Suppression of Nrf2 Activity by Chestnut Leaf Extract Increases Chemosensitivity of Breast Cancer Stem Cells to Paclitaxel
Abstract
1. Introduction
2. Materials and Methods
2.1. Preparation of Plant Extracts
2.2. Cell Culture
2.3. Fluorescence-Activated Cell Sorting (FACS)
2.4. Determination of Cytotoxicity
2.5. Cell Death Analysis
2.6. Measurement of Antioxidant Response Element (ARE) Activity
2.7. Fractionation of Nuclear and Cytoplasmic Proteins
2.8. Western Blot Analysis
2.9. Quantitative Polymerase Chain Reaction (qPCR) Analysis
2.10. Mitochondrial Membrane Potential Assay Using JC-1 Dye
2.11. Clonogenic Assay
2.12. Statistical Analysis
3. Results
3.1. CD44high/CD24low MCF-7 Cells Were More Resistant to Paclitaxel than Their Parental Cells
3.2. Chestnut Leaf Extract Suppressed ARE-Luciferase Activity
3.3. Chestnut Leaf Extract Increased Chemosensitivity of CSCs
3.4. Chestnut Leaf Extract Facilitated Paclitaxel-Induced Apoptotic Cell Death
3.5. Chestnut Leaf Extract Impeded Colony Formation of CSCs
4. Discussion and Conclusions
Supplementary Materials
Acknowledgments
Author Contributions
Conflicts of Interest
References
- Oh, J.; Hlatky, L.; Jeong, Y.S.; Kim, D. Therapeutic effectiveness of anticancer phytochemicals on cancer stem cells. Toxins 2016, 8, 199. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dick, J.E. Looking ahead in cancer stem cell research. Nat. Biotechnol. 2009, 27, 44–46. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Reya, T.; Morrison, S.J.; Clarke, M.F.; Weissman, I.L. Stem cells, cancer, and cancer stem cells. Nature 2001, 414, 105–111. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wu, T.; Harder, B.G.; Wong, P.K.; Lang, J.E.; Zhang, D.D. Oxidative stress, mammospheres and Nrf2-new implication for breast cancer therapy? Mol. Carcinog. 2015, 54, 1494–1502. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Diehn, M.; Cho, R.W.; Lobo, N.A.; Kalisky, T.; Dorie, M.J.; Kulp, A.N.; Qian, D.; Lam, J.S.; Ailles, L.E.; Wong, M.; et al. Association of reactive oxygen species levels and radioresistance in cancer stem cells. Nature 2009, 458, 780–783. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Al-Hajj, M.; Wicha, M.S.; Benito-Hernandez, A.; Morrison, S.J.; Clarke, M.F. Prospective identification of tumorigenic breast cancer cells. Proc. Natl. Acad. Sci. USA 2003, 100, 3983–3988. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Horimoto, Y.; Arakawa, A.; Sasahara, N.; Tanabe, M.; Sai, S.; Himuro, T.; Saito, M. Combination of cancer stem cell markers CD44 and CD24 is superior to ALDH1 as a prognostic indicator in breast cancer patients with distant metastases. PLoS ONE 2016, 11, e0165253. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Phillips, T.M.; McBride, W.H.; Pajonk, F. The response of CD24(-/low)/CD44+ breast cancer-initiating cells to radiation. J. Natl. Cancer Inst. 2006, 98, 1777–1785. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dai, Z.; Nair, V.; Khan, M.; Ciolino, H.P. Pomegranate extract inhibits the proliferation and viability of MMTV-Wnt-1 mouse mammary cancer stem cells in vitro. Oncol. Rep. 2010, 24, 1087–1091. [Google Scholar] [PubMed]
- Dean, M.; Fojo, T.; Bates, S. Tumour stem cells and drug resistance. Nat. Rev. Cancer 2005, 5, 275–284. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kobayashi, C.I.; Suda, T. Regulation of reactive oxygen species in stem cells and cancer stem cells. J. Cell. Physiol. 2012, 227, 421–430. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shi, X.; Zhang, Y.; Zheng, J.; Pan, J. Reactive oxygen species in cancer stem cells. Antioxid. Redox Signal. 2012, 16, 1215–1228. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ryoo, I.G.; Kim, G.; Choi, B.H.; Lee, S.H.; Kwak, M.K. Involvement of NRF2 signaling in doxorubicin resistance of cancer stem cell-enriched colonospheres. Biomol. Ther. (Seoul) 2016, 24, 482–488. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, X.J.; Sun, Z.; Villeneuve, N.F.; Zhang, S.; Zhao, F.; Li, Y.; Chen, W.; Yi, X.; Zheng, W.; Wondrak, G.T.; et al. Nrf2 enhances resistance of cancer cells to chemotherapeutic drugs, the dark side of Nrf2. Carcinogenesis 2008, 29, 1235–1243. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Menegon, S.; Columbano, A.; Giordano, S. The Dual Roles of NRF2 in Cancer. Trends Mol. Med. 2016, 22, 578–593. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ryoo, I.G.; Lee, S.H.; Kwak, M.K. Redox modulating NRF2: A potential mediator of cancer stem cell resistance. Oxid. Med. Cell. Longev. 2016, 2016, 2428153. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gorrini, C.; Harris, I.S.; Mak, T.W. Modulation of oxidative stress as an anticancer strategy. Nat. Rev. Drug Discov. 2013, 12, 931–947. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Graham, J.G.; Quinn, M.L.; Fabricant, D.S.; Farnsworth, N.R. Plants used against cancer—An extension of the work of Jonathan Hartwell. J. Ethnopharmacol. 2000, 73, 347–377. [Google Scholar] [CrossRef] [Scilit]
- Nobili, S.; Lippi, D.; Witort, E.; Donnini, M.; Bausi, L.; Mini, E.; Capaccioli, S. Natural compounds for cancer treatment and prevention. Pharmacol. Res. 2009, 59, 365–378. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Amin, A.; Gali-Muhtasib, H.; Ocker, M.; Schneider-Stock, R. Overview of major classes of plant-derived anticancer drugs. Int. J. Biomed. Sci. 2009, 5, 1–11. [Google Scholar] [PubMed]
- Carlisi, D.; Buttitta, G.; Di Fiore, R.; Scerri, C.; Drago-Ferrante, R.; Vento, R.; Tesoriere, G. Parthenolide and DMAPT exert cytotoxic effects on breast cancer stem-like cells by inducing oxidative stress, mitochondrial dysfunction and necrosis. Cell Death Dis. 2016, 7, e2194. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sun, X.; Wang, Q.; Wang, Y.; Du, L.; Xu, C.; Liu, Q. Brusatol Enhances the Radiosensitivity of A549 Cells by Promoting ROS Production and Enhancing DNA Damage. Int. J. Mol. Sci. 2016, 17, 997. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ren, D.; Villeneuve, N.F.; Jiang, T.; Wu, T.; Lau, A.; Toppin, H.A.; Zhang, D.D. Brusatol enhances the efficacy of chemotherapy by inhibiting the Nrf2-mediated defense mechanism. Proc. Natl. Acad. Sci. USA 2011, 108, 1433–1438. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yu, F.; Li, J.; Chen, H.; Fu, J.; Ray, S.; Huang, S.; Zheng, H.; Ai, W. Kruppel-like factor 4 (KLF4) is required for maintenance of breast cancer stem cells and for cell migration and invasion. Oncogene 2011, 30, 2161–2172. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Oh, J.; Jeon, S.B.; Lee, Y.; Lee, H.; Kim, J.; Kwon, B.R.; Yu, K.Y.; Cha, J.D.; Hwang, S.M.; Choi, K.M.; et al. Fermented red ginseng extract inhibits cancer cell proliferation and viability. J. Med. Food 2015, 18, 421–428. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kim, B.R.; Hu, R.; Keum, Y.S.; Hebbar, V.; Shen, G.; Nair, S.S.; Kong, A.N. Effects of glutathione on antioxidant response element-mediated gene expression and apoptosis elicited by sulforaphane. Cancer Res. 2003, 63, 7520–7525. [Google Scholar] [PubMed]
- Keum, Y.S.; Yu, S.W.; Chang, P.P.J.; Yuan, X.L.; Kim, J.H.; Xu, C.J.; Han, J.H.; Agarwal, A.; Kong, A.N.T. Mechanism of action of sulforaphane: Inhibition of p38 mitogen-activated protein kinase isoforms contributing to the induction of antioxidant response element-mediated heme oxygenase-1 in human hepatoma HepG2 cells. Cancer Res. 2006, 66, 8804–8813. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dinkova-Kostova, A.T.; Holtzclaw, W.D.; Cole, R.N.; Itoh, K.; Wakabayashi, N.; Katoh, Y.; Yamamoto, M.; Talalay, P. Direct evidence that sulfhydryl groups of Keap1 are the sensors regulating induction of phase 2 enzymes that protect against carcinogens and oxidants. Proc. Natl. Acad. Sci. USA 2002, 99, 11908–11913. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mani, S.A.; Guo, W.; Liao, M.J.; Eaton, E.N.; Ayyanan, A.; Zhou, A.Y.; Brooks, M.; Reinhard, F.; Zhang, C.C.; Shipitsin, M.; et al. The epithelial-mesenchymal transition generates cells with properties of stem cells. Cell 2008, 133, 704–715. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tang, S.N.; Singh, C.; Nall, D.; Meeker, D.; Shankar, S.; Srivastava, R.K. The dietary bioflavonoid quercetin synergizes with epigallocathechin gallate (EGCG) to inhibit prostate cancer stem cell characteristics, invasion, migration and epithelial-mesenchymal transition. J. Mol. Signal. 2010, 5, 14. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhou, W.; Kallifatidis, G.; Baumann, B.; Rausch, V.; Mattern, J.; Gladkich, J.; Giese, N.; Moldenhauer, G.; Wirth, T.; Buchler, M.W.; et al. Dietary polyphenol quercetin targets pancreatic cancer stem cells. Int. J. Oncol. 2010, 37, 551–561. [Google Scholar] [PubMed]
- Gupta, P.B.; Chaffer, C.L.; Weinberg, R.A. Cancer stem cells: Mirage or reality? Nat. Med. 2009, 15, 1010–1012. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Marjanovic, N.D.; Weinberg, R.A.; Chaffer, C.L. Cell plasticity and heterogeneity in cancer. Clin. Chem. 2013, 59, 168–179. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Achuthan, S.; Santhoshkumar, T.R.; Prabhakar, J.; Nair, S.A.; Pillai, M.R. Drug-induced senescence generates chemoresistant stemlike cells with low reactive oxygen species. J. Biol. Chem. 2011, 286, 37813–37829. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ding, S.; Li, C.; Cheng, N.; Cui, X.; Xu, X.; Zhou, G. Redox Regulation in Cancer Stem Cells. Oxid. Med. Cell. Longev. 2015, 2015, 750798. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gao, A.M.; Ke, Z.P.; Wang, J.N.; Yang, J.Y.; Chen, S.Y.; Chen, H. Apigenin sensitizes doxorubicin-resistant hepatocellular carcinoma BEL-7402/ADM cells to doxorubicin via inhibiting PI3K/Akt/Nrf2 pathway. Carcinogenesis 2013, 34, 1806–1814. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tang, X.; Wang, H.; Fan, L.; Wu, X.; Xin, A.; Ren, H.; Wang, X.J. Luteolin inhibits Nrf2 leading to negative regulation of the Nrf2/ARE pathway and sensitization of human lung carcinoma A549 cells to therapeutic drugs. Free Radic. Biol. Med. 2011, 50, 1599–1609. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Arlt, A.; Sebens, S.; Krebs, S.; Geismann, C.; Grossmann, M.; Kruse, M.L.; Schreiber, S.; Schafer, H. Inhibition of the Nrf2 transcription factor by the alkaloid trigonelline renders pancreatic cancer cells more susceptible to apoptosis through decreased proteasomal gene expression and proteasome activity. Oncogene 2013, 32, 4825–4835. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kumar, H.; Kim, I.S.; More, S.V.; Kim, B.W.; Choi, D.K. Natural product-derived pharmacological modulators of Nrf2/ARE pathway for chronic diseases. Nat. Prod. Rep. 2014, 31, 109–139. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Harder, B.; Tian, W.; La Clair, J.J.; Tan, A.C.; Ooi, A.; Chapman, E.; Zhang, D.D. Brusatol overcomes chemoresistance through inhibition of protein translation. Mol. Carcinog. 2017, 56, 1493–1500. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rigling, D.; Prospero, S. Cryphonectria parasitica, the causal agent of chestnut blight: Invasion history, population biology and disease control. Mol. Plant Pathol. 2017. [CrossRef] [Scilit] [PubMed]
- Lee, H.S.; Kim, E.J.; Kim, S.H. Chestnut extract induces apoptosis in AGS human gastric cancer cells. Nutr. Res. Pract. 2011, 5, 185–191. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jung, B.S.; Lee, N.K.; Na, D.S.; Yu, H.H.; Paik, H.D. Comparative analysis of the antioxidant and anticancer activities of chestnut inner shell extracts prepared with various solvents. J. Sci. Food Agric. 2016, 96, 2097–2102. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Youn, U.Y.; Shon, M.S.; Kim, G.N.; Katagiri, R.; Harata, K.; Ishida, Y.; Lee, S.C. Antioxidant and anti-adipogenic activities of chestnut (Castanea crenata) byproducts. Food Sci. Biotechnol. 2016, 25, 1169–1174. [Google Scholar] [CrossRef] [Scilit]
- Kim, J.Y.; Kim, S.Y.; Kwon, H.M.; Kim, C.H.; Lee, S.J.; Park, S.C.; Kim, K.H. Comparison of Antioxidant and Anti-Inflammatory Activity on Chestnut, Chestnut Shell and Leaves of Castanea crenata Extracts. Korean J. Med. Crop Sci. 2014, 22, 8–16. [Google Scholar] [CrossRef] [Scilit]
- Calliste, C.A.; Trouillas, P.; Allais, D.P.; Duroux, J.L. Castanea sativa Mill. leaves as new sources of natural antioxidant: An electronic spin resonance study. J. Agric. Food Chem. 2005, 53, 282–288. [Google Scholar] [PubMed]
- Barreira, J.C.M.; Ferreira, I.C.F.R.; Oliveira, M.B.P.P.; Pereira, J.A. Antioxidant activities of the extracts from chestnut flower, leaf, skins and fruit. Food Chem. 2008, 107, 1106–1113. [Google Scholar] [CrossRef] [Scilit]
- Quave, C.L.; Lyles, J.T.; Kavanaugh, J.S.; Nelson, K.; Parlet, C.P.; Crosby, H.A.; Heilmann, K.P.; Horswill, A.R. Castanea sativa (European Chestnut) Leaf Extracts Rich in Ursene and Oleanene Derivatives Block Staphylococcus aureus Virulence and Pathogenesis without Detectable Resistance. PLoS ONE 2015, 10, e0136486. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Calabria, L.M.; Piacente, S.; Kapusta, I.; Dharmawardhane, S.F.; Segarra, F.M.; Pessiki, P.J.; Mabry, T.J. Triterpene saponins from Silphium radula. Phytochemistry 2008, 69, 961–972. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Alexandre, J.; Batteux, F.; Nicco, C.; Chereau, C.; Laurent, A.; Guillevin, L.; Weill, B.; Goldwasser, F. Accumulation of hydrogen peroxide is an early and crucial step for paclitaxel-induced cancer cell death both in vitro and in vivo. Int. J. Cancer 2006, 119, 41–48. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Weaver, B.A. How Taxol/paclitaxel kills cancer cells. Mol. Biol. Cell 2014, 25, 2677–2681. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ramanathan, B.; Jan, K.Y.; Chen, C.H.; Hour, T.C.; Yu, H.J.; Pu, Y.S. Resistance to paclitaxel is proportional to cellular total antioxidant capacity. Cancer Res. 2005, 65, 8455–8460. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Scarpa, E.S.; Ninfali, P. Phytochemicals as innovative therapeutic tools against cancer stem cells. Int. J. Mol. Sci. 2015, 16, 15727–15742. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sparreboom, A.; Cox, M.C.; Acharya, M.R.; Figg, W.D. Herbal remedies in the United States: Potential adverse interactions with anticancer agents. J. Clin. Oncol. 2004, 22, 2489–2503. [Google Scholar] [CrossRef] [Scilit] [PubMed]









| Gene (NCBI Accession No.) | Primer (5′→3′) | Product Length (bp) | |
|---|---|---|---|
| Forward | Reverse | ||
| Nrf2 (NM_006164) | CATCCAGTCAGAAACCAGTGG | GCAGTCATCAAAGTACAAAGCAT | 85 |
| Keap1 (NM_012289) | CAGATTGGCTGTGTGGAGTT | GCTGTTCGCAGTCGTACTTG | 202 |
| HO-1 (NM_002133) | TCCTGGCTCAGCCTCAAATG | CGTTAAACACCTCCCTCCCC | 107 |
| GAPDH (NM_001289746) | ACCCACTCCTCCACCTTTGA | CTGTTGCTGTAGCCAAATTCGT | 101 |
© 2017 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Woo, Y.; Oh, J.; Kim, J.-S. Suppression of Nrf2 Activity by Chestnut Leaf Extract Increases Chemosensitivity of Breast Cancer Stem Cells to Paclitaxel. Nutrients 2017, 9, 760. https://doi.org/10.3390/nu9070760
Woo Y, Oh J, Kim J-S. Suppression of Nrf2 Activity by Chestnut Leaf Extract Increases Chemosensitivity of Breast Cancer Stem Cells to Paclitaxel. Nutrients. 2017; 9(7):760. https://doi.org/10.3390/nu9070760
Chicago/Turabian StyleWoo, Yaejin, Jisun Oh, and Jong-Sang Kim. 2017. "Suppression of Nrf2 Activity by Chestnut Leaf Extract Increases Chemosensitivity of Breast Cancer Stem Cells to Paclitaxel" Nutrients 9, no. 7: 760. https://doi.org/10.3390/nu9070760
APA StyleWoo, Y., Oh, J., & Kim, J.-S. (2017). Suppression of Nrf2 Activity by Chestnut Leaf Extract Increases Chemosensitivity of Breast Cancer Stem Cells to Paclitaxel. Nutrients, 9(7), 760. https://doi.org/10.3390/nu9070760

