Antagonism and Synergism Characterize the Interactions between Four North American Potato Virus Y Strains
Abstract
:1. Introduction
2. Materials and Methods
2.1. Virus Inoculations
2.2. Isolation of RNA and Reverse Transcription Quantitative PCR (RT-qPCR)
2.3. Determination of Relative Viral RNA Titer
3. Results
3.1. Antagonistic and Synergistic Interactions between PVY Strains in Potato
3.2. RT-qPCR Quantification of Viral RNA
3.3. Replication and Cell-To-Cell Movement of PVY Strains
3.4. Interactions between PVY Strains in Potato Tubers
3.5. Effect of Temperature on PVY Cell-to-Cell Movement in Tubers
3.6. Evidence of Virus Replication in Potato Tubers
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Scholthof, K.-B.G.; Adkins, S.; Czosnek, H.; Palukaitis, P.; Jacquot, E.; Hohn, T.; Hohn, B.; Saunders, K.; Candresse, T.; Ahlquist, P.; et al. Top 10 Plant Viruses in Molecular Plant Pathology. Mol. Plant Pathol. 2011, 12, 938–954. [Google Scholar] [CrossRef] [PubMed]
- Karasev, A.V.; Gray, S.M. Continuous and Emerging Challenges of Potato Virus Y in Potato. Annu. Rev. Phytopathol. 2013, 51, 571–586. [Google Scholar] [CrossRef] [PubMed]
- Gray, S.; De Boer, S.; Lorenzen, J.; Karasev, A.; Whitworth, J.; Nolte, P.; Singh, R.; Boucher, A.; Xu, H. Potato Virus Y: An Evolving Concern for Potato Crops in the United States and Canada. Plant Dis. 2010, 94, 1384–1397. [Google Scholar] [CrossRef]
- Karasev, A.V.; Hu, X.; Brown, C.J.; Kerlan, C.; Nikolaeva, O.V.; Crosslin, J.M.; Gray, S.M. Genetic Diversity of the Ordinary Strain of Potato Virus Y (PVY) and Origin of Recombinant PVY Strains. Phytopathology 2011, 101, 778–785. [Google Scholar] [CrossRef]
- Green, K.J.; Brown, C.J.; Gray, S.M.; Karasev, A.V. Phylogenetic Study of Recombinant Strains of Potato Virus Y. Virology 2017, 507, 40–52. [Google Scholar] [CrossRef] [PubMed]
- MacKenzie, T.D.B.; Nie, X.; Bisht, V.; Singh, M. Proliferation of Recombinant PVY Strains in Two Potato-Producing Regions of Canada, and Symptom Expression in 30 Important Potato Varieties with Different PVY Strains. Plant Dis. 2019, 103, 2221–2230. [Google Scholar] [CrossRef]
- Hu, X.; He, C.; Xiao, Y.; Xiong, X.; Nie, X. Molecular Characterization and Detection of Recombinant Isolates of Potato Virus Y from China. Arch. Virol. 2009, 154, 1303–1312. [Google Scholar] [CrossRef] [PubMed]
- Rowley, J.S.; Gray, S.M.; Karasev, A.V. Screening Potato Cultivars for New Sources of Resistance to Potato Virus Y. Am. J. Potato Res. 2015, 92, 38–48. [Google Scholar] [CrossRef]
- Carroll, J.E.; Smith, D.M.; Gray, S.M. Preferential Acquisition and Inoculation of PVYNTN over PVYO in Potato by the Green Peach Aphid Myzus Persicae (Sulzer). J. Gen. Virol. 2016, 97, 797–802. [Google Scholar] [CrossRef]
- Boonham, N.; Walsh, K.; Preston, S.; North, J.; Smith, P.; Barker, I. The Detection of Tuber Necrotic Isolates of Potato Virus Y, and the Accurate Discrimination of PVY(O), PVY(N) and PVY(C) Strains Using RT-PCR. J. Virol. Methods 2002, 102, 103–112. [Google Scholar] [CrossRef]
- Nie, B.; Singh, M.; Murphy, A.; Sullivan, A.; Xie, C.; Nie, X. Response of Potato Cultivars to Five Isolates Belonging to Four Strains of Potato Virus Y. Plant Dis. 2012, 96, 1422–1429. [Google Scholar] [CrossRef]
- Gebhardt, C.; Valkonen, J.P. Organization of Genes Controlling Disease Resistance in the Potato Genome. Annu. Rev. Phytopathol. 2001, 39, 79–102. [Google Scholar] [CrossRef] [PubMed]
- Mestre, P.; Brigneti, G.; Baulcombe, D.C. An Ry-Mediated Resistance Response in Potato Requires the Intact Active Site of the NIa Proteinase from Potato Virus Y. Plant J. 2000, 23, 653–661. [Google Scholar] [CrossRef] [PubMed]
- Dupuis, B.; Bragard, C.; Schumpp, O. Resistance of Potato Cultivars as a Determinant Factor of Potato Virus Y (PVY) Epidemiology. Potato Res. 2019, 62, 123–138. [Google Scholar] [CrossRef]
- Funke, C.N.; Nikolaeva, O.V.; Green, K.J.; Tran, L.T.; Chikh-Ali, M.; Quintero-Ferrer, A.; Cating, R.A.; Frost, K.E.; Hamm, P.B.; Olsen, N.; et al. Strain-Specific Resistance to Potato Virus Y (PVY) in Potato and Its Effect on the Relative Abundance of PVY Strains in Commercial Potato Fields. Plant Dis. 2017, 101, 20–28. [Google Scholar] [CrossRef] [PubMed]
- Jones, R.A.C.; Barbetti, M.J.; Fox, A.; Adams, I.P. Potato Virus Y Biological Strain Group YD: Hypersensitive Resistance Genes Elicited and Phylogenetic Placement. Plant Dis. 2021, 105, 3600–3609. [Google Scholar] [CrossRef] [PubMed]
- Jones, R.a.C. Strain Group Specific and Virus Specific Hypersensitive Reactions to Infection with Potyviruses in Potato Cultivars. Ann. Appl. Biol. 1990, 117, 93–105. [Google Scholar] [CrossRef]
- Mondal, S.; Lin, Y.-H.; Carroll, J.E.; Wenninger, E.J.; Bosque-Pérez, N.A.; Whitworth, J.L.; Hutchinson, P.; Eigenbrode, S.; Gray, S.M. Potato Virus Y Transmission Efficiency from Potato Infected with Single or Multiple Virus Strains. Phytopathology 2017, 107, 491–498. [Google Scholar] [CrossRef]
- Hühnlein, A.; Drechsler, N.; Steinbach, P.; Thieme, T.; Schubert, J. Comparison of Three Methods for the Detection of Potato Virus Y in Seed Potato Certification. J. Plant Dis. Prot. 2013, 120, 57–69. [Google Scholar] [CrossRef]
- Taylor, S.; Wakem, M.; Dijkman, G.; Alsarraj, M.; Nguyen, M. A Practical Approach to RT-qPCR-Publishing Data That Conform to the MIQE Guidelines. Methods 2010, 50, S1–S5. [Google Scholar] [CrossRef]
- Wilhelm, J.; Pingoud, A.; Hahn, M. Validation of an Algorithm for Automatic Quantification of Nucleic Acid Copy Numbers by Real-Time Polymerase Chain Reaction. Anal. Biochem. 2003, 317, 218–225. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Jones, R.A.C.; Vincent, S.J. Strain-Specific Hypersensitive and Extreme Resistance Phenotypes Elicited by Potato Virus Y Among 39 Potato Cultivars Released in Three World Regions Over a 117-Year Period. Plant Disease 2018, 102, 185–196. [Google Scholar] [CrossRef] [PubMed]
- Caplan, J.L.; Mamillapalli, P.; Burch-Smith, T.M.; Czymmek, K.; Dinesh-Kumar, S.P. Chloroplastic Protein NRIP1 Mediates Innate Immune Receptor Recognition of a Viral Effector. Cell 2008, 132, 449–462. [Google Scholar] [CrossRef]
- Tian, Y.-P.; Valkonen, J.P.T. Recombination of Strain O Segments to HCpro-Encoding Sequence of Strain N of Potato Virus Y Modulates Necrosis Induced in Tobacco and in Potatoes Carrying Resistance Genes Ny or Nc. Mol. Plant Pathol. 2015, 16, 735–747. [Google Scholar] [CrossRef] [PubMed]
- Jin, H.; Liu, Y.; Yang, K.-Y.; Kim, C.Y.; Baker, B.; Zhang, S. Function of a Mitogen-Activated Protein Kinase Pathway in N Gene-Mediated Resistance in Tobacco. Plant J. 2003, 33, 719–731. [Google Scholar] [CrossRef] [PubMed]
- Komatsu, K.; Hashimoto, M.; Ozeki, J.; Yamaji, Y.; Maejima, K.; Senshu, H.; Himeno, M.; Okano, Y.; Kagiwada, S.; Namba, S. Viral-Induced Systemic Necrosis in Plants Involves Both Programmed Cell Death and the Inhibition of Viral Multiplication, Which Are Regulated by Independent Pathways. Mol. Plant Microbe Interact. 2010, 23, 283–293. [Google Scholar] [CrossRef]
- Valkonen, J.P.; Rokka, V.M.; Watanabe, K.N. Examination of the Leaf-Drop Symptom of Virus-Infected Potato Using Anther Culture-Derived Haploids. Phytopathology 1998, 88, 1073–1077. [Google Scholar] [CrossRef] [PubMed]
- Moury, B.; Caromel, B.; Johansen, E.; Simon, V.; Chauvin, L.; Jacquot, E.; Kerlan, C.; Lefebvre, V. The Helper Component Proteinase Cistron of Potato Virus Y Induces Hypersensitivity and Resistance in Potato Genotypes Carrying Dominant Resistance Genes on Chromosome IV. Mol. Plant Microbe Interact. 2011, 24, 787–797. [Google Scholar] [CrossRef]
- Plaisted, R.L.; Halseth, D.E.; Brodie, B.B.; Slack, S.A.; Sieczka, J.B.; Christ, B.J.; Paddock, K.M.; Peck, M.W. Eva:A Midseason Golden Nematode- and Virus-Resistant Variety for Use as Tablestock or Chipstock. Am. J. Pot Res. 2001, 78, 65–68. [Google Scholar] [CrossRef]
- Nazarian-Firouzabadi, F.; Visser, R.G.F. Potato Starch Synthases: Functions and Relationships. Biochem. Biophys. Rep. 2017, 10, 7–16. [Google Scholar] [CrossRef] [PubMed]
- Kumar, G.N.M.; Iyer, S.; Knowles, N.R. Extraction of RNA from Fresh, Frozen, and Lyophilized Tuber and Root Tissues. J. Agric. Food Chem. 2007, 55, 1674–1678. [Google Scholar] [CrossRef] [PubMed]
- Vasanthan, T.; Bergthaller, W.; Driedger, D.; Yeung, J.; Sporns, P. Starch from Alberta Potatoes: Wet-Isolation and Some Physicochemical Properties. Food Res. Int. 1999, 32, 355–365. [Google Scholar] [CrossRef]
- Wischmann, B.; Hamborg Nielsen, T.; Lindberg Møller, B. Wischmann, null; Hamborg Nielsen T, null; Lindberg Moller B, null In Vitro Biosynthesis of Phosphorylated Starch in Intact Potato Amyloplasts. Plant Physiol. 1999, 119, 455–462. [Google Scholar] [CrossRef] [PubMed]
- Mondal, S.; Ghanim, M.; Roberts, A.; Gray, S.M. Different Potato Virus Y Strains Frequently Co-Localize in Single Epidermal Leaf Cells and in the Aphid Stylet. J. Gen. Virol. 2021, 102, 001576. [Google Scholar] [CrossRef]
- Singh, M.; Singh, R.P. Host Dependent Cross-Protection between PVYN, PVY°, and PVA in Potato Cultivars and Solarium Brachycarpum. Can. J. Plant Pathol. 1995, 17, 82–86. [Google Scholar] [CrossRef]
- Szajko, K.; Strzelczyk-Żyta, D.; Marczewski, W. Ny-1 and Ny-2 Genes Conferring Hypersensitive Response to Potato Virus Y (PVY) in Cultivated Potatoes: Mapping and Marker-Assisted Selection Validation for PVY Resistance in Potato Breeding. Mol. Breed. 2014, 34, 267–271. [Google Scholar] [CrossRef] [PubMed]
- Syller, J. Facilitative and Antagonistic Interactions between Plant Viruses in Mixed Infections. Mol. Plant Pathol. 2012, 13, 204–216. [Google Scholar] [CrossRef] [PubMed]
- Syller, J.; Grupa, A. Antagonistic Within-Host Interactions between Plant Viruses: Molecular Basis and Impact on Viral and Host Fitness. Mol. Plant Pathol. 2016, 17, 769–782. [Google Scholar] [CrossRef] [PubMed]
- Tatineni, S.; Riethoven, J.-J.M.; Graybosch, R.A.; French, R.; Mitra, A. Dynamics of Small RNA Profiles of Virus and Host Origin in Wheat Cultivars Synergistically Infected by Wheat Streak Mosaic Virus and Triticum Mosaic Virus: Virus Infection Caused a Drastic Shift in the Endogenous Small RNA Profile. PLoS ONE 2014, 9, e111577. [Google Scholar] [CrossRef]
- Glais, L.; Faurez, F.; Tribodet, M.; Boulard, F.; Jacquot, E. The Amino Acid 419 in HC-Pro Is Involved in the Ability of PVY Isolate N605 to Induce Necrotic Symptoms on Potato Tubers. Virus Res. 2015, 208, 110–119. [Google Scholar] [CrossRef] [PubMed]
- Abrams, M. Environmental Grain, Organism Fitness, and Type Fitness. In Entangled Life; Springer: Dordrecht, The Netherlands, 2014; pp. 127–151. [Google Scholar] [CrossRef] [PubMed]
- Metcalf, C.J.E.; Birger, R.B.; Funk, S.; Kouyos, R.D.; Lloyd-Smith, J.O.; Jansen, V.a.A. Five Challenges in Evolution and Infectious Diseases. Epidemics 2015, 10, 40–44. [Google Scholar] [CrossRef] [PubMed]
- Barbour, J.D.; Grant, R.M. The Role of Viral Fitness in HIV Pathogenesis. Curr. HIV/AIDS Rep. 2005, 2, 29–34. [Google Scholar] [CrossRef] [PubMed]
- Domingo, E. Mechanisms of Viral Emergence. Vet. Res. 2010, 41, 38. [Google Scholar] [CrossRef] [PubMed]
- Wargo, A.R.; Kurath, G. Viral Fitness: Definitions, Measurement, and Current Insights. Curr. Opin. Virol. 2012, 2, 538–545. [Google Scholar] [CrossRef] [PubMed]
- Elena, S.F.; Lalić, J. Plant RNA Virus Fitness Predictability: Contribution of Genetic and Environmental Factors. Plant Pathol. 2013, 62, 10–18. [Google Scholar] [CrossRef]
- Milling, A.; Meng, F.; Denny, T.P.; Allen, C. Interactions with Hosts at Cool Temperatures, Not Cold Tolerance, Explain the Unique Epidemiology of Ralstonia Solanacearum Race 3 Biovar 2. Phytopathology 2009, 99, 1127–1134. [Google Scholar] [CrossRef]
- Fox, A.; Evans, F.; Browning, I. Direct Tuber Testing for Potato Y Potyvirus by Real-Time RT-PCR and ELISA: Reliable Options for Post-Harvest Testing?*. EPPO Bull. 2005, 35, 93–97. [Google Scholar] [CrossRef]
A/RT-PCR | |||
Target | Designation | Sequence (5’-3’) | Length (bp) |
* PVYNTN | NTN7350-F NTN8266-R | ACATCACCGATGAGCAGG GTACATACCCTCGATTAGCA | 918 |
* PVYO | O1962-F O2296-R | TCAACATTCTATCCACCAAC ACGTTTGAGTGTCATGGT | 335 |
PVYN:O | N:O1008-F N:O1703-R | GCACGTTCCAAGGTTACC TCGCTTAGCATGATATTCCCT | 695 |
** PVYN-Wi | N-Wi_YN5-1780-F N-Wi_YO3-2558-R | TCCGAATGGGACAAGAAAACTTG AGGCTCATCTAACAGCAACTGTC | 778 |
B/RT-qPCR *** | |||
Target | Designation | Sequence (5’-3’) | Length (bp) |
PVYNTN | NTNq-6515-F NTNq-6631-R | TCCGAGCTCCAGTGCAGAAT AAGTGCTGCCCGGTACATTG | 116 |
PVYO | Oq-4-F Oq-138-R | CGCAAAAACACTCATAAAAGCTCA TGGTTGGAAGTGATGAAATTGCT | 134 |
PVYN:O | NOq-6444-F NOq-6574-R | GGATATCATCCTCATCAAATGCCG TCGACGATGCATACTTCTCCTG | 130 |
PVYN-Wi | N-Wiq-35-F N-Wiq-156-R | TTCCTTGCAATTCTCTTAAACGGT ACGAACCGAAACAGATTGTTGAC | 121 |
All strains | Uni-q-9426-F Uni-q-9549-R | GTGGCAGGGTGATTTCGTCA AGAATCGCAACATCACCTAATCG | 123 |
1-alpha EF1α | EF1-F EF1-R | TGGAGGCACTCCCTGGTGACA TGTGGCAGTCGAGCACTGGT | 194 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Niraula, P.M.; Baldrich, P.; Cheema, J.A.; Cheema, H.A.; Gaiter, D.S.; Meyers, B.C.; Fondong, V.N. Antagonism and Synergism Characterize the Interactions between Four North American Potato Virus Y Strains. Int. J. Plant Biol. 2024, 15, 412-428. https://doi.org/10.3390/ijpb15020032
Niraula PM, Baldrich P, Cheema JA, Cheema HA, Gaiter DS, Meyers BC, Fondong VN. Antagonism and Synergism Characterize the Interactions between Four North American Potato Virus Y Strains. International Journal of Plant Biology. 2024; 15(2):412-428. https://doi.org/10.3390/ijpb15020032
Chicago/Turabian StyleNiraula, Prakash M., Patricia Baldrich, Junaid A. Cheema, Hashir A. Cheema, Dejah S. Gaiter, Blake C. Meyers, and Vincent N. Fondong. 2024. "Antagonism and Synergism Characterize the Interactions between Four North American Potato Virus Y Strains" International Journal of Plant Biology 15, no. 2: 412-428. https://doi.org/10.3390/ijpb15020032