Apremilast Microemulsion as Topical Therapy for Local Inflammation: Design, Characterization and Efficacy Evaluation
Abstract
1. Introduction
2. Results
2.1. Validation of the Analytical Method
2.2. Pseudo-Ternary Phase Diagrams and APR-ME Preparation
2.3. APR-ME Characterization
2.4. Stability Studies
2.5. In Vitro Release Studies
2.6. Permeation and Qret Studies in Ex Vivo Human Skin
2.7. In Vitro Anti-Inflammatory Efficacy Studies
2.8. In Vivo Anti-Inflammatory Efficacy Studies: Arachidonic Acid (Aa)-Induced Inflammation
2.8.1. Biomechanical Skin Properties Evaluation
2.8.2. Histological Analysis
2.8.3. Pro-Inflammatory Cytokines Determination
2.8.4. In Vivo Tolerance
3. Discussion
4. Materials and Methods
4.1. Materials
4.2. Validation of the Analytical Method
Conditions Analyzed
4.3. Solubility Studies
4.4. Pseudo-Ternary Phase Diagrams
4.5. Preparation of Apremilast Microemulsion (APR-ME)
4.6. Characterization of the Apremilast Microemulsion
4.6.1. Content and pH of APR-ME
4.6.2. Drop Size and Polydispersity Index
4.6.3. Transmission Electron Microscopy (TEM)
4.6.4. Viscosity and Rheological Behavior
4.7. Stability Study
4.8. In Vitro Release Study
4.9. Ex Vivo Skin Permeation Study
Determination of the Amount of Drug Retained in the Skin
4.10. In Vitro Anti-Inflammatory Efficacy Studies in HaCaT Cell Line
4.10.1. Cell Culture
4.10.2. Cell Viability Assay
4.10.3. In Vitro Anti-Inflammatory Efficacy
4.11. In Vivo Anti-Inflammatory Efficacy Studies: Arachidonic Acid (AA)-Induced Inflammation
4.11.1. Animals and Study Protocol
4.11.2. Biomechanical Skin Properties Evaluation
4.11.3. Histological Analysis
4.11.4. Pro-Inflammatory Cytokines Study
4.12. In Vivo Tolerance Study in Humans
4.13. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Chen, L.; Deng, H.; Cui, H.; Fang, J.; Zuo, Z.; Deng, J.; Li, Y.; Wang, X.; Zhao, L. Inflammatory responses and inflammation-associated diseases in organs. Oncotarget 2018, 9, 7204–7218. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Medzhitov, R. Inflammation 2010: New adventures of an old flame. Cell 2010, 140, 771–776. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dainichi, T.; Hanakawa, S.; Kabashima, K. Classification of inflammatory skin diseases: A proposal based on the disorders of the three-layered defense systems, barrier, innate immunity and acquired immunity. J. Dermatol. Sci. 2014, 76, 81–89. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mease, P.J. Apremilast: A phosphodiesterase 4 inhibitor for the treatment of psoriatic arthritis. Rheumatol. Ther. 2014, 1, 1–20. [Google Scholar] [CrossRef] [Scilit]
- Raker, V.K.; Becker, C.; Steinbrink, K. The cAMP pathway as therapeutic target in autoimmune and inflammatory diseases. Front. Immunol. 2016, 7. [Google Scholar] [CrossRef] [Scilit]
- Abdulrahim, H.; Thistleton, S.; Adebajo, A.O.; Shaw, T.; Edwards, C.; Wells, A. Apremilast: A PDE4 inhibitor for the treatment of psoriatic arthritis. Expert Opin. Pharmacother. 2015, 16, 1099–1108. [Google Scholar] [CrossRef] [Scilit]
- Zerilli, T.; Ocheretyaner, E. Apremilast (otezla): A new oral treatment for adults with psoriasis and psoriatic arthritis. Drug Forecast 2015, 40, 495–500. [Google Scholar]
- Man, H.-W.; Schafer, P.; Wong, L.M.; Patterson, R.T.; Corral, L.G.; Raymon, H.; Blease, K.; Leisten, J.; Shirley, M.A.; Tang, Y.; et al. Discovery of (S)-N-{2-[1-(3-ethoxy-4-methoxyphenyl)-2-methanesulfonylethyl]-1,3-dioxo2,3-dihydro-1H-isoindol-4-yl}acetamide (Apremilast), a potent and orally active phosphodiesterase 4 and tumor necrosis factor-α inhibitor. J. Med. Chem. 2009, 52, 1522–1524. [Google Scholar] [CrossRef] [Scilit]
- Afra, T.P.; Razmi, T.M.; Dogra, S. Apremilast in psoriasis and beyond: Big hopes on a small molecule. Indian Dermatol. Online J. 2019, 10, 1–12. [Google Scholar] [CrossRef] [Scilit]
- Butler, T.; Maravent, S.; Boisselle, J.; Valdes, J.; Fellner, C. A review of 2014 cancer drug approvals, with a look at 2015 and beyond. P T 2015, 40, 191–205. [Google Scholar]
- Schafer, P. Apremilast mechanism of action and application to psoriasis and psoriatic arthritis. Biochem. Pharmacol. 2012, 83, 1583–1590. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kumar, N.; Goldminz, A.M.; Kim, N.; Gottlieb, A.B. Phosphodiesterase 4-targeted treatments for autoimmune diseases. BMC Med. 2013, 11, 96. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Anwer, K.; Mohammad, M.; Ezzeldin, E.; Fatima, F.; Alalaiwe, A.; Iqbal, M. Preparation of sustained release apremilast-loaded PLGA nanoparticles: In vitro characterization and in vivo pharmacokinetic study in rats. Int. J. Nanomed. 2019, 14, 1587–1595. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Muvva, A.; Lakshman, D.; Dwibhashyam, V.S.N.M.; Dengale, S.; Lewis, S.A. In vitro-in silico evaluation of Apremilast solid dispersions prepared via Corotating Twin Screw Extruder. J. Drug Deliv. Sci. Tech. 2020, 59, 101844. [Google Scholar] [CrossRef] [Scilit]
- Madan, J.R.; Khobaragade, S.; Dua, K.; Awasthi, R. Formulation, optimization, and in vitro evaluation of nanostructured lipid carriers for topical delivery of Apremilast. Dermatol. Ther. 2020. [Google Scholar] [CrossRef] [Scilit]
- Parmar, P.K.; Bansal, A.K. Novel nanocrystal-based formulations of apremilast for improved topical delivery. Drug Deliv. Transl. Res. 2020. [Google Scholar] [CrossRef] [Scilit]
- Fala, L. Otezla (Apremilast), an oral PDE-4 Inhibitor, receives FDA approval for the treatment of patients with active psoriatic arthritis and plaque psoriasis. Am. Health Drug Benefits 2015, 8, 105–110. [Google Scholar]
- Pireddu, R.; Caddeo, C.; Valenti, D.; Marongiu, F.; Scano, A.; Ennas, G.; Lai, F.; Fadda, A.M.; Sinico, C. Diclofenac acid nanocrystals as an effective strategy to reduce in vivo skin inflammation by improving dermal drug bioavailability. Colloids Surf. B 2016, 143, 64–70. [Google Scholar] [CrossRef] [Scilit]
- Brown, M.B.; Martin, G.P.; Jones, S.A.; Akomeah, F.K. Dermal and transdermal drug delivery systems: Current and future prospects. Drug Deliv. 2006, 13, 175–187. [Google Scholar] [CrossRef] [Scilit]
- Hafeez, F.; Chiang, A.; Hui, X.; Zhu, H.; Kamili, F.; Maibach, H.I. Stratum corneum reservoir as a predictive method for in vitro percutaneous absorption: SC reservoir to predict in vitro percutaneous absorption. J. Appl. Toxicol. 2016, 36, 1003–1010. [Google Scholar] [CrossRef] [Scilit]
- Marwah, H.; Garg, T.; Goyal, A.K.; Rath, G. Permeation enhancer strategies in transdermal drug delivery. Drug Deliv. 2016, 23, 564–578. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lee, H.; Song, C.; Baik, S.; Kim, D.; Hyeon, T.; Kim, D.-H. Device-assisted transdermal drug delivery. Adv. Drug Deliv. Rev. 2018, 127, 35–45. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- European Medicines Agency. Assessment Report: Otezla; EMA: England, UK, 2014; pp. 1–189. [Google Scholar]
- Nastiti, C.; Ponto, T.; Abd, E.; Grice, J.; Benson, H.; Roberts, M. Topical Nano and Microemulsions for Skin Delivery. Pharmaceutics 2017, 9, 37. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Benigni, M.; Pescina, S.; Grimaudo, M.A.; Padula, C.; Santi, P.; Nicoli, S. Development of microemulsions of suitable viscosity for cyclosporine skin delivery. Int. J. Pharm. 2018, 545, 197–205. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rahdar, A.; Hajinezhad, M.R.; Nasri, S.; Beyzaei, H.; Barani, M.; Trant, J.F. The synthesis of methotrexate-loaded F127 microemulsions and their in vivo toxicity in a rat model. J. Mol. Liq. 2020, 313, 113449. [Google Scholar] [CrossRef] [Scilit]
- Savić, V.; Todosijević, M.; Ilić, T.; Lukić, M.; Mitsou, E.; Papadimitriou, V.; Avramiotis, S.; Marković, B.; Cekić, N.; Savić, S. Tacrolimus loaded biocompatible lecithin-based microemulsions with improved skin penetration: Structure characterization and in vitro/in vivo performances. Int. J. Pharm. 2017, 529, 491–505. [Google Scholar] [CrossRef] [Scilit]
- Shewaiter, M.A.; Hammady, T.M.; El-Gindy, A.; Hammadi, S.H.; Gad, S. Formulation and characterization of leflunomide/diclofenac sodium microemulsion base-gel for the transdermal treatment of inflammatory joint diseases. J. Drug Deliv. Sci. Tech. 2020, 102110. [Google Scholar] [CrossRef] [Scilit]
- Mu, H.; Holm, R.; Müllertz, A. Lipid-based formulations for oral administration of poorly water-soluble drugs. Int. J. Pharm. 2013, 453, 215–224. [Google Scholar] [CrossRef] [Scilit]
- Godin, B.; Touitou, E. Dermal and Transdermal Delivery. In Encyclopedia of Nanotechnology; Bhushan, B., Ed.; Springer: Dordrecht, The Netherlands, 2012; pp. 517–526. [Google Scholar]
- Yuan, Y.; Gao, Y.; Zhao, J.; Mao, L. Characterization and stability evaluation of β-carotene nanoemulsions prepared by high pressure homogenization under various emulsifying conditions. Food Res. Int. 2008, 41, 61–68. [Google Scholar] [CrossRef] [Scilit]
- Espitia, P.J.P.; Fuenmayor, C.A.; Otoni, C.G. Nanoemulsions: Synthesis, Characterization, and Application in Bio-Based Active Food Packaging. Compr. Rev. Food Sci. Food Saf. 2019, 18, 264–285. [Google Scholar] [CrossRef] [Scilit]
- Karimkhani Aksut, C.; Dellavalle, R.P.; Naghavi, M. 181 Global skin disease morbidity and mortality: An update from the Global Burden of Disease Study 2013. J. Invest Dermatol. 2017, 137, S31. [Google Scholar] [CrossRef] [Scilit]
- Seth, D.; Cheldize, K.; Brown, D.; Freeman, E.E. Global Burden of Skin Disease: Inequities and Innovations. Curr. Derm. Rep. 2017, 6, 204–210. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, X.; Wang, A.; Shi, T.; Zhang, J.; Xu, H.; Wang, D.; Feng, L. The psychosocial adaptation of patients with skin disease: A scoping review. BMC Public Health 2019, 19, 1404. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zamora, N.V.; Valerio-Morales, I.-A.; Lopez-Olivo, M.A.; Pan, X.; Suarez-Almazor, M.E. Phosphodiesterase 4 inhibitors for psoriatic arthritis. Cochrane Database Syst. Rev. 2016. [Google Scholar] [CrossRef] [Scilit]
- Lopalco, G.; Venerito, V.; Leccese, P.; Emmi, G.; Cantarini, L.; Lascaro, N.; Di Scala, G.; Fabiani, C.; Rigante, D.; Iannone, F. Real-world effectiveness of apremilast in multirefractory mucosal involvement of Behçet’s disease. Ann. Rheum. Dis. 2019, 78, 1736–1737. [Google Scholar] [CrossRef] [Scilit]
- European Medicines Agency ICH Q2 (R1) Validation of Analytical Procedures: Text and Methodology. Available online: https://www.ema.europa.eu/en/ich-q2-r1-validation-analytical-procedures-text-methodology (accessed on 15 July 2020).
- Kulkarni, P.; Deshpande, A. Analytical methods for determination of apremilast from bulk, dosage form and biological fluids: A critical review. Crit. Rev. Anal. Chem. 2020, 1–10. [Google Scholar] [CrossRef] [Scilit]
- Wadhwa, J.; Nair, A.; Kumria, R. Self-emulsifying therapeutic system: A potential approach for delivery of lipophilic drugs. Braz. J. Pharm. Sci. 2011, 47, 447–465. [Google Scholar] [CrossRef] [Scilit]
- Abbasi, S.; Amiri-Rigi, A. Microemulsions as nano-carriers for nutraceuticals: Current trends and the future outlook. EC Nutr. 2017, 12, 46–50. [Google Scholar]
- Fernández-Campos, F.; Clares Naveros, B.; López Serrano, O.; Alonso Merino, C.; Calpena Campmany, A.C. Evaluation of novel nystatin nanoemulsion for skin candidosis infections: Nystatin nanoemulsion for skin candidosis. Mycoses 2013, 56, 70–81. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Espinoza, L.C.; Silva-Abreu, M.; Calpena, A.C.; Rodríguez-Lagunas, M.J.; Fábrega, M.-J.; Garduño-Ramírez, M.L.; Clares, B. Nanoemulsion strategy of pioglitazone for the treatment of skin inflammatory diseases. Nanomed. Nanotechnol. Biol. Med. 2019, 19, 115–125. [Google Scholar] [CrossRef] [Scilit]
- Gué, E.; Since, M.; Ropars, S.; Herbinet, R.; Le Pluart, L.; Malzert-Fréon, A. Evaluation of the versatile character of a nanoemulsion formulation. Int. J. Pharm. 2016, 498, 49–65. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Elmataeeshy, M.E.; Sokar, M.S.; Bahey-El-Din, M.; Shaker, D.S. Enhanced transdermal permeability of Terbinafine through novel nanoemulgel formulation; Development, in vitro and in vivo characterization. Future J. Pharm. Sci. 2018, 4, 18–28. [Google Scholar] [CrossRef] [Scilit]
- Szumała, P. Structure of microemulsion formulated with monoacylglycerols in the presence of polyols and ethanol. J. Surfactants Deterg. 2015, 18, 97–106. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ciurlizza, C.; Fernández, F.; Calpena, A.C.; Lázaro, R.; Parra, A.; Clares, B. Semisolid formulations containing cetirizine: Human skin permeation and topical antihistaminic evaluation in a rabbit model. Arch. Dermatol. Res. 2014, 306, 711–717. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ali, M.S.; Alam, M.S.; Alam, N.; Siddiqui, M.R. Preparation, characterization and stability study of dutasteride loaded nanoemulsion for treatment of benign prostatic hypertrophy. Iran J. Pharm. Res. 2014, 13, 1125–1140. [Google Scholar]
- Zhang, Z.; McClements, D.J. Overview of Nanoemulsion Properties: Stability, Rheology, and Appearance. In Nanoemulsions; Elsevier: Amsterdam, The Netherlands, 2018; pp. 21–49. [Google Scholar]
- Mehrnia, M.-A.; Jafari, S.-M.; Makhmal-Zadeh, B.S.; Maghsoudlou, Y. Rheological and release properties of double nano-emulsions containing crocin prepared with Angum gum, Arabic gum and whey protein. Food Hydrocoll. 2017, 66, 259–267. [Google Scholar] [CrossRef] [Scilit]
- Salamanca, C.; Barrera-Ocampo, A.; Lasso, J.; Camacho, N.; Yarce, C. Franz diffusion cell approach for pre-formulation characterisation of ketoprofen semi-solid dosage forms. Pharmaceutics 2018, 10, 148. [Google Scholar] [CrossRef] [Scilit]
- Dahan, A.; Miller, J.M. The solubility–permeability interplay and its implications in formulation design and development for poorly soluble drugs. AAPS J. 2012, 14, 244–251. [Google Scholar] [CrossRef] [Scilit]
- Mallandrich, M.; Fernández-Campos, F.; Clares, B.; Halbaut, L.; Alonso, C.; Coderch, L.; Garduño-Ramírez, M.L.; Andrade, B.; del Pozo, A.; Lane, M.E.; et al. Developing transdermal applications of ketorolac tromethamine entrapped in stimuli sensitive block copolymer hydrogels. Pharm. Res. 2017, 34, 1728–1740. [Google Scholar] [CrossRef] [Scilit]
- Lai, J.; Maibach, H.I. Experimental models in predicting topical antifungal efficacy: Practical aspects and challenges. Skin Pharmacol. Physiol. 2009, 22, 231–239. [Google Scholar] [CrossRef] [Scilit]
- Abd, E.; Yousef, S.A.; Pastore, M.N.; Telaprolu, K.; Mohammed, Y.H.; Namjoshi, S.; Grice, J.E.; Roberts, M.S. Skin models for the testing of transdermal drugs. Clin. Pharmacol. 2016, 8, 163–176. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Schafer, P.H.; Chen, P.; Fang, L.; Wang, A.; Chopra, R. The pharmacodynamic impact of apremilast, an oral phosphodiesterase 4 inhibitor, on circulating levels of inflammatory biomarkers in patients with psoriatic arthritis: Substudy results from a phase III, randomized, placebo-controlled trial (PALACE 1). J. Immunol. Res. 2015, 906349. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Messamore, E.; Yao, J.K. Phospholipid, arachidonate and eicosanoid signaling in schizophrenia. Oilseeds Fats Crops Lipids 2016, 23, D112. [Google Scholar] [CrossRef] [Scilit]
- Kiezel-Tsugunova, M.; Kendall, A.C.; Nicolaou, A. Fatty acids and related lipid mediators in the regulation of cutaneous inflammation. Biochem. Soc. Trans. 2018, 46, 119–129. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hwang, P.-A.; Hung, Y.-L.; Chien, S.-Y. Inhibitory activity of Sargassum hemiphyllum sulfated polysaccharide in arachidonic acid-induced animal models of inflammation. J. Food Drug Anal. 2015, 23, 49–56. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kawahara, K.; Hohjoh, H.; Inazumi, T.; Tsuchiya, S.; Sugimoto, Y. Prostaglandin E2-induced inflammation: Relevance of prostaglandin E receptors. Biochim. Biophys. Acta Mol. Cell. Biol. Lipids 2015, 1851, 414–421. [Google Scholar] [CrossRef] [Scilit]
- Veras, H.N.H.; Araruna, M.K.A.; Costa, J.G.M.; Coutinho, H.D.M.; Kerntopf, M.R.; Botelho, M.A.; Menezes, I.R.A. Topical antiinflammatory activity of essential oil of Lippia sidoides Cham: Possible Mechanism of Action. Phytother. Res. 2013, 27, 179–185. [Google Scholar] [CrossRef] [Scilit]
- Toda, K.; Tsukayama, I.; Nagasaki, Y.; Konoike, Y.; Tamenobu, A.; Ganeko, N.; Ito, H.; Kawakami, Y.; Takahashi, Y.; Miki, Y.; et al. Red-kerneled rice proanthocyanidin inhibits arachidonate 5-lipoxygenase and decreases psoriasis-like skin inflammation. Arch. Biochem. 2020, 108307. [Google Scholar] [CrossRef] [Scilit]
- Pincelli, C.; Schafer, P.H.; French, L.E.; Augustin, M.; Krueger, J.G. Mechanisms underlying the clinical effects of apremilast for psoriasis. J. Drugs Dermatol. 2018, 17, 835–840. [Google Scholar]
- Da Silva, B.A.F.; da Costa, R.H.S.; Fernandes, C.N.; Leite, L.H.I.; Ribeiro-Filho, J.; Garcia, T.R.; Coutinho, H.D.M.; Wanderley, A.G.; de Menezes, I.R.A. HPLC profile and antiedematogenic activity of Ximenia americana L. (Olacaceae) in mice models of skin inflammation. Food Chem. Toxicol. 2018, 119, 199–205. [Google Scholar] [CrossRef] [Scilit]
- Tang, S.-C.; Liao, P.-Y.; Hung, S.-J.; Ge, J.-S.; Chen, S.-M.; Lai, J.-C.; Hsiao, Y.-P.; Yang, J.-H. Topical application of glycolic acid suppresses the UVB induced IL-6, IL-8, MCP-1 and COX-2 inflammation by modulating NF-κB signaling pathway in keratinocytes and mice skin. J. Dermatol. Sci. 2017, 86, 238–248. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- De Vry, C.G.; Valdez, M.; Lazarov, M.; Muhr, E.; Buelow, R.; Fong, T.; Iyer, S. Topical application of a novel immunomodulatory peptide, RDP58, reduces skin inflammation in the phorbol ester-induced dermatitis model. J. Invest Dermatol. 2005, 125, 473–481. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Schüler, R.; Brand, A.; Klebow, S.; Wild, J.; Veras, F.P.; Ullmann, E.; Roohani, S.; Kolbinger, F.; Kossmann, S.; Wohn, C.; et al. Antagonization of IL-17A attenuates skin inflammation and vascular dysfunction in mouse models of psoriasis. J. Invest Dermatol. 2019, 139, 638–647. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Go, H.-N.; Lee, S.-H.; Cho, H.-J.; Ahn, J.-R.; Kang, M.-J.; Lee, S.-Y.; Hong, S.-J. Effects of chloromethylisothiazolinone/methylisothiazolinone (CMIT/MIT) on Th2/Th17-related immune modulation in an atopic dermatitis mouse model. Sci. Rep. 2020, 10, 4099. [Google Scholar] [CrossRef] [Scilit]
- Lubrano, E.; Scriffignano, S.; Perrotta, F.M. TNF-alpha inhibitors for the six treatment targets of psoriatic arthritis. Expert Rev. Clin. Immunol. 2019, 15, 1303–1312. [Google Scholar] [CrossRef] [Scilit]
- Mootoo, A.; Stylianou, E.; Arias, M.A.; Reljic, R. TNF-α in tuberculosis: A cytokine with a split personality. Inflamm. Allergy Drug Targets 2009, 8, 53–62. [Google Scholar] [CrossRef] [Scilit]
- Chu, W.-M. Tumor necrosis factor. Cancer Lett. 2013, 328, 222–225. [Google Scholar] [CrossRef] [Scilit]
- Liu, Y.; Yang, G.; Zhang, J.; Xing, K.; Dai, L.; Cheng, L.; Liu, J.; Deng, J.; Shi, G.; Li, C.; et al. Anti-TNF-α monoclonal antibody reverses psoriasis through dual inhibition of inflammation and angiogenesis. Int. Immunopharmacol. 2015, 28, 731–743. [Google Scholar] [CrossRef] [Scilit]
- Lin, Z.-M.; Ma, M.; Li, H.; Qi, Q.; Liu, Y.-T.; Yan, Y.-X.; Shen, Y.-F.; Yang, X.-Q.; Zhu, F.-H.; He, S.-J.; et al. Topical administration of reversible SAHH inhibitor ameliorates imiquimod-induced psoriasis-like skin lesions in mice via suppression of TNF-α/IFN-γ-induced inflammatory response in keratinocytes and T cell-derived IL-17. Pharmacol. Res. 2018, 129, 443–452. [Google Scholar] [CrossRef] [Scilit]
- Bianchi, L.; Del Duca, E.; Romanelli, M.; Saraceno, R.; Chimenti, S.; Chiricozzi, A. Pharmacodynamic assessment of apremilast for the treatment of moderate-to-severe plaque psoriasis. Expert Opin. Drug Metab. Toxicol. 2016, 12, 1121–1128. [Google Scholar] [CrossRef] [Scilit]
- Ozawa, M.; Terui, T.; Tagami, H. Localization of IL-8 and Complement Components in Lesional Skin of Psoriasis vulgaris and Pustulosis palmaris et plantaris. Dermatology 2005, 211, 249–255. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kondo, S.; Kono, T.; Sauder, D.N.; McKenzie, R.C. IL-8 gene expression and production in human keratinocytes and their modulation by UVB. J. Invest Dermatol. 1993, 101, 690–694. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bernardini, N.; Skroza, N.; Tolino, E.; Mambrin, A.; Anzalone, A.; Balduzzi, V.; Colapietra, D.; Marchesiello, A.; Michelini, S.; Proietti, I.; et al. IL-17 and its role in inflammatory, autoimmune, and oncological skin diseases: State of art. Int. J. Dermatol. 2020, 59, 406–411. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Beringer, A.; Noack, M.; Miossec, P. IL-17 in chronic inflammation: From discovery to targeting. Trends Mol. Med. 2016, 22, 230–241. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Medvedeva, I.V.; Stokes, M.E.; Eisinger, D.; LaBrie, S.T.; Ai, J.; Trotter, M.W.B.; Schafer, P.; Yang, R. Large-scale analyses of disease biomarkers and apremilast pharmacodynamic effects. Sci. Rep. 2020, 10, 605. [Google Scholar] [CrossRef] [Scilit]
- Thangamani, S.; Younis, W.; Seleem, M.N. Repurposing ebselen for treatment of multidrug-resistant staphylococcal infections. Sci. Rep. 2015, 5, 11596. [Google Scholar] [CrossRef] [Scilit]
- López-García, J.; Lehocký, M.; Humpolíček, P.; Sáha, P. HaCaT keratinocytes response on antimicrobial atelocollagen substrates: Extent of cytotoxicity, cell viability and proliferation. J. Funct. Biomater. 2014, 5, 43–57. [Google Scholar] [CrossRef] [Scilit]
- Souto, E.B.; Zielinska, A.; Souto, S.B.; Durazzo, A.; Lucarini, M.; Santini, A.; Silva, A.M.; Atanasov, A.G.; Marques, C.; Andrade, L.N.; et al. (+)-Limonene 1,2-epoxide-loaded slns: Evaluation of drug release, antioxidant activity, and cytotoxicity in an HaCaT cell line. Int. J. Mol. Sci. 2020, 21, 1449. [Google Scholar] [CrossRef] [Scilit]
- Villanueva-Martínez, A.; Hernández-Rizo, L.; Ganem-Rondero, A. Evaluating two nanocarrier systems for the transdermal delivery of sodium alendronate. Int. J. Pharm. 2020, 582, 119312. [Google Scholar] [CrossRef] [Scilit]
- Alalaiwe, A.; Lin, C.-F.; Hsiao, C.-Y.; Chen, E.-L.; Lin, C.-Y.; Lien, W.-C.; Fang, J.-Y. Development of flavanone and its derivatives as topical agents against psoriasis: The prediction of therapeutic efficiency through skin permeation evaluation and cell-based assay. Int. J. Pharm. 2020, 581, 119256. [Google Scholar] [CrossRef] [Scilit]
- Duplan, H.; Nocera, T. Hydratation cutanée et produits hydratants. Ann. Dermatol. Venereol. 2018, 145, 376–384. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tomita, Y.; Akiyama, M.; Shimizu, H. Stratum corneum hydration and flexibility are useful parameters to indicate clinical severity of congenital ichthyosis. Exp. Dermatol. 2005, 14, 619–624. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Schario, M.; Tomova-Simitchieva, T.; Lichterfeld, A.; Herfert, H.; Dobos, G.; Lahmann, N.; Blume-Peytavi, U.; Kottner, J. Effects of two different fabrics on skin barrier function under real pressure conditions. J. Tissue Viability 2017, 26, 150–155. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, Q.; Murawsky, M.; LaCount, T.; Kasting, G.B.; Li, S.K. Transepidermal water loss and skin conductance as barrier integrity tests. Toxicol. In Vitro 2018, 51, 129–135. [Google Scholar] [CrossRef] [Scilit]
- Jansen van Rensburg, S.; Franken, A.; Du Plessis, J.L. Measurement of transepidermal water loss, stratum corneum hydration and skin surface pH in occupational settings: A review. Skin Res. Technol. 2019, 25, 595–605. [Google Scholar] [CrossRef] [Scilit]
- Fujimura, T.; Shimotoyodome, Y.; Nishijima, T.; Sugata, K.; Taguchi, H.; Moriwaki, S. Changes in hydration of the stratum corneum are the most suitable indicator to evaluate the irritation of surfactants on the skin. Skin Res. Technol. 2017, 23, 97–103. [Google Scholar] [CrossRef] [Scilit]
- Alvarado, H.L.; Abrego, G.; Garduño-Ramirez, M.L.; Clares, B.; García, M.L.; Calpena, A.C. Development and validation of a high-performance liquid chromatography method for the quantification of ursolic/oleanic acids mixture isolated from Plumeria obtusa. J. Chromatogr. B 2015, 983–984, 111–116. [Google Scholar] [CrossRef] [Scilit]
- Pineros, I.; Slowing, K.; Serrano, D.R.; de Pablo, E.; Ballesteros, M.P. Analgesic and anti-inflammatory controlled-released injectable microemulsion: Pseudo-ternary phase diagrams, in vitro, ex vivo and in vivo evaluation. Eur. J. Pharm. Sci. 2017, 101, 220–227. [Google Scholar] [CrossRef] [Scilit]
- Feng, H.; Kang, W.; Wu, H.; Li, Z.; Chen, J.; Zhou, Q.; Bai, B. Study on the relationship between emulsion stability and droplet dynamics of a spontaneous emulsion for chemical enhanced oil recovery. J. Disper. Sci. Technol. 2018, 39, 1214–1222. [Google Scholar] [CrossRef] [Scilit]
- Sandig, A.G.; Campmany, A.C.C.; Campos, F.F.; Villena, M.J.M.; Naveros, B.C. Transdermal delivery of imipramine and doxepin from newly oil-in-water nanoemulsions for an analgesic and anti-allodynic activity: Development, characterization and in vivo evaluation. Colloids Surf. B 2013, 103, 558–565. [Google Scholar] [CrossRef] [Scilit]













| Components | (%) |
|---|---|
| Apremilast (1.5 mg/mL) | |
| Plurol® oleique CC497 (Polyglyceryl-3 dioleate) | 6.00 |
| Labrasol® (Caprylocaproyl Polyoxyl-8 glycerides) | 29.33 |
| Transcutol® P (Diethylene glycol monoethyl ether) | 14.67 |
| Water | 50.00 |
| Time (days) | Drug Content (%) | ||
|---|---|---|---|
| 4 ± 1 °C | 30 ± 2 °C | 40 ± 2 °C | |
| 1 | 99.66 | 99.67 | 99.67 |
| 30 | 99.66 | 99.66 | 99.66 |
| 60 | 99.61 | 99.12 | 98.90 |
| 90 | 99.59 | 98.67 | 98.14 |
| Gene | Primer Sequence (5′ to 3′) | Gene Accession Number |
|---|---|---|
| GAPDH | FW: AGCTTGTCATCAACGGGAAG | BC023196.2 |
| RV: TTTGATGTTAGTGGGGTCTCG | ||
| IL-8 | FW: GCTGTGACCCTCTCTGTGAAG | X53798.1 |
| RV: CAAACTCCATCTTGTTGTGTC | ||
| IL-17A | FW: TTTTCAGCAAGGAATGTGGA | NM_010552.3 |
| RV: TTCATTGTGGAGGGCAGAC | ||
| TNFα | FW: AACTAGTGGTGCCAGCCGAT | NM_013693.3 |
| RV: CTTCACAGAGCAATGACTCC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Sarango-Granda, P.; Silva-Abreu, M.; Calpena, A.C.; Halbaut, L.; Fábrega, M.-J.; Rodríguez-Lagunas, M.J.; Díaz-Garrido, N.; Badia, J.; Espinoza, L.C. Apremilast Microemulsion as Topical Therapy for Local Inflammation: Design, Characterization and Efficacy Evaluation. Pharmaceuticals 2020, 13, 484. https://doi.org/10.3390/ph13120484
Sarango-Granda P, Silva-Abreu M, Calpena AC, Halbaut L, Fábrega M-J, Rodríguez-Lagunas MJ, Díaz-Garrido N, Badia J, Espinoza LC. Apremilast Microemulsion as Topical Therapy for Local Inflammation: Design, Characterization and Efficacy Evaluation. Pharmaceuticals. 2020; 13(12):484. https://doi.org/10.3390/ph13120484
Chicago/Turabian StyleSarango-Granda, Paulo, Marcelle Silva-Abreu, Ana Cristina Calpena, Lyda Halbaut, María-José Fábrega, María J. Rodríguez-Lagunas, Natalia Díaz-Garrido, Josefa Badia, and Lupe Carolina Espinoza. 2020. "Apremilast Microemulsion as Topical Therapy for Local Inflammation: Design, Characterization and Efficacy Evaluation" Pharmaceuticals 13, no. 12: 484. https://doi.org/10.3390/ph13120484
APA StyleSarango-Granda, P., Silva-Abreu, M., Calpena, A. C., Halbaut, L., Fábrega, M.-J., Rodríguez-Lagunas, M. J., Díaz-Garrido, N., Badia, J., & Espinoza, L. C. (2020). Apremilast Microemulsion as Topical Therapy for Local Inflammation: Design, Characterization and Efficacy Evaluation. Pharmaceuticals, 13(12), 484. https://doi.org/10.3390/ph13120484

