya, K.; Matsubayashi, H.; Yamaguchi, K.; Nishiyama, R.; Takaya, Y.; Ishikawa, T.; Yasuo, T.; Yamada, H. Chronic endometritis: Potential cause of infertility and obstetric and neonatal complications. Am. J. Reprod. Immunol. 2016, 75, 13–22. [Google Scholar] [CrossRef] [Scilit]
- Song, D.; Feng, X.; Zhang, Q.; Xia, E.; Xiao, Y.; Xie, W.; Li, T.C. Prevalence and confounders of chronic endometritis in premenopausal women with abnormal bleeding or reproductive failure. Reprod. Biomed. Online 2018, 36, 78–83. [Google Scholar] [CrossRef] [Scilit]
- Moreno, I.; Cicinelli, E.; Garcia-Grau, I.; Gonzalez-Monfort, M.; Bau, D.; Vilella, F.; De Ziegler, D.; Resta, L.; Valbuena, D.; Simon, C. The diagnosis of chronic endometritis in infertile asymptomatic women: A comparative study of histology, microbial cultures, hysteroscopy, and molecular microbiology. Am. J. Obstet. Gynecol. 2018, 218, 602.e1–602.e16. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Smith, M.; Hagerty, K.A.; Skipper, B.; Bocklage, T. Chronic endometritis: A combined histopathologic and clinical review of cases from 2002 to 2007. Int. J. Gynecol. Pathol. 2010, 29, 44–50. [Google Scholar] [CrossRef] [Scilit]
- Murtinger, M.; Wirleitner, B.; Spitzer, D.; Bralo, H.; Miglar, S.; Schuff, M. Diagnosing chronic endometritis: When simplification fails to clarify. Hum. Reprod. Open 2022, 3, hoac023. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, Y.; Xu, S.; Yu, S.; Huang, C.; Lin, S.; Chen, W.; Mo, M.; Lian, R.; Diao, L.; Ding, L.; et al. Diagnosis of chronic endometritis: How many CD138+ cells/HPF in endometrial stroma affect pregnancy outcome of infertile women? Am. J. Reprod. Immunol. 2021, 85, e13369. [Google Scholar] [CrossRef] [Scilit]
- Ryan, E.; Tolani, A.T.; Zhang, J.; Cruz, G.I.; Folkins, A.K.; Lathi, R.B. The menstrual cycle phase impacts the detection of plasma cells and the diagnosis of chronic endometritis in endometrial biopsy specimens. Fertil. Steril. 2022, 118, 787–794. [Google Scholar] [CrossRef] [Scilit]
- Deb, K.; Chaturvedi, M.M.; Jaiswal, Y.K. Comprehending the role of LPS in Gram-negative bacterial vaginosis: Ogling into the causes of unfulfilled child-wish. Arch. Gynecol. Obstet. 2004, 270, 133–146. [Google Scholar] [CrossRef] [Scilit]
- Koga, K.; Mor, G. Toll-Like Receptors at the Maternal–Fetal Interface in Normal Pregnancy and Pregnancy Disorders. Am. J. Reprod. Immunol. 2010, 63, 587–600. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wu, H.; Zhao, G.; Jiang, K.; Li, C.; Qiu, C.; Deng, G. Engeletin Alleviates lipopolysaccharide-induced endometritis in mice by inhibiting TLR4-mediated NF-κB activation. J. Agric. Food Chem. 2016, 64, 6171–6178. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wu, H.; Jiang, K.; Yin, N.; Ma, X.; Zhao, G.; Qiu, C.; Deng, G. Thymol mitigates lipopolysaccharide-induced endometritis by regulating the TLR4-and ROS-mediated NF-κB signaling pathways. Oncotaget 2017, 8, 20042–20055. [Google Scholar] [CrossRef] [Scilit]
- Kim, W.; Lee, J.; Choi, J.; Yoon, H.; Jun, J.H. Detrimental effects of lipopolysaccharide on the attachment and outgrowth of various trophoblastic spheroids on human endometrial epithelial cells. Clin. Exp. Reprod. Med. 2021, 48, 132–141. [Google Scholar] [CrossRef] [Scilit]
- Tortorella, C.; Piazzolla, G.; Matteo, M.; Pinto, V.; Tinelli, R.; Sabbà, C.; Fanelli, M.; Cicinelli, E. Interleukin-6, interleukin-1β, and tumor necrosis factor α in menstrual effluents as biomarkers of chronic endometritis. Fertil. Steril. 2014, 101, 242–247. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kyo, S.; Nakamura, M.; Kiyono, T.; Maida, Y.; Kanaya, T.; Tanaka, M.; Yatabe, N.; Inoue, M. Successful Immortalization of Endometrial Glandular Cells with Normal Structural and Functional Characteristics. Am. J. Pathol. 2003, 163, 2259–2269. [Google Scholar] [CrossRef] [Scilit]
- Peipert, J.F.; Montagno, A.B.; Cooper, A.S.; Sung, C.J. Bacterial vaginosis as a risk factor for upper genital tract infection. Am. J. Obstet. Gynecol. 1997, 177, 1184–1187. [Google Scholar] [CrossRef] [Scilit]
- Wang, J.; Li, Z.; Ma, X.; Du, L.; Jia, Z.; Cui, X.; Yu, L.; Yang, J.; Xiao, L.; Zhang, B.; et al. Translocation of vaginal microbiota is involved in impairment and protection of uterine health. Nat. Commun. 2021, 12, 4191. [Google Scholar] [CrossRef] [Scilit]
- Kamiyama, S.; Teruya, Y.; Nohara, M.; Kanazawa, K. Impact of detection of bacterial endotoxin in menstrual effluent on the pregnancy rate in in vitro fertilization and embryo transfer. Fertil. Steril. 2004, 82, 788–792. [Google Scholar] [CrossRef] [Scilit]
- Khan, K.N.; Kitajima, M.; Hiraki, K.; Yamaguchi, N.; Katamine, S.; Matsuyama, T.; Nakashima, M.; Fujishita, A.; Ishimaru, T.; Masuzaki, H. Escherichia coli contamination of menstrual blood and effect of bacterial endotoxin on endometriosis. Fertil. Steril. 2010, 94, 2860–2863.e3. [Google Scholar] [CrossRef] [Scilit]
- Gholamnezhad, Z.; Safarian, B.; Esparham, A.; Mirzaei, M.; Esmaeilzadeh, M.; Boskabady, M.H. The modulatory effects of exercise on lipopolysaccharide-induced lung inflammation and injury: A systemic review. Life Sci. 2022, 293, 120306. [Google Scholar] [CrossRef] [Scilit]
- Martínez, S.; Garrido, N.; Coperias, J.L.; Pardo, F.; Desco, J.; García-Velasco, J.A.; Simón, C.; Pellicer, A. Serum interleukin-6 levels are elevated in women with minimal-mild endometriosis. Hum. Reprod. 2007, 22, 836–842. [Google Scholar] [CrossRef] [Scilit]
- Cronin, J.G.; Kanamarlapudi, V.; Thornton, C.A.; Sheldon, I.M. Signal transducer and activator of transcription-3 licenses Toll-like receptor 4-dependent interleukin (IL)-6 and IL-8 production via IL-6 receptor-positive feedback in endometrial cells. Mucosal Immunol. 2016, 9, 1125–1136. [Google Scholar] [CrossRef] [Scilit]
- Xiao, L.; Song, Y.; Huang, W.; Yang, S.; Fu, J.; Feng, X. Expression of SOX2, NANOG and OCT4 in a mouse model of lipopolysaccharide-induced acute uterine injury and intrauterine adhesions. Reprod. Biol. Endocrinol. 2017, 15, 14. [Google Scholar] [CrossRef] [Scilit]
- Zanoni, I.; Ostuni, R.; Marek, L.R.; Barresi, S.; Barbalat, R.; Barton, G.M.; Granucci, F.; Kagan, J.C. CD14 controls the LPS-induced endocytosis of toll-like receptor 4. Cell 2011, 147, 868–880. [Google Scholar] [CrossRef] [Scilit]
- Fitzgerald, K.A.; Kagan, J.C. Toll-like Receptors and the Control of Immunity. Cell 2020, 180, 1044–1066. [Google Scholar] [CrossRef] [Scilit]
- Vasudevan, S.O.; Russo, A.J.; Kumari, P.; Vanaja, S.K.; Rathinam, V.A. A TLR4-independent critical role for CD14 in intracellular LPS sensing. Cell Rep. 2022, 39, 110755. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Muroi, M.; Ohnishi, T.; Tanamoto, K.I. Regions of the mouse CD14 molecule required for Toll-like receptor 2- and 4-mediated activation of NF-κB. J. Biol. Chem. 2002, 277, 42372–42379. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Krut, Y.; Zemlyana, N.; Gaidai, N.; Pavliuchenko, M.; Amro, I. The proliferation markers in patients with different forms of hyperplastic endometrial processes. J. Educ. Health Sport 2022, 12, 80–86. [Google Scholar] [CrossRef] [Scilit]
- Zhang, X.; Chen, C.H.; Confino, E.; Barnes, R.; Milad, M.; Kazer, R.R. Increased endometrial thickness is associated with improved treatment outcome for selected patients undergoing in vitro fertilization-embryo transfer. Fertil. Steril. 2005, 83, 336–340. [Google Scholar] [CrossRef] [Scilit]
- Song, D.; Li, T.C.; Zhang, Y.; Feng, X.; Xia, E.; Huang, X.; Xiao, Y. Correlation between hysteroscopy findings and chronic endometritis. Fertil. Steril. 2019, 111, 772–779. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, Y.Q.; Fang, R.L.; Luo, Y.N.; Luo, C.Q. Analysis of the diagnostic value of CD138 for chronic endometritis, the risk factors for the pathogenesis of chronic endometritis and the effect of chronic endometritis on pregnancy: A cohort study. BMC Women’s Health 2016, 16, 60. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bayer-Garner, I.B.; Korourian, S. Plasma cells in chronic endometritis are easily identified when stained with syndecan-1. Mod. Pathol. 2001, 14, 877–879. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bayer-Garner, I.B.; Nickell, J.A.; Korourian, S. Routine Syndecan-1 Immunohistochemistry Aids in the Diagnosis of Chronic Endometritis. Arch. Pathol. Lab. Med. 2004, 128, 1000–1003. [Google Scholar] [CrossRef] [Scilit]
- Achilles, S.L.; Amortegui, A.J.; Wiesenfeld, H.C. Endometrial plasma cells: Do they indicate subclinical pelvic inflammatory disease? Sex. Transm. Dis. 2005, 32, 185–188. [Google Scholar] [CrossRef] [Scilit]
- Germeyer, A.; Klinkert, M.S.; Huppertz, A.G.; Clausmeyer, S.; Popovici, R.M.; Strowitzki, T.; von Wolff, M. Expression of syndecans, cell-cell interaction regulating heparan sulfate proteoglycans, within the human endometrium and their regulation throughout the menstrual cycle. Fertil. Steril. 2007, 87, 657–663. [Google Scholar] [CrossRef] [Scilit]
- Baston-Büst, D.M.; Götte, M.; Janni, W.; Krüssel, J.S.; Hess, A.P. Syndecan-1 knock-down in decidualized human endometrial stromal cells leads to significant changes in cytokine and angiogenic factor expression patterns. Reprod. Biol. Endocrinol. 2010, 8, 133. [Google Scholar] [CrossRef] [Scilit]
- Kaponis, A.; Iwabe, T.; Taniguchi, F.; Ito, M.; Deura, I.; Decavalas, G.; Terakawa, N.; Harada, T. The role of NF-kappaB in endometriosis. Front. Biosci. 2012, 4, 1213–1234. [Google Scholar]
- Yu, X.W.; Zhang, X.W.; Li, X. Soluble tumor necrosis factor receptor mediates cell proliferation on lipopolysaccharide-stimulated cultured human decidual stromal cells. Int. J. Mol. Sci. 2009, 10, 2010–2018. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhu, N.; Yang, X.; Liu, Q.; Chen, Y.; Wang, X.; Li, H.; Gao, H. “Iron triangle” of regulating the uterine microecology: Endometrial microbiota, immunity and endometrium. Front. Immunol. 2022, 13, 928475. [Google Scholar] [CrossRef] [Scilit]
- Mayerhofer, K.; Lozanov, P.; Bodner, K.; Bodner-Adler, B.; Kimberger, O.; Czerwenka, K. Ki-67 expression in patients with uterine leiomyomas, uterine smooth muscle tumors of uncertain malignant potential (STUMP) and uterine leiomyosarcomas (LMS). Acta Obstet. Gynecol. Scand. 2004, 83, 1085–1088. [Google Scholar] [CrossRef] [PubMed]
- Li, W.; Fu, K.; Lv, X.; Wang, Y.; Wang, J.; Li, H.; Tian, W.; Cao, R. Lactoferrin suppresses lipopolysaccharide-induced endometritis in mice via down-regulation of the NF-κB pathway. Int. Immunopharmacol. 2015, 28, 695–699. [Google Scholar] [CrossRef] [Scilit] [PubMed]







| Gene | Primer | Size (bp) | Annealing Temperature (°C) | Accession No. | |
|---|---|---|---|---|---|
| Human TLR4 | F | TCCTGCGTGAGACCAGAAAG | 125 | 60 | NM_003266.4 |
| R | AATGGAATCGGGGTGAAGGG | ||||
| Human CD14 | F | AAGCACTTCCAGAGCCTGTC | 138 | 60 | NM_000591.4 |
| R | TCGTCCAGCTCACAAGGTTC | ||||
| Human CD138 | F | GGCTACTAATTTGCCCCCTGA | 163 | 60 | NM_002997.5 |
| R | TTCTGGAGACGTGGGAATAGC | ||||
| Human IL-1β | F | AACAGGCTGCTCTGGGATTC | 174 | 60 | NM_000576.2 |
| R | GTCCTGGAAGGAGCACTTCA | ||||
| Human IL-6 | F | CTCACCTCTTCAGAACGAATTG | 148 | 60 | NM_000600.5 |
| R | CCATCTTTGGAAGGTTCAGGTTG | ||||
| Human CyclinD1 | F | TGACCCCGCACGATTTCATT | 143 | 60 | NM_053056.3 |
| R | CATGGAGGGCGGATTGGAAA | ||||
| Human p27 | F | GGCCTCAGAAGACGTCAAAC | 227 | 60 | NM_004064.5 |
| R | CATCCAACGCTTTTAGAGGCAG | ||||
| Human p53 | F | GAGGTTGGCTCTGACTGTACC | 133 | 60 | NM_000546.6 |
| R | TCCGTCCCAGTAGATTACCAC | ||||
| Human Ki67 | F | GTGGAAGTTCTGCCTACGGA | 237 | 60 | XM_011539818.2 |
| R | TAGTGCCCAATTTCTCAGGC | ||||
| Human ACTB | F | GGATTCCTATGTGGGCGACGA | 282 | 60 | NM_001101.5 |
| R | GCGTACAGGGATAGCACAGC | ||||
| Mouse Tlr4 | F | CGCTGCCACCAGTTACAGAT | 263 | 60 | NM_021297.3 |
| R | CTTCAAGGGGTTGAAGCTCAGA | ||||
| Mouse Il-6 | F | GGATACCACTCCCAACAGACC | 251 | 60 | NM_001314054.1 |
| R | GGTACTCCAGAAGACCAGAGGAA | ||||
| Mouse Cd138 | F | TGACTCCAGCCGGCGAAA | 299 | 60 | NM_011519.2 |
| R | AAGTTGTCAGAGTCATCCCCA | ||||
| Mouse Ki67 | F | GAGGCTGAGACATGGAGACATA | 245 | 60 | NM_001081117.2 |
| R | TATCTGCAGAAAGGCCCTTGG | ||||
| Mouse Actb | F | CGTGCGTGACATCAAAGAGAA | 201 | 60 | NM_007393.5 |
| R | TGGATGCCACAGGATTCCAT | ||||
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yoneda, E.; Kim, S.; Tomita, K.; Minase, T.; Kayano, M.; Watanabe, H.; Tetsuka, M.; Sasaki, M.; Iwayama, H.; Sanai, H.; et al. Evaluation of Lipopolysaccharide and Interleukin-6 as Useful Screening Tool for Chronic Endometritis. Int. J. Mol. Sci. 2024, 25, 2017. https://doi.org/10.3390/ijms25042017
Yoneda E, Kim S, Tomita K, Minase T, Kayano M, Watanabe H, Tetsuka M, Sasaki M, Iwayama H, Sanai H, et al. Evaluation of Lipopolysaccharide and Interleukin-6 as Useful Screening Tool for Chronic Endometritis. International Journal of Molecular Sciences. 2024; 25(4):2017. https://doi.org/10.3390/ijms25042017
Chicago/Turabian StyleYoneda, Erina, Sangwoo Kim, Kisaki Tomita, Takashi Minase, Mitsunori Kayano, Hiroyuki Watanabe, Masafumi Tetsuka, Motoki Sasaki, Hiroshi Iwayama, Hideomi Sanai, and et al. 2024. "Evaluation of Lipopolysaccharide and Interleukin-6 as Useful Screening Tool for Chronic Endometritis" International Journal of Molecular Sciences 25, no. 4: 2017. https://doi.org/10.3390/ijms25042017
APA StyleYoneda, E., Kim, S., Tomita, K., Minase, T., Kayano, M., Watanabe, H., Tetsuka, M., Sasaki, M., Iwayama, H., Sanai, H., & Muranishi, Y. (2024). Evaluation of Lipopolysaccharide and Interleukin-6 as Useful Screening Tool for Chronic Endometritis. International Journal of Molecular Sciences, 25(4), 2017. https://doi.org/10.3390/ijms25042017

