MTA Enhances the Potential of Adipose-Derived Mesenchymal Stem Cells for Dentin–Pulp Complex Regeneration
Abstract
1. Introduction
2. Materials and Methods
2.1. Isolation and Culture of Human Ad-MSCs and BM-MSCs
2.2. Preparation of MTA-Conditioned Medium
2.3. Cell Viability Assay
2.4. Alkaline Phosphatase (ALP) Activity and Alizarin Red S Staining
2.5. Evaluation of Gene Expression by Quantitative Reverse Transcription-Polymerase Chain Reaction (qRT-PCR)
2.6. Statistical Analysis
3. Results
3.1. Effects of MTA on Proliferation of Ad-MSCs and BM-MSCs
3.2. Effects of MTA on Osteo/Odontogenic Potential of Ad- and BM-MSCs
4. Discussion
5. Conclusions
Author Contributions
Funding
Conflicts of Interest
References
- Peters, O.A. Translational opportunities in stem cell-based endodontic therapy: Where are we and what are we missing? J. Endod. 2014, 40, S82–S85. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nosrat, A.; Homayounfar, N.; Oloomi, K. Drawbacks and unfavorable outcomes of regenerative endodontic treatments of necrotic immature teeth: A literature review and report of a case. J. Endod. 2012, 38, 1428–1434. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Siqueira, J.F. Reaction of periradicular tissues to root canal treatment: Benefits and drawbacks. Endod. Top. 2005, 10, 123–147. [Google Scholar] [CrossRef] [Scilit]
- Wu, Z.; Wang, F.; Fan, Z.; Wu, T.; He, J.; Wang, J.; Zhang, C.; Wang, S. Whole-Tooth Regeneration by Allogeneic Cell Reassociation in Pig Jawbone. Tissue Eng. Part A 2019, 25, 1202–1212. [Google Scholar] [CrossRef] [Scilit]
- Wei, F.; Song, T.; Ding, G.; Xu, J.; Liu, Y.; Liu, D.; Fan, Z.; Zhang, C.; Shi, S.; Wang, S. Functional tooth restoration by allogeneic mesenchymal stem cell-based bio-root regeneration in swine. Stem Cells Dev. 2013, 22, 1752–1762. [Google Scholar] [CrossRef] [Scilit]
- Kaneko, T.; Gu, B.; Sone, P.P.; Zaw, S.Y.M.; Murano, H.; Zaw, Z.C.T.; Okiji, T. Dental Pulp Tissue Engineering Using Mesenchymal Stem Cells: A Review with a Protocol. Stem Cell Rev. Rep. 2018, 14, 668–676. [Google Scholar] [CrossRef] [Scilit]
- Conde, M.C.M.; Chisini, L.A.; Demarco, F.F.; Nör, J.E.; Casagrande, L.; Tarquinio, S.B.C. Stem cell-based pulp tissue engineering: Variables enrolled in translation from the bench to the bedside, a systematic review of literature. Int. Endod. J. 2016, 49, 543–550. [Google Scholar] [CrossRef] [Scilit]
- Babaki, D.; Matin, M.M. Odontoblast-like Cytodifferentiation of Dental Stem Cells: A review. Iran. Endod. J. 2020, 15, 79–89. [Google Scholar] [CrossRef] [Scilit]
- Shrestha, S.; Kishen, A. Bioactive Molecule Delivery Systems for Dentin-pulp Tissue Engineering. J. Endod. 2017, 43, 733–744. [Google Scholar] [CrossRef] [Scilit]
- Chieruzzi, M.; Pagano, S.; De Carolis, C.; Eramo, S.; Kenny, J.M. Scanning Electron Microscopy Evaluation of Dental Root Resorption Associated With Granuloma. Microsc. Microanal. 2015, 21, 1264–1270. [Google Scholar] [CrossRef] [Scilit]
- Mente, J.; Leo, M.; Panagidis, D.; Ohle, M.; Schneider, S.; Lorenzo Bermejo, J.; Pfefferle, T. Treatment outcome of mineral trioxide aggregate in open apex teeth. J. Endod. 2013, 39, 20–26. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gabor, C.; Tam, E.; Shen, Y.; Haapasalo, M. Prevalence of internal inflammatory root resorption. J. Endod. 2012, 38, 24–27. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tsesis, I.; Rosenberg, E.; Faivishevsky, V.; Kfir, A.; Katz, M.; Rosen, E. Prevalence and Associated Periodontal Status of Teeth with Root Perforation: A Retrospective Study of 2002 Patients’ Medical Records. J. Endod. 2010, 36, 797–800. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yuan, Z.; Nie, H.; Wang, S.; Lee, C.H.; Li, A.; Fu, S.Y.; Zhou, H.; Chen, L.; Mao, J.J. Biomaterial selection for tooth regeneration. Tissue Eng. Part B Rev. 2011, 17, 373–388. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sonoyama, W.; Liu, Y.; Fang, D.; Yamaza, T.; Seo, B.-M.; Zhang, C.; Liu, H.; Gronthos, S.; Wang, C.-Y.; Shi, S.; et al. Mesenchymal Stem Cell-Mediated Functional Tooth Regeneration in Swine. PLoS ONE 2006, 1, e79. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Parirokh, M.; Torabinejad, M.; Dummer, P.M.H. Mineral trioxide aggregate and other bioactive endodontic cements: An updated overview—Part I: Vital pulp therapy. Int. Endod. J. 2018, 51, 177–205. [Google Scholar] [CrossRef] [Scilit]
- Babaki, D.; Yaghoubi, S.; Matin, M.M. The effects of mineral trioxide aggregate on osteo/odontogenic potential of mesenchymal stem cells: A comprehensive and systematic literature review. Biomater. Invest. Dent. 2020, 7, 175–185. [Google Scholar] [CrossRef] [Scilit]
- Gimble, J.M.; Guilak, F. Adipose-derived adult stem cells: Isolation, characterization, and differentiation potential. Cytotherapy 2003, 5, 362–369. [Google Scholar] [CrossRef] [Scilit]
- Mizuno, H. Adipose-derived Stem Cells for Tissue Repair and Regeneration: Ten Years of Research and a Literature Review. J. Nippon Med. Sch. 2009, 76, 56–66. [Google Scholar] [CrossRef] [Scilit]
- Liao, H.-T. Osteogenic potential: Comparison between bone marrow and adipose-derived mesenchymal stem cells. World J. Stem Cells 2014, 6, 288. [Google Scholar] [CrossRef] [Scilit]
- Im, G.I.; Shin, Y.W.; Lee, K.B. Do adipose tissue-derived mesenchymal stem cells have the same osteogenic and chondrogenic potential as bone marrow-derived cells? Osteoarthr. Cartil. 2005, 13, 845–853. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kia, N.A.; Bahrami, A.R.; Ebrahimi, M.; Matin, M.M.; Neshati, Z.; Almohaddesin, M.R.; Aghdami, N.; Bidkhori, H.R. Comparative analysis of chemokine receptor’s expression in mesenchymal stem cells derived from human bone marrow and adipose tissue. J. Mol. Neurosci. 2011, 44, 178–185. [Google Scholar] [CrossRef] [Scilit]
- Gregory, C.A.; Gunn, W.G.; Peister, A.; Prockop, D.J. An Alizarin red-based assay of mineralization by adherent cells in culture: Comparison with cetylpyridinium chloride extraction. Anal. Biochem. 2004, 329, 77–84. [Google Scholar] [CrossRef] [Scilit]
- Patel, B. Apexogenesis, apexification, revascularization and endodontic regeneration. In Endodontic Treatment, Retreatment, and Surgery: Mastering Clinical Practice; Springer International Publishing: Basel, Switzerland, 2016; pp. 205–223. ISBN 9783319194769. [Google Scholar]
- Corbella, S.; Ferrara, G.; El Kabbaney, A.; Taschieri, S. Apexification, apexogenesis and regenerative endodontic procedures: A review of the literature. Minerva Stomatol. 2014, 63, 375–389. [Google Scholar]
- Vallittu, P.K.; Boccaccini, A.R.; Hupa, L.; Watts, D.C. Bioactive dental materials—Do they exist and what does bioactivity mean? Dent. Mater. 2018, 34, 693–694. [Google Scholar] [CrossRef] [Scilit]
- Schmalz, G.; Galler, K.M. Biocompatibility of biomaterials—Lessons learned and considerations for the design of novel materials. Dent. Mater. 2017, 33, 382–393. [Google Scholar] [CrossRef] [Scilit]
- Torabinejad, M.; Parirokh, M.; Dummer, P.M.H. Mineral trioxide aggregate and other bioactive endodontic cements: An updated overview—Part II: Other clinical applications and complications. Int. Endod. J. 2018, 51, 284–317. [Google Scholar] [CrossRef] [Scilit]
- Parirokh, M.; Torabinejad, M. Mineral Trioxide Aggregate: A Comprehensive Literature Review—Part I: Chemical, Physical, and Antibacterial Properties. J. Endod. 2010, 36, 16–27. [Google Scholar] [CrossRef] [Scilit]
- Torabinejad, M.; Parirokh, M. Mineral Trioxide Aggregate: A Comprehensive Literature Review—Part II: Leakage and Biocompatibility Investigations. J. Endod. 2010, 36, 190–202. [Google Scholar] [CrossRef] [Scilit]
- Shi, S.; Miura, M.; Seo, B.M.; Robey, P.G.; Bartold, P.M.; Gronthos, S. The efficacy of mesenchymal stem cells to regenerate and repair dental structures. Orthod. Craniofacial Res. 2005, 8, 191–199. [Google Scholar] [CrossRef] [Scilit]
- Zhao, X.; He, W.; Song, Z.; Tong, Z.; Li, S.; Ni, L. Mineral trioxide aggregate promotes odontoblastic differentiation via mitogen-activated protein kinase pathway in human dental pulp stem cells. Mol. Biol. Rep. 2012, 39, 215–220. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, Y.; Zhou, Y.; Jin, L.; Pang, X.; Lu, Y.; Wang, Z.; Yu, Y.; Yu, J. Mineral trioxide aggregate enhances the osteogenic capacity of periodontal ligament stem cells via NF-κB and MAPK signaling pathways. J. Cell. Physiol. 2018, 233, 2386–2397. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zomer, H.D.; Vidane, A.S.; Gonçalves, N.N.; Ambrósio, C.E. Mesenchymal and induced pluripotent stem cells: General insights and clinical perspectives. Stem Cells Cloning Adv. Appl. 2015, 8, 125–134. [Google Scholar] [CrossRef] [Scilit]
- Jung, Y.; Bauer, G.; Nolta, J.A. Concise review: Induced pluripotent stem cell-derived mesenchymal stem cells: Progress toward safe clinical products. Stem Cells 2012, 30, 42–47. [Google Scholar] [CrossRef] [Scilit]






| Gene | Primer | Sequence (5′→3′) | Product Length |
|---|---|---|---|
| ALP | Forward | ACCAAGCGCAAGAGACACTG | 106 bp |
| Reverse | GTGGAGACACCCATCCCATCT | ||
| DSPP | Forward | CAAAAGTCCAGGACAGTGGGC | 186 bp |
| Reverse | TGGTTTGCTTTGAGGAACTGGA | ||
| OCN | Forward | CACCGAGACACCATGAGAGC | 132 bp |
| Reverse | CTGCTTGGACACAAAGGCTGC | ||
| RUNX2 | Forward | CTGTCATGGCGGGTAACGAT | 132 bp |
| Reverse | AGGTGAAACTCTTGCCTCGT | ||
| GAPDH | Forward | GTCGGAGTCAACGGATTTGG | 156 bp |
| Reverse | ATGGAATTTGCCATGGGTGG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Babaki, D.; Amoako, K.; Bahrami, A.R.; Yaghoubi, S.; Mirahmadi, M.; Matin, M.M. MTA Enhances the Potential of Adipose-Derived Mesenchymal Stem Cells for Dentin–Pulp Complex Regeneration. Materials 2020, 13, 5712. https://doi.org/10.3390/ma13245712
Babaki D, Amoako K, Bahrami AR, Yaghoubi S, Mirahmadi M, Matin MM. MTA Enhances the Potential of Adipose-Derived Mesenchymal Stem Cells for Dentin–Pulp Complex Regeneration. Materials. 2020; 13(24):5712. https://doi.org/10.3390/ma13245712
Chicago/Turabian StyleBabaki, Danial, Kagya Amoako, Ahmad Reza Bahrami, Sanam Yaghoubi, Mahdi Mirahmadi, and Maryam M. Matin. 2020. "MTA Enhances the Potential of Adipose-Derived Mesenchymal Stem Cells for Dentin–Pulp Complex Regeneration" Materials 13, no. 24: 5712. https://doi.org/10.3390/ma13245712
APA StyleBabaki, D., Amoako, K., Bahrami, A. R., Yaghoubi, S., Mirahmadi, M., & Matin, M. M. (2020). MTA Enhances the Potential of Adipose-Derived Mesenchymal Stem Cells for Dentin–Pulp Complex Regeneration. Materials, 13(24), 5712. https://doi.org/10.3390/ma13245712

