Next Article in Journal
Tolerance and Excretion of the Mycotoxins Aflatoxin B1, Zearalenone, Deoxynivalenol, and Ochratoxin A by Alphitobius diaperinus and Hermetia illucens from Contaminated Substrates
Previous Article in Journal
Biocontrol of Fusarium graminearum sensu stricto, Reduction of Deoxynivalenol Accumulation and Phytohormone Induction by Two Selected Antagonists
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

The Major Fusarium Species Causing Maize Ear and Kernel Rot and Their Toxigenicity in Chongqing, China

1
Institute of Crop Sciences, Chinese Academy of Agricultural Sciences/National Key Facility for Crop Gene Resources and Genetic Improvement, Beijing 100081, China
2
College of Plant Protection, Southwest University, Chongqing 400715, China
*
Author to whom correspondence should be addressed.
Toxins 2018, 10(2), 90; https://doi.org/10.3390/toxins10020090
Submission received: 22 January 2018 / Revised: 10 February 2018 / Accepted: 16 February 2018 / Published: 22 February 2018
(This article belongs to the Section Mycotoxins)

Abstract

Fusarium verticillioides, F. proliferatum, and F. meridionale were identified as the predominant fungi among 116 Fusarium isolates causing maize ear and kernel rot, a destructive disease in Chongqing areas, China. The toxigenic capability and genotype were determined by molecular amplification and toxin assay. The results showed that the key toxigenic gene FUM1 was detected in 47 F. verticillioides and 19 F. proliferatum isolates. Among these, F. verticillioides and F. proliferatum isolates mainly produced fumonisin B1, ranging from 3.17 to 1566.44, and 97.74 to 11,100.99 µg/g for each gram of dry hyphal weight, with the averages of 263.94 and 3632.88 µg/g, respectively, indicating the F. proliferatum isolates on average produced about an order of magnitude more fumonisins than F. verticillioides did in these areas, in vitro. Only NIV genotype was detected among 16 F. meridionale and three F. asiaticum isolates. Among these, 11 F. meridionale isolates produced NIV, varying from 17.40 to 2597.34 µg/g. ZEA and DON toxins were detected in 11 and 4 F. meridionale isolates, with the toxin production range of 8.35–78.57 and 3.38–33.41 µg/g, respectively. Three F. asiaticum isolates produced almost no mycotoxins, except that one isolate produced a small amount of DON. The findings provide us with insight into the risk of the main pathogenic Fusarium species and a guide for resistance breeding in these areas.
Key Contribution: The composition and distribution of Fusarium spp. causing maize ear and kernel rot were clarified in Chongqing areas. The toxigenicity of the major pathogenic Fusarium species was determined.

Graphical Abstract

1. Introduction

Fusarium species are the main pathogenic fungi causing maize ear and kernel rot worldwide, including F. verticillioides, F. graminearum species complex (FGSC), F. oxysporum, F. equiseti, F. subglutinans [1,2,3,4]. These pathogens not only cause grain rot, but also produce a variety of mycotoxins that are a direct threat to human and animal health [5,6]. Studies have shown that F. verticillioides and F. proliferatum mainly produce fumonisin B (FB) that contaminate grains and grain products, whereas members of the FGSC mainly produce trichothecene toxins that contaminate grains. These mycotoxins act as phytotoxins and virulence factors, interact with their hosts [7].
F. verticillioides and F. proliferatum can produce a variety of secondary metabolites, such as fumonisins and moniliformin in maize-based products [8]. In Fusarium-infected maize tissues, FB1 predominates, accounting for 75% of the total FB content [9]. Fumonisins have been associated with equine leukoencephalomalacia [10], human esophageal cancer [11], and neural tube defects in newborns [12]. There are several reports on FB contamination in maize in various areas of China. Fu et al. reported that 50% of the maize grains in Hebei, Inner Mongolia, Yunnan, Guizhou, Heilongjiang, Liaoning, and Ningxia provinces were contaminated by FBs [13]. Li et al. analyzed 125 maize samples from Hebei province between 2011 and 2013, of which 46.4% of the samples were contaminated, and the mean contamination levels of FB of the maize samples collected in 2013 reached 706 µg kg−1 [14]. FB accumulation in grains is associated with a number of factors, such as toxin production capability of strains [15], host species [16], types of crops [17], and various environmental factors [18].
Currently, 16 phylogenetically distinct species have been identified in the FGSC. The most predominant species associated with small grains diseases are F. graminearum sensu stricto, F. meridionale, F. asiaticum, and F. boothii [19,20,21]. The members of FGSC can produce deoxynivalenol (DON), nivalenol (NIV), and other toxins [22]. Based on trichothecene profiles and Tri13 gene, the FGSC can be divided into three different genotypes: NIV genotype, 3-ADON genotype, and 15-ADON genotype [23]. Previous studies have shown that F. graminearum sensu stricto generally belongs to the 15-ADON or 3-ADON genotype [24,25], most of F. asiaticum strains belong to the NIV genotype [26] or 3-ADON chemotype [27,28], and the majority of F. meridionale strains are of the NIV genotype [29,30,31], but a few belong to 15-ADON or 15-ADON+NIV [32].
The high incidence of maize ear and kernel rot in Chongqing and surrounding areas is mainly due to its special geographical and climatic conditions, as well as cropping systems and resistance level of the major maize cultivars. The incidence of the maize ear and kernel rot is 20–40%, even reaching as high as 75%, which significantly decreases thousand-kernel weight. More seriously, mycotoxin contamination of the affected maize kernels is severe. Up to now, no systematic studies on pathogenic Fusarium toxins causing maize ear rot in these areas have been conducted. This study aimed to clarify the composition and distribution of Fusarium spp. causing maize kernel rot in Chongqing and surrounding areas, as well as the toxigenic chemotypes and their potentiality and capability. The results will provide effective information on the toxigenic genotype and toxin production capacity of major pathogenic Fusarium spp. causing maize kernel rot in the Chongqing and surrounding areas, as well as provide an early warning mechanism for regional maize production.

2. Results

2.1. Identification of Fusarium spp.

Based on morphological and molecular findings, a total of 116 Fusarium isolates and 10 Fusarium species were obtained and identified, including F. verticillioides, F. proliferatum, FGSC, F. oxysporum, F. fujikuroi, F. equiseti, F. culmorum, F. incarnatum, F. kyushuense, and F. solani, with the isolation frequencies of 40.2% (47), 16.4% (19), 16.4% (19), 12.1% (14), 6.9% (8), 3.4% (4), 1.7% (2), 0.9% (1), 0.9% (1), and 0.9% (1), respectively (Table 1 and Figure 1).
There were a few differences in the frequency of Fusarium isolates in different regions of Chongqing (Table 2). In Southeast Chongqing, the frequency of F. verticillioides, F. proliferatum, FGSC, and F. oxysporum was 42.86%, 10.07%, 14.29%, and 25.00%, respectively. Therefore, F. verticillioides and F. oxysporum were the predominant Fusarium species in Southeast Chongqing. However, F. oxysporum were not be found in West Chongqing. The conclusion should not be drawn for the Central Chongqing and the other regions, due to the smaller sample size.
Analysis of the sequences of the TEF-1α gene of 19 FGSC isolates and alignment with BLAST in the Fusarium Center’s database indicated that 19 FGSC isolates contained 16 F. meridionale and 3 F. asiaticum, with the total isolation frequencies of 15.5% and 2.9%. A total of 16 isolates, such as D38, D46 and others, exhibited 99% to 100% homology with reference strain B2307 (F. meridionale), while CP5, D57-2 and D99 showed 99% to 100% homology with reference strains HNZZ106 and HBTS484 (F. asiaticum). The tree topologies of the TEF-1α gene sequences showed that the classification divided FGSC into two distinct clades, with high clade support values (Figure 2).

2.2. Detection of Toxigenic Genes and Chemotypes

Using the specific primers, the FUM1 gene was detected in 47 F. verticillioides and 19 F. proliferatum isolates (Figure 3 and Figure 4). The results showed that these isolates theoretically possessed the capacity to synthesize FBs.
The Tri13 gene-specific primer Tri13P1/Tri13P2 was used to conduct the PCR amplification of 19 members of the FGSC in Figure 5. A single 859 bp fragment was stably amplified in 16 F. meridionale isolates and three F. asiaticum isolates, indicating that all 19 members of the FGSC were of the NIV chemotype.

2.3. Analysis of FBs

Mycotoxin assays showed that all F. verticillioides and F. proliferatum isolates could produce toxins FB1, FB2, and FB3. Except for F. verticillioides isolates D61-1 and D63, the other isolates exhibited a significantly higher FB1 yield than that of FB2 and FB3 (Table 3 and Table 4). In the F. verticillioides isolates, FB production (all toxin production expressed in micrograms per gram of mycelial dry weight in this paper) was 5.76–2015.19 µg/g, with an average of 344.81 µg/g. Among these, the production of toxin FB1 ranged from 3.17 to 1566.44 µg/g, with an average of 263.94 µg/g; the production of FB2 toxin was between 1.07 and 156.52 µg/g, with an average of 24.70 µg/g; and the production of FB3 toxin varied from 1.52 to 356.15 µg/g, with an average of 56.17 µg/g (Table 3).
Among the F. proliferatum isolates, the production of FB1, FB2, and FB3 was within the ranges of 97.74–11,100.99 µg/g, 16.01–1554.83 µg/g, and 9.11–381.4 µg/g, with the corresponding averages of 3632.88, 402.31, and 177.78 µg/g, respectively (Table 4).
Table 3 and Table 4 showed the significant differences in FB production among various isolates. For the F. verticillioides isolates, 42.6% of the isolates had <100.00 µg/g toxin production, whereas 68.4% of the F. proliferatum isolates exhibited >1000.00 µg/g toxin production, indicating that the toxigenicity of F. proliferatum in these areas was higher than that of F. verticillioides (Table 5).

2.4. Determination of the Toxigenicity of FGSC

The DON, ZEN, and NIV assay based on UHPLC-MS/MS were in agreement with the molecular detection of the Tri13 gene in members of the FGSC. The toxin assay showed that none of the three F. asiaticum strains produced the toxins NIV and ZEN, but only the CP5 isolate produced DON with 4.50 µg/g of dry hyphal weight, suggesting that the F. asiaticum produces almost no mycotoxins in Chongqing (Table 6).
NIV was detected in 11 out of the 16 F. meridionale isolates, which showed a mycotoxin-producing range of 17.40–2597.34 µg/g of dry hyphal weight. ZEN was detected in 11 isolates, and toxin production ranged from 8.35 to 78.57 µg/g. DON was detected in four isolates, i.e., CP1, CP4, D14, and D46, with the toxin production range of 3.38–33.41 µg/g. Isolates D38, D58-2, and D85-1 expressed 3-AcDON toxin, with the corresponding productions of 7.81, 5.83, and 3.10 µg/g, respectively. 15-AcDON was only detected in D38 isolate, with toxin production of 7.90 µg/g. The results show that F. meridionale mainly produces NIV, but weakly does ZEN, DON, 3-AcDON or 15-AcDON.

3. Discussion

Maize is an important food crop in China, and it is also a significant energy crop and industrial material. Numerous studies have shown that in most countries and regions, Fusarium spp. are the main causative pathogens for maize kernel rot. F. verticillioides and F. graminearum sensu stricto are the predominant species in Huang-Huai-Hai and northeast China [2,33]. However, our study indicated that besides F. verticillioides, F. proliferatum, and F. meridionale were also the predominant pathogens that caused maize ear rot in Chongqing areas, indicating the characteristic composition of pathogenic Fusarium species causing maize ear rot in these areas. These discrepancies may be caused by particular environmental conditions. Chongqing is located in the southwest maize growing area of China, and the area is hilly and mountainous, with the highest elevation reaching up to 2800 m. Different ecological zones are present, thereby forming the unique pathogen community.
The warm, rainy, and humid weather conditions are suitable for infection, growth, and reproduction of Fusarium spp. in these areas. It is an important factor contributing to the serious maize ear rot. Besides, cropping system is probably also a major factor. In Chongqing areas, crop planting patterns usually incude corn monoculture, wheat and corn rotation, and rice and corn rotation, and so on. Undoubtedly, inoculum production increases with corn monoculture. In addition, F. verticillioides, F. proliferatum, FGSC, and F. oxysporum are also important pathogenic fungi in wheat and rice. Therefore, corn rotation with wheat or rice hardly reduces the prevalence of these fungi, even leading to the accumulation of the above Fusarium species in these areas.
FBs, DON, NIV, ZEA, and other mycotoxins are the major causes of toxin contamination by Fusarium species. However, both F. verticillioides and F. proliferatum produce FBs, the former can cause FB contamination mainly in maize, whereas the latter can cause toxin contamination in a variety of crops. Mycotoxin assays showed that all F. proliferatum and F. verticillioides isolates could produce toxins the FB1, FB2, and FB3, with FB1 as the predominant mycotoxin. However, the average toxin production of F. proliferatum isolates was 12.22-fold higher than that of F. verticillioides, and hence, potential contamination with F. proliferatum should always be fully considered. In the present study, PDB liquid medium was used in culturing the Fusarium strains, and whether the toxin production of F. proliferatum was the highest in vivo will be investigated in our future study. In the field or in storage, mycotoxin contamination from maize ears and kernels is heavily influenced by multiple factors, such as pathogens, environmental conditions (temperature, humidity, pH, and lighting), host resistance, and so on. Therefore, mycotoxin production from these isolates in the laboratory primarily represents their toxigenic potential.
In this study, the results of the Tri13P1/Tri13P2 specific primer assay and toxin detection indicated that 16 F. meridionale and 3 F. asiaticum isolates were of the NIV chemotype, thereby representing geographical characteristics. Kuppler et al. reported that among 63 FGSC strains from Germany, only two belonged to NIV type, and the remaining were of the DON type [34]. In France, only 14.6% of the members of the FGSC were of the NIV type, and the remaining 85.4% belonged to the 15-ADON type [35]. In Brazil, among the 92 strains of the FGSC isolated from barley, 61 (66.3%), 4 (4.4%) and 27 (29.3%) belonged to 15-ADON, 3-ADON, and NIV chemotype, respectively [31].
In China, studies on the population structure and toxigenicity of the FGSC have mostly focused on wheat and rice, whereas studies on maize are very limited. Shen et al. found that among 530 FGSC strains isolated from the main winter wheat-producing areas of China, 182 F. graminearum sensu stricto strains were mainly distributed in North China, and 348 F. asiaticum strains were mainly distributed in South China. Among these, a high isolation frequency of the 15-ADON strains was observed in North China, and the NIV and 3-ADON strains were more common in South China [28]. Similar studies also have proven that the NIV and 3-ADON strains are mostly distributed in warmer regions [36,37]. Our findings that FGSC isolates causing maize ear rot in Chongqing areas were of the NIV genotype also support the above conclusions.
Studies have shown that various mycotoxins have different toxicological properties. Compared to the toxin DON, NIV poses a more serious threat to humans and animals health, which requires a more stringent limit of daily intake [38,39]. NIV was detected in 57.9% of the FGSC, and three isolates had a relatively high NIV-producing capacity (>1000 µg/g of dry hyphal weight) were F. meridionale. Compared to NIV, these isolates produced a small amount of ZEA and DON toxins. These findings indicate that NIV is likely to be the predominant trichothecene contaminant in Chongqing areas.
In the present study, we found that several F. meridionale isolates, such as D58-2, D66, D73, D85-1, and D91-2, and F. asiaticum strains D99, CP5, and D57-2 harbored the gene responsible for NIV-production but did not secrete NIV toxin. These phenotypes could be explained by a mutation in the NIV producing gene sequences, or by altered expression of the NIV producing genes. Also, the amount of NIV toxin produced by these isolates is probably beyond the detection limit of our assays. In addition, the lack of NIV in these isolates may also be due to the growth medium used.
Based on our study, various Fusarium species show distinct differences in their toxigenicity. Therefore, in Chongqing areas, the potential maize food and feed safety threat caused by F. proliferatum and F. meridionale is probably more serious than that by F. verticillioides, and F. asiaticum, respectively. However, maize germplasm and varieties are usually merely screened for resistance to ear rot caused by F. verticillioides and F. graminearum sensu stricto in China. Therefore, the risk of growing the selected “resistant” varieties remains. Although F. proliferatum is not the firstly major causal pathogen of ear and kernel rot, this species should also be included in germplasm screening for resistance and crop breeding for disease resistance, particularly in Chongqing areas. Also, maize ear and kernel rot caused by F. meridionale deserves attention. The maize germplasm resistant to F. meridionale should be selected for cultivation in these areas. In addition, F. proliferatum contamination may be utilized as an important indicator of the quality and safety of grains produced in these particular areas.

4. Materials and Methods

4.1. Sample Collection and Isolation and Identification of Pathogenic Fungi

A total of 103 maize ear or kernel samples (five symptomatic maize ears or 500 g of kernels for each sample) were collected from production fields at harvest in 103 towns of 34 counties in Chongqing and surrounding areas in 2014 and 2015 (Figure 6 and Table S1). About 30 seeds collected from each sample were soaked in 20% sodium hypochlorite solution for 3 min, and rinsed with sterile water thrice. These seeds were dried with sterile filter paper and placed on a potato dextrose agar (PDA) (potato infusion 200 g, dextrose 20 g, agar 20 g, distilled water 1000 mL) plate for culture for 3 days at 25 °C. Hyphae from typical Fusarium colonies on PDA were transferred to a fresh poor-nutrient potato dextrose agar (half-PDA) (potato infusion 100 g, dextrose 20 g, agar 20 g, distilled water 1000 mL) plate and the culture was grown for 5 to 7 days. Upon emergence of conidia, a single spore was isolated on PDA by the plate dilution method. Finally, the single spore was transplanted onto a PDA plate to culture single-spore isolates.

4.2. Identification of Pathogenic Fungi

The morphological identification of fungal cultures was conducted based on general characteristics and conidial morphology [40]. In order to confirm the morphological identification, genomic DNA was extracted from collected aerial mycelia using the Rapid Fungi Genomic DNA Isolation Kit (SK8230, Sangon Biotech, Shanghai, China) according to the manufacturer’s instruction and were validated by species-specific polymerase chain reaction (PCR) for identification (Table 7).
Each PCR reaction system (20 µL) consisted of a DNA template (2.0 µL), upstream and downstream primers (1.0 µL each), 2× Taq PCR Master Mix (10.0 µL), and ddH2O (6.0 µL).
Reactions were performed using a GeneAmp PCR System 9700 thermal cycler (ABI, Norwalk, CT, USA) programmed for 94 °C for 5 min; followed by 35 cycles of 95 °C for 50 s, 58–60 °C for 50 s, and 72 °C for 60 s; and a final extension at 72 °C for 10 min. Electrophoretic analysis of the PCR-amplified products was performed on a 1% agarose gel.
The other Fusarium species that could not be determined by species-specific PCR were analyzed using the translation elongation factor (TEF)-1α gene sequences. TEF-F/R: 5′-ATGGGTAAGGARGACAAGAC-3′/5′-GGARGTACCAGTSATCATGTT-3′ [45]. Each PCR reaction system (50.0 µL) consisted of a DNA template (5.0 µL), upstream and downstream primers (2.5 µL each), 2× Taq PCR Master Mix (25.0 µL), and ddH2O (15.0 µL). Reactions were performed using a GeneAmp PCR System 9700 thermal cycler programmed for 94 °C for 5 min; followed by 35 cycles of 95 °C 50 s, 53 °C for 50 s, and 72 °C 60 s; and a final extension at 72 °C for 10 min. The amplified PCR products were bi-directionally sequenced by Sangon Biotech, and the sequences were compared with Fusarium sequences in the Fusarium Center’s database at Penn State. Using MEGA 5.0 software (ASU, Phoenix, AZ, USA, 2011), a phylogenetic tree was constructed via Test Maximum Likelihood Tree clustering method based on the TEF-1α gene sequences, and the bootstrap analysis was performed with 1000 replicates for statistical support of branches.

4.3. Molecular Identification of Toxigenic Genes

The detection of the FUM1 gene was conducted using the specific primers: Fum5F/Fum5R (Fum5F: 5′-GTCGAGTTGTTGACCACTGCG-3′ and Fum5R: 5′-CGTATCGTCAGCATGATGTAGC-3′) for F. verticillioides isolates and Rp32/Rp33 (Rp32: 5′-ACAAGTGTCCTTGGGGTCCAGG-3′ and Rp33: 5′-GATGCTCTTGGAAGTGGCCTACG-3′) for all F. verticillioides and F. proliferatum strains, with an annealing temperature of 60 °C [41,46]. The size of amplified fragments was 890 and 680 bp, respectively. The molecular detection of the toxigenic chemotypes of the FGSC was conducted using specific primers, Tri13P1/Tri13P2 (Tri13P1: 5′-CTCSACCGCATCGAAGASTCTC-3′ and Tri13P2: 5′-GAASGTCGCARGACCTTGTTTC-3′), at an annealing temperature of 58 °C [47]. The sizes of amplified fragments of the NIV, 3-AcDON, and 15-AcDON strains were 859, 644, and 583 bp, respectively. PCR reaction system was earlier described. Electrophoretic analysis of the PCR-amplified products was performed on a 1% agarose gel.

4.4. Detection of Mycotoxin Production

Equivalent Fusarium spp. were cut from half-PDA and placed in a sterilized conical flask containing 150 mL of potato dextrose broth (PDB). Each fungal isolate was cultured in triplicate, and the sterile liquid medium with no inoculant was used as control. F. verticillioides and F. proliferatum were grown in a 15 day static culture in PDB with pH 8.0 at 25 °C, and FGSC was grown in a 15 day shaking culture (100g) in PDB with pH 3.0 at 25 °C [32]. The inoculated culture medium was filtered with a Whatman GF/A glass fiber filter paper, the filtrate was then stored at −80 °C or sterilized under high pressure, and the hyphae were collected, dried, and weighed.
For all Fusarium isolates, 20 mL of the filtrate was collected and used in the toxin assays. Immunoaffinity column purification and HPLC analysis of F. verticillioides and F. proliferatum were performed to measure FB production [48]. The eluent was dried with nitrogen and dissolved in 1.5 mL of 80% methanol solution. FBs were tested using a C18 reverse-phase liquid chromatography/fluorescence detector after O-phthaldialdehyde (OPA) derivation and quantified via an external standard method. DON, ZEN, and NIV production of FGSC was determined using UHPLC-MS/MS [49]. Samples were extracted with an 80% acetonitrile water solution, purified via a multifunction decontamination column, isolated via a Waters ACQUITY UPLC BEH C18 chromatographic column, tested by multireaction ion monitoring of quadrupole mass spectrometry, and quantified by an external standard method. Statistical analysis was performed with SPSS 10.0 software (SPSS Inc., Chicago, IL, USA, 2007).

Supplementary Materials

The following are available online at https://www.mdpi.com/2072-6651/10/2/90/s1, Table S1: Sampling information.

Acknowledgments

This project was supported by the National Key Research and Development Program of China (2016YFD0100103) and the Modern Agro-industry Technology Research System (CARS-02) of the Ministry of Agriculture of China.

Author Contributions

Canxing Duan, Xiaoming Wang and Danni Zhou conceived and designed the experiments; Danni Zhou and Yang Yang performed the experiments; Canxing Duan, Danni Zhou and Xiaoming Wang analyzed the data; Guokang Chen, Suli Sun and Zhendong Zhu contributed reagents/materials/analysis tools; Danni Zhou and Canxing Duan wrote and revised the paper.

Conflicts of Interest

The authors declare no conflict of interest.

Abbreviations

The following abbreviations are used in this manuscript:
3-ADON3-acetyl-deoxynivalenol
15-ADON15-deoxynivalenol
DONdeoxynivalenol
FBfumonisin B
HPLChigh performance liquid chromatography
NIVnivalenol
OPAO-phthaldialdehyde
PCRpolymerase chain reactions
PDApotato dextrose agar
PDBpotato dextrose broth
SNASpezieller Nährstoffarmer agar
TEFtranslation elongation factor
UHPLC-MS/MSultra-high performance liquid chromatography-mass spectrometry
ZENzearalenone

References

  1. Andreas, G.; Erich-Christian, O.; Ulrike, S.; Cees, W.; Ineke, V.; Heinz-Wilhelm, D. Biodiversity of Fusarium species causing ear rot of maize in Germany. Cereal Res. Commun. 2008, 36, 617–622. [Google Scholar]
  2. Qin, Z.H.; Ren, X.; Jiang, K.; Wu, X.F.; Yang, Z.H.; Wang, X.M. Identification of Fusarium species and F. graminearum species complex causing maize ear rot in China. Acta Phytophysiol. Sin. 2014, 41, 589–596. [Google Scholar]
  3. Ammar, M.; Merfat, A.; Walid, N.; Paul, H.V.; Mohammad, H. Morphological and Molecular Characterization of Fusarium isolated from maize in Syria. J. Phytopathol. 2013, 161, 452–458. [Google Scholar]
  4. Rahjoo, V.; Zad, J.; Javan-Nikkhah, A.; Mirzadi, G.A.; Okhovvat, S.M.; Bihamta, M.R.; Razzaghian, J.; Klemsdal, S.S. Morphological and molecular identification of Fusarium isolated from maize ears in Iran. J. Plant Pathol. 2008, 90, 463–468. [Google Scholar]
  5. Mukanga, M.; Derera, J.; Tongoona, P.; Laing, M.D. A survey of pre-harvest ear rot diseases of maize and associated mycotoxins in south and central Zambia. Int. J. Food Microbiol. 2010, 141, 213–221. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  6. Strange, R.N.; Scott, P.R. Plant disease: A threat to global food security. Phytopathology 2005, 43, 83–116. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  7. Sánchez-Rangel, D.; Plasencia, J. The role of sphinganine analog mycotoxins on the virulence of plant pathogenic fungi. Toxin Rev. 2010, 29, 73–86. [Google Scholar] [CrossRef] [Scilit]
  8. Bottalico, A. Fusarium diseases of cereals: Species complex and related mycotoxin profiles, in Europe. J. Plant Pathol. 1998, 80, 85–103. [Google Scholar]
  9. Proctor, R.H.; Plattner, R.D.; Desjardins, A.E.; Busman, M.; Butchko, R.A. Fumonisin production in the maize pathogen Fusarium verticillioides: genetic basis of naturally occurring chemical variation. J. Agric. Food Chem. 2006, 54, 2424–2430. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  10. Thiel, P.G.; Shephard, G.S.; Sydenham, E.W.; Marasas, W.F.; Nelson, P.E.; Wilson, T.M. Levels of fumonisins B1 and B2 in feeds associated with confirmed cases of equine leukoencephalomalacia. J. Agric. Food Chem. 1991, 39, 109–111. [Google Scholar] [CrossRef] [Scilit]
  11. Sun, G.J.; Wang, S.K.; Hu, X.; Su, J.J.; Huang, T.R.; Yu, J.H.; Tang, L.L.; Gao, W.M.; Wang, J.S. Fumonisin B1 contamination of home-grown corn in high-risk areas for esophageal and liver cancer in China. Food Addit. Contam. 2007, 24, 181–185. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  12. Marasas, W. Discovery and occurrence of the fumonisins: A historical perspective. Environ. Health Perspect. 2001, 109 (Suppl. 2), 239–243. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  13. Fu, M.; Li, R.; Guo, C.C.; Pang, M.H.; Liu, Y.C.; Dong, J.G. Natural incidence of Fusarium species and fumonisins B1 and B2 associated with maize kernels from nine provinces in China in 2012. Food Addit. Contam. A 2015, 32, 503–511. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  14. Li, R.J.; Guo, C.C.; Zhang, Q.G.; Pang, M.H.; Liu, Y.C.; Dong, J.G. Fumonisins B1 and B2 in maize harvested in Hebei province, China, during 2011–2013. Food Addit. Contam. B 2015, 8, 1–6. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  15. Desjardins, A.E.; Plattner, R.D. Fumonisin B1-nonproducing strains of Fusarium verticillioides cause maize (Zea mays) ear infection and ear rot. J. Agric. Food Chem. 2000, 48, 5773–5780. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  16. Marin, S.; Magan, N.; Serra, J.; Ramos, A.; Canela, R.; Sanchis, V. Fumonisin B1 production and growth of Fusarium moniliforme and Fusarium proliferatum on maize, wheat, and barley grain. J. Food Sci. 1999, 64, 921–924. [Google Scholar] [CrossRef] [Scilit]
  17. Lanubile, A.; Ferrarini, A.; Maschietto, V.; Delledonne, M.; Marocco, A.; Bellin, D. Functional genomic analysis of constitutive and inducible defense responses to Fusarium verticillioides infection in maize genotypes with contrasting ear rot resistance. BMC Genom. 2014, 15, 710. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  18. Cendoya, E.; Farnochi, M.C.; Chulze, S.N.; Ramirez, M.L. Two-dimensional environmental profiles of growth and fumonisin production by Fusarium proliferatum on a wheat-based substrate. Int. J. Food Microbiol. 2014, 182, 9–17. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  19. Lamprecht, S.; Tewoldemedhin, Y.; Botha, W.; Calitz, F. Fusarium graminearum species complex associated with maize crowns and roots in the KwaZulu-Natal province of South Africa. Plant Dis. 2011, 95, 1153–1158. [Google Scholar] [CrossRef] [Scilit]
  20. O’Donnell, K.; Ward, T.J.; Geiser, D.M.; Kistler, H.C.; Aoki, T. Genealogical concordance between the mating type locus and seven other nuclear genes supports formal recognition of nine phylogenetically distinct species within the Fusarium graminearum clade. Fungal Genet. Biol. 2004, 41, 600–623. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  21. O’Donnell, K.; Kistler, H.C.; Tacke, B.K.; Casper, H.H. Gene genealogies reveal global phylogeographic structure and reproductive isolation among lineages of Fusarium graminearum, the fungus causing wheat scab. Proc. Natl. Acad. Sci. USA 2000, 97, 7905–7910. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  22. Desjardins, A. Fusarium Mycotoxins, Chemistry, Genetics and Biology; The American Phytopathological Society: St. Paul, MN, USA, 2006; p. 260. ISBN 0-89054-335-6. [Google Scholar]
  23. Ward, T.J.; Bielawski, J.P.; Kistler, H.C.; Sullivan, E.; O’Donnell, K. Ancestral polymorphism and adaptive evolution in the trichothecene mycotoxin gene cluster of phytopathogenic Fusarium. Proc. Natl. Acad. Sci. USA 2002, 99, 9278–9283. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  24. Suga, H.; Karugia, G.W.; Ward, T.; Gale, L.R.; Tomimura, K.; Nakajima, T.; Miyasaka, A.; Koizumi, S.; Kageyama, K.; Hyakumachi, M. Molecular characterization of the Fusarium graminearum species complex in Japan. Phytopathology 2008, 98, 159–166. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  25. Ward, T.J.; Clear, R.M.; Rooney, A.P.; O’Donnell, K.; Gaba, D.; Patrick, S.; Starkey, D.E.; Gilbert, J.; Geiser, D.M.; Nowicki, T.W. An adaptive evolutionary shift in Fusarium head blight pathogen populations is driving the rapid spread of more toxigenic Fusarium graminearum in North America. Fungal Genet. Biol. 2008, 45, 473–484. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  26. Lee, S.H.; Lee, J.K.; Nam, Y.J.; Lee, S.H.; Ryu, J.G.; Lee, T. Population structure of Fusarium graminearum from maize and rice in 2009 in Korea. Plant Pathol. J. 2010, 26, 321–327. [Google Scholar] [CrossRef] [Scilit]
  27. Zhang, H.; Van der, L.T.; Waalwijk, C.; Chen, W.Q.; Xu, J.; Xu, J.S.; Zhang, Y.; Feng, J. Population analysis of the Fusarium graminearum species complex from wheat in China show a shift to more aggressive isolates. PLoS ONE 2012, 7, e31722. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  28. Shen, C.M.; Hu, Y.C.; Sun, H.Y.; Li, W.; Guo, J.H.; Chen, H.G. Geographic distribution of trichothecene chemotypes of the Fusarium graminearum species complex in major winter wheat production areas of China. Plant Dis. 2012, 96, 1172–1178. [Google Scholar] [CrossRef] [Scilit]
  29. Sampietro, D.A.; Ficoseco, M.E.A.; Jimenez, C.M.; Vattuone, M.A.; Catalán, C.A. Trichothecene genotypes and chemotypes in Fusarium graminearum complex strains isolated from maize fields of northwest Argentina. Int. J. Food Microbiol. 2012, 153, 229–233. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  30. Lee, J.; Kim, H.; Jeon, J.J.; Kim, H.S.; Zeller, K.A.; Carter, L.L.A.; Leslie, J.F.; Lee, Y.W. Population structure of and mycotoxin production by Fusarium graminearum from maize in South Korea. Appl. Environ. Microbiol. 2012, 78, 2161–2167. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  31. Astolfi, P.; Santos, J.D.; Schneider, L.; Gomes, L.B.; Silva, C.N.; Tessmann, D.J.; Del Ponte, E.M. Molecular survey of trichothecene genotypes of Fusarium graminearum species complex from barley in southern Brazil. Int. J. Food Microbiol. 2011, 148, 197–201. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  32. Duan, C.X.; Qin, Z.H.; Yang, Z.H.; Li, W.X.; Sun, S.L.; Zhu, Z.D.; Wang, X.M. Identification of pathogenic Fusarium spp. causing maize ear rot and potential mycotoxin production in China. Toxins 2016, 8, 186. [Google Scholar] [CrossRef] [Scilit]
  33. Duan, C.X.; Wang, X.M.; Song, F.J.; Sun, S.L.; Zhou, D.N.; Zhu, Z.D. Advance in Research on Maize Resistance to Ear Rot. Sci. Agric. Sin. 2015, 48, 2152–2164. [Google Scholar]
  34. Kuppler, A.L.M.; Steiner, U.; Sulyok, M.; Krska, R.; Oerke, E.C. Genotyping and phenotyping of Fusarium graminearum isolates from Germany related to their mycotoxin biosynthesis. Int. J. Food Microbiol. 2011, 151, 78–86. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  35. Boutigny, A.L.; Ward, T.J.; Ballois, N.; Iancu, G.; Ioos, R. Diversity of the Fusarium graminearum species complex on French cereals. Eur. J. Plant Pathol. 2014, 138, 133–148. [Google Scholar] [CrossRef] [Scilit]
  36. Ji, L.; Cao, K.; Hu, T.; Wang, S. Determination of deoxynivalenol and nivalenol chemotypes of Fusarium graminearum isolates from China by PCR assay. J. Phytopathol. 2007, 155, 505–512. [Google Scholar] [CrossRef] [Scilit]
  37. Zhang, J.B.; Li, H.P.; Dang, F.J.; Qu, B.; Xu, Y.B.; Zhao, C.S.; Liao, Y.C. Determination of the trichothecene mycotoxin chemotypes and associated geographical distribution and phylogenetic species of the Fusarium graminearum clade from China. Mycol. Res. 2007, 111, 967–975. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  38. European Food Safety Authority. Scientific Opinion on risks for animal and public health related to the presence of nivalenol in food and feed. EFSA J. 2013, 11, 3262. [Google Scholar]
  39. Schothorst, R.C.; Egmond, H.P. Report from SCOOP task 3.2. 10 “collection of occurrence data of Fusarium toxins in food and assessment of dietary intake by the population of EU member states”: Subtask: trichothecenes. Toxicol. Lett. 2004, 153, 133–143. [Google Scholar] [PubMed]
  40. Leslie, J.F.; Summerell, B.A. The Fusarium Laboratory Manual; Blackwell Publishing: Ames, IA, USA, 2007. [Google Scholar] [CrossRef] [Scilit]
  41. Bluhm, B.H.; Flaherty, J.E.; Cousin, M.A.; Woloshuk, C.P. Multiplex polymerase chain reaction assay for the differential detection of trichothecene- and fumonisin-producing species of Fusarium in cornmeal. J. Food Prot. 2002, 65, 1955–1961. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  42. Nicholson, P.; Simpson, D.R.; Weston, G.; Rezanoor, H.N.; Lees, A.K.; Parry, D.W.; Joyce, D. Detection and quantification of Fusarium culmorum and Fusarium graminearumin cereals using PCR assays. Physiol. Mol. Plant Pathol. 1998, 53, 17–37. [Google Scholar] [CrossRef] [Scilit]
  43. Mishra, P.K.; Fox, R.T.V.; Culham, A. Development of a PCR-based assay for rapid and reliable identification of pathogenic Fusariam. FEMS Microbiol. Lett. 2003, 218, 329–332. [Google Scholar] [CrossRef] [PubMed]
  44. Mulè, G.; Susca, A.; Stea, G.; Moretti, A. A species-specific PCR assay based on the calmodulin partial gene for identification of Fusarium verticillioides, F. proliferatum and F. subglutinans. Eur. J. Plant Pathol. 2004, 110, 495–502. [Google Scholar] [CrossRef] [Scilit]
  45. O’Donnell, K.; Kistler, H.C.; Cigelnik, E.; Ploetz, R.C. Multiple evolutionary origins of the fungus causing Panama disease of banana: Concordant evidence from nuclear and mitochondrial gene genealogies. Proc. Natl. Acad. Sci. USA 1998, 95, 2044–2049. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  46. Proctor, R.H.; Plattner, R.D.; Brown, D.W.; Seo, J.A.; Lee, Y.W. Discontinuous distribution of fumonisin biosynthetic genes in the Gibberella fujikuroi species complex. Mycol. Res. 2004, 108, 815–822. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  47. Wang, J.H.; Li, H.P.; Qu, B.; Zhang, J.B.; Huang, T.; Chen, F.F.; Liao, Y.C. Development of a Generic PCR Detection of 3-Acetyldeoxynivalenol-, 15-Acetyldeoxynivalenol- and Nivalenol-Chemotypes of Fusarium graminearum clade. Int. J. Mol. Sci. 2008, 9, 2495–2504. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  48. Krska, R.; Baumgartner, S.; Josephs, R. The state of the art in the analysis of type-A and -B trichothecene mycotoxins in cereals. J. Anal. Chem. 2001, 371, 285–299. [Google Scholar] [CrossRef] [Scilit]
  49. Escobar, J.; Loran, S.; Gimenez, I.; Ferruz, E.; Herrera, M.; Herrera, A.; Arino, A. Occurrence and exposure assessment of Fusarium mycotoxins in maize germ, refined corn oil and margarine. Food Chem. Toxicol. 2013, 62, 514–520. [Google Scholar] [CrossRef] [Scilit] [PubMed]
Figure 1. Molecular identification of Fusarium species (M, DNA marker; (a) PCR amplification of Fusarium spp., 1–11: CP1, CP4, CP5, D14, D11, D13, D15, D26, D31, D91, Negative control; (b) Specific PCR amplification of F. verticillioides, 1–11: D11, D13, D17, D22, D25, D31, D50, D52, D77, D87, Negative control; (c) Specific PCR amplification of F. proliferatum, 1–11: D21, D57-1, D59, D67, D68-3, D75, D75-2, D79-3, D88-2, D91, Negative control; (d) Specific PCR amplification of the FGSC, 1–11: CP1, CP4, CP5, D14, D38, D59-2, D66, D73, D76-1, D99, Negative control).
Figure 1. Molecular identification of Fusarium species (M, DNA marker; (a) PCR amplification of Fusarium spp., 1–11: CP1, CP4, CP5, D14, D11, D13, D15, D26, D31, D91, Negative control; (b) Specific PCR amplification of F. verticillioides, 1–11: D11, D13, D17, D22, D25, D31, D50, D52, D77, D87, Negative control; (c) Specific PCR amplification of F. proliferatum, 1–11: D21, D57-1, D59, D67, D68-3, D75, D75-2, D79-3, D88-2, D91, Negative control; (d) Specific PCR amplification of the FGSC, 1–11: CP1, CP4, CP5, D14, D38, D59-2, D66, D73, D76-1, D99, Negative control).
Toxins 10 00090 g001
Figure 2. The phylogenetic tree of F. graminearum species complex (FGSC) isolates based on TEF-1α gene sequences.
Figure 2. The phylogenetic tree of F. graminearum species complex (FGSC) isolates based on TEF-1α gene sequences.
Toxins 10 00090 g002
Figure 3. Detection of the key toxigenic gene FUM1 in F. verticillioides isolates using primers Fum5F/Fum5R and Rp32/Rp33 (M, DNA marker; 1–6: D11, D12-1, D12-2, D13, D15, D17; 7–13: D11, D12-1, D12-2, D13, D15, D17, Negative control).
Figure 3. Detection of the key toxigenic gene FUM1 in F. verticillioides isolates using primers Fum5F/Fum5R and Rp32/Rp33 (M, DNA marker; 1–6: D11, D12-1, D12-2, D13, D15, D17; 7–13: D11, D12-1, D12-2, D13, D15, D17, Negative control).
Toxins 10 00090 g003
Figure 4. Detection of the gene FUM1 in F. proliferatum isolates using primer Rp32/Rp33 (M, DNA marker; 1–11: D21, D44-2, D56-1, D57-1, D59, D62-1, D65-1, D67, D75, D91, Negative control).
Figure 4. Detection of the gene FUM1 in F. proliferatum isolates using primer Rp32/Rp33 (M, DNA marker; 1–11: D21, D44-2, D56-1, D57-1, D59, D62-1, D65-1, D67, D75, D91, Negative control).
Toxins 10 00090 g004
Figure 5. Detection of toxigenic chemotype among FGSC isolates using primer Tri13P1/Tri13P2 (M, DNA marker; 1–9: Fusarium spp. CP1, CP5, D38, D66, D66, D73, D76-1, D99, Negative control).
Figure 5. Detection of toxigenic chemotype among FGSC isolates using primer Tri13P1/Tri13P2 (M, DNA marker; 1–9: Fusarium spp. CP1, CP5, D38, D66, D66, D73, D76-1, D99, Negative control).
Toxins 10 00090 g005
Figure 6. Sampling locations in Chongqing areas.
Figure 6. Sampling locations in Chongqing areas.
Toxins 10 00090 g006
Table 1. Fusarium species isolated from rotted maize ears and kernels in Chongqing areas.
Table 1. Fusarium species isolated from rotted maize ears and kernels in Chongqing areas.
Fusarium spp.Number of IsolatesIsolation FrequencyIsolate Code
Fusarium verticillioides4740.2%D11, D12-1, D12-2, D13, D15, D17, D22, D25, D30-2, D31, D32, D33, D34, D40-2, D42, D45, D50, D52, D54, D58-1, D60, D61-2, D62-2, D63, D64, D68-1, D68-2, D70, D72, D74-1, D77, D78-2, D79-1, D80-2, D81, D83-1, D83-2, D84, D85-2, D87, D88-1, D92-1, D93-2, D95-1, D96-1, D98-2, D100
F. proliferatum1916.4%D21, D44-2, D56-1, D57-1, D59, D62-1, D65-1, D67, D68-3, D75, D75-2, D78-1, D79-3, D88-2, D89-2, D90-1, D91, D92-2, D93-1
FGSC1916.4%CP1, CP4, CP5, D14, D38, D44-1, D46, D48, D57-2, D58-2, D59-2, D66, D73, D76-1, D82-1, D85-1, D91-2, D92-3, D99
F. oxysporum1412.1%D16, D23, D26, D30-1, D61-1, D61-3, D71-2, D78-3, D79-2, D82-2, D86-2, D93-3, D95-2, D96-2
F. fujikuroi86.9%CP2AH, CP2AZ, D24, D69-2, D7, D90-22, D94, D97-2
F. equiseti43.4%D56-2, D80-1, D89-1, D98-1
F. culmorum21.7%D55, D95-3
F. incarnatum10.9%D71-3
F. kyushuense10.9%D40-3
F. solani10.9%D69-1
Table 2. The isolation frequency of Fusarium species in different regions.
Table 2. The isolation frequency of Fusarium species in different regions.
Fusarium spp.Isolation Frequency
Northeast ChongqingSoutheast ChongqingCentral ChongqingWest ChongqingThe Others
F. verticillioides28.57%42.86%40.00%35.48%91.67%
FGSC20.00%14.29%10.00%22.58%0.00%
F. proliferatum20.00%10.71%20.00%19.35%0.00%
F. oxysporum14.14%25.00%20.00%0.00%8.33%
F. fujikuroi5.71%7.14%10.00%9.68%0.00%
F. equiseti5.71%3.57%0.00%3.22%0.00%
F. culmorum2.86%0.00%0.00%3.22%0.00%
F. kyushuense0.00%0.00%0.00%3.22%0.00%
F. incarnatum0.00%3.57%0.00%0.00%0.00%
Northeast Chongqing: Chengkou, Wuxi, Kaixian, Yunyang, Wanzhou, Zhongxian, Fengdu, Dianjiang; Southeast Chongqing: Shizhu, Wulong, Pengshui, Qianjiang, Jiuyang, Xiushan; Central Chongqing: Beibei, Jiulongpo, Fuling, Changshou; West Chongqing: Tongnan, Hechuan, Tongliang, Dazhu, Rongchang, Yongchuang, Jiangjin, Wansheng, Nanchuan, Qijiang; the others: Bazhong, Neijiang, Yibin, Ziyang, Chengdu, Xichang.
Table 3. Mycotoxin production of F. verticillioides isolates in Chongqing areas 1.
Table 3. Mycotoxin production of F. verticillioides isolates in Chongqing areas 1.
No.Origin of IsolateFB1 (µg/g)FB2 (µg/g)FB3 (µg/g)FBs (µg/g)
D100Jiulongpo148.56 ± 3.5115.32 ± 2.5324.51 ± 2.01188.39 ± 8.33
D11Hechuan21.13 ± 1.325.47 ± 1.127.71 ± 1.5634.31 ± 4.01
D12-1Longyu18.33 ± 1.412.58 ± 0.283.22 ± 0.6924.13 ± 2.11
D12-2Longyu584.06 ± 8.5381.22 ± 0.8969.98 ± 3.21735.26 ± 10.35
D13Suzhou35.30 ± 2.307.88 ± 1.0310.32 ± 1.1153.50 ± 2.36
D15Changping122.84 ± 4.5810.25 ± 1.5526.13 ± 3.28159.22 ± 5.78
D17Bazhong20.07 ± 1.113.72 ± 0.566.21 ± 0.3430.01 ± 2.15
D22Bijie211.83 ± 2.1219.45 ± 2.5839.82 ± 2.01271.10 ± 5.38
D25Xifeng56.23 ± 1.566.86 ± 1.1315.37 ± 0.8878.46 ± 4.56
D30-2Pujiang13.20 ± 0.893.41 ± 0.776.79 ± 0.6723.40 ± 1.81
D31Pujiang11.49 ± 1.132.51 ± 0.565.82 ± 0.8719.82 ± 1.87
D32Pujiang3.17 ± 0.331.07 ± 0.391.52 ± 0.305.76 ± 0.68
D33Pujiang209.67 ± 4.5517.93 ± 2.5747.14 ± 2.56274.74 ± 6.30
D34Zizhong26.86 ± 1.204.78 ± 0.4612.28 ± 1.8943.92 ± 2.51
D40-2Handan968.68 ± 6.3874.51 ± 5.48105.01 ± 5.111148.19 ± 13.15
D42Qinhuangdao19.25 ± 1.095.00 ± 0.776.34 ± 0.5530.60 ± 2.33
D45Luanxian9.44 ± 0.552.17 ± 0.692.63 ± 0.5114.24 ± 1.26
D50Yibin90.53 ± 2.377.91 ± 0.8813.93 ± 2.14112.36 ± 4.23
D52Yibin35.91 ± 1.221.80 ± 0.2016.38 ± 1.8954.10 ± 3.18
D54Yibin1076.93 ± 16.7851.51 ± 4.26356.15 ± 15.111484.59 ± 17.33
D58-1Qijiang502.83 ± 6.5651.41 ± 2.21200.92 ± 10.23755.16 ± 7.36
D60Dianjiang63.20 ± 2.596.14 ± 0.5810.60 ± 0.9579.95 ± 3.56
D61-1Dianjiang22.22 ± 1.088.98 ± 0.3916.02 ± 1.0847.21 ± 2.88
D62-2Nanchuan270.12 ± 5.0221.35 ± 2.5646.02 ± 2.58337.49 ± 7.77
D63Nanchuan10.28 ± 0.568.20 ± 0.776.83 ± 0.8625.32 ± 2.03
D64Changshou167.70 ± 4.568.58 ± 0.9553.40 ± 3.33229.68 ± 5.08
D68-1Rongchang8.90 ± 0.631.62 ± 0.194.88 ± 0.8815.40 ± 1.26
D68-2Rongchang283.87 ± 5.1732.87 ± 2.1572.44 ± 5.69389.18 ± 7.02
D70Rongchang233.19 ± 5.3142.68 ± 2.33145.60 ± 8.12421.47 ± 5.59
D72Xiushan26.26 ± 1.093.72 ± 0.6914.35 ± 2.9944.33 ± 2.03
D74-1Shizhu112.39 ± 4.2615.73 ± 0.9757.14 ± 3.11185.26 ± 5.69
D77Dazhu261.92 ± 4.6325.38 ± 3.3380.67 ± 4.23367.98 ± 5.78
D78-2Youyang353.08 ± 7.8922.778 ± 2.68129.00 ± 5.55504.86 ± 8.26
D79-1Youyang848.51 ± 9.9742.33 ± 3.15167.50 ± 6.421058.35 ± 10.89
D80-2Xiushan1005.51 ± 10.3686.65 ± 4.13128.81 ± 5.431220.98 ± 10.29
D81Qianjiang206.21 ± 5.1219.69 ± 1.2230.37 ± 2.33256.26 ± 5.96
D83-1Penshui36.09 ± 2.018.24 ± 0.5710.88 ± 1.4655.20 ± 2.39
D83-2Penshui44.05 ± 2.256.39 ± 0.8812.21 ± 1.3962.65 ± 2.54
D84Fumeng100.87 ± 3.878.96 ± 1.0931.28 ± 3.11141.11 ± 4.37
D85-2Pengshui1566.44 ± 12.66156.52 ± 5.55292.22 ± 6.472015.19 ± 13.89
D87Wulong215.51 ± 7.0120.83 ± 2.0747.24 ± 2.11283.58 ± 8.09
D88-1Tongnan37.15 ± 1.176.62 ± 0.8912.51 ± 1.0356.27 ± 2.15
D92-1Chengkou206.02 ± 3.566.37 ± 1.2211.15 ± 1.35223.54 ± 4.23
D93-2Chengkou89.92 ± 3.439.18 ± 0.9125.29 ± 2.10124.38 ± 3.89
D95-1Wuxi749.74 ± 8.0177.64 ± 3.87122.98 ± 5.88950.36 ± 9.52
D96-1Yunyang968.97 ± 11.1295.69 ± 3.6097.01 ± 4.531161.67 ± 13.52
D98-2Wanzhou330.59 ± 5.2341.03 ± 2.1135.68 ± 3.68407.30 ± 6.56
1 Values are means ± SE.
Table 4. Mycotoxin production of F. proliferatum isolates in Chongqing 1.
Table 4. Mycotoxin production of F. proliferatum isolates in Chongqing 1.
No.Origin of IsolateFB1 (µg/g)FB2 (µg/g)FB3 (µg/g)FBs (µg/g)
D21Beibe3082.95 ± 30.78231.44 ± 5.22155.25 ± 5.363469.64 ± 33.69
D44-2Fengdu5331.14 ± 45.36463.27 ± 5.68204.95 ± 5.215999.36 ± 47.23
D56-1Yongchuan157.23 ± 5.2331.16 ± 2.1125.14 ± 1.01213.52 ± 5.89
D57-1Qijiang194.99 ± 6.1216.01 ± 0.8918.59 ± 1.53229.59 ± 6.57
D59Dianjiang5947.56 ± 38.12866.02 ± 9.45308.96 ± 9.317122.54 ± 40.12
D62-1Nanchuan5666.14 ± 46.25229.35 ± 7.36124.29 ± 5.236019.77 ± 47.76
D65-1Changshou4578.41 ± 23.39800.77 ± 9.12316.49 ± 8.015695.67 ± 26.59
D67Wansheng1284.52 ± 15.23101.54 ± 2.89231.50 ± 5.341617.55 ± 17.25
D68-3Rongchan366.54 ± 6.5534.09 ± 3.1175.35 ± 2.59475.97 ± 7.67
D75Zhongxian9130.53 ± 52.47867.38 ± 18.12317.26 ± 7.2110,315.17 ± 54.28
D75-2Zhongxian6357.95 ± 39.58534.06 ± 6.39200.89 ± 6.337092.89 ± 41.26
D78-1Youyang5579.13 ± 37.45390.65 ± 8.88258.46 ± 8.776228.24 ± 38.97
D79-3Youyang632.89 ± 10.2490.55 ± 3.69141.27 ± 6.37864.71 ± 11.25
D88-2Tongnan97.74 ± 4.6316.48 ± 1.109.11 ± 0.78123.33 ± 4.99
D89-2Kaixian299.31 ± 6.1136.92 ± 3.5519.66 ± 1.25355.89 ± 7.21
D90-1Kaixian936.56 ± 11.5666.04 ± 2.0144.61 ± 3.211047.21 ± 14.22
D91Shizhu2813.66 ± 22.37881.77 ± 10.56250.86 ± 6.783946.29 ± 26.85
D92-2Chenkou11,100.99 ± 56.79431.62 ± 9.23293.84 ± 10.5711,826.45 ± 58.76
D93-1Chenkou5466.50 ± 35.761554.83 ± 16.37381.40 ± 9.787402.72 ± 38.83
1 Values are means ± SE.
Table 5. The comparison of mycotoxin production between by F. verticillioides and F. proliferatum 1.
Table 5. The comparison of mycotoxin production between by F. verticillioides and F. proliferatum 1.
Fusarium spp.FB1 (µg/g)FB2 (µg/g)FB3 (µg/g)FBs (µg/g)
F. verticillioides263.94 ± 4.01 A24.70 ± 3.75 A56.1 8 ± 2.95 A344.81 ± 6.51 A
F. proliferatum3632.88 ± 23.70 B402.31 ± 6.02 B177.78 ± 4.51 B4212.97 ± 25.89 B
1 Values are means ± SE. The values with the different capital letter in the column express extremely significant difference (p < 0.01), according to Duncan’s multiple range test.
Table 6. Mycotoxin chemotype and production of FGSC isolates in Chongqing 1.
Table 6. Mycotoxin chemotype and production of FGSC isolates in Chongqing 1.
No.Species 2OriginGenotypeNIV (µg/g)DON (µg/g)15-ADON (µg/g)3-ADON (µg/g)ZEN (µg/g)
CP1F. m.FulingNIV699.55 ± 11.2319.43 ± 1.560.000.000.00
CP4F. m.JiangjinNIV1254.86 ± 18.683.77 ± 0.380.000.000.00
D14F. m.WanzhouNIV2597.34 ± 25.4833.41 ± 2.690.000.008.35 ± 0.67
D38F. m.JiangjinNIV143.52 ± 5.360.007.90 ± 0.897.81 ± 0.5712.72 ± 1.03
D44-1F. m.FengduNIV1004.84 ± 13.890.000.000.0014.57 ± 1.25
D46F. m.ChengkouNIV450.11 ± 8.373.38 ± 0.560.000.000.00
D48F. m.ChengkouNIV89.25 ± 3.210.000.000.0078.57 ± 3.89
D58-2F. m.QijiangNIV0.000.000.005.83 ± 0.6756.40 ± 4.25
D59-2F. m.DianjiangNIV123.29 ± 5.870.000.000.000.00
D66F. m.WanshengNIV0.000.000.000.000.00
D73F. m.ShizhuNIV0.000.000.000.0049.06 ± 3.58
D76-1F. m.DazhuNIV90.89 ± 4.210.000.000.0071.68 ± 3.79
D82-1F. m.QianjiangNIV17.40 ± 1.560.000.000.0051.65 ± 2.87
D85-1F. m.WulongNIV0.000.000.003.10 ± 0.2238.95 ± 3.19
D91-2F. m.ShizhuNIV0.000.000.000.0031.57 ± 2.45
D92-3F. m.ChengkouNIV61.87 ± 3.050.000.000.0042.38 ± 2.71
D99F. a.WanzhouNIV0.000.000.000.000.00
CP5F. a.TongliangNIV0.004.50 ± 0.550.000.000.00
D57-2F. a.QijiangNIV0.000.000.000.000.00
1 Values are means ± SE; 2 F. m. = F. meridionale; F. a. = F. asiaticum.
Table 7. Specific primer pairs for Fusarium spp.
Table 7. Specific primer pairs for Fusarium spp.
FungiPrimerSequences (5′–3′)Product Size (bp)Tm (°C)Reference
Fusarium spp.ItsFAACTCCCAAACCCCTGTGAACATA43158[41]
ItsRTTTAACGGCGTGGCCGC
FGSCFg16NFACAGATGACAAGATTCAGGCACA28057[42]
Fg16NRTTCTTTGACATCTGTTCAACCCA
F. oxysporumFoF1ACATACCACTTGTTGCCTCG34058[43]
FoR1CGCCAATCAATTTGAGGAACG
F. verticillioidesVER1CTTCCTGCGATGTTTCTCC57856[44]
VER2AATTGGCCATTGGTATTATATATCTA
F. proliferatumPRO1CTTTCCGCCAAGTTTCTTC58556[44]
PRO2TGTCAGTAACTCGACGTTGTTG

Share and Cite

MDPI and ACS Style

Zhou, D.; Wang, X.; Chen, G.; Sun, S.; Yang, Y.; Zhu, Z.; Duan, C. The Major Fusarium Species Causing Maize Ear and Kernel Rot and Their Toxigenicity in Chongqing, China. Toxins 2018, 10, 90. https://doi.org/10.3390/toxins10020090

AMA Style

Zhou D, Wang X, Chen G, Sun S, Yang Y, Zhu Z, Duan C. The Major Fusarium Species Causing Maize Ear and Kernel Rot and Their Toxigenicity in Chongqing, China. Toxins. 2018; 10(2):90. https://doi.org/10.3390/toxins10020090

Chicago/Turabian Style

Zhou, Danni, Xiaoming Wang, Guokang Chen, Suli Sun, Yang Yang, Zhendong Zhu, and Canxing Duan. 2018. "The Major Fusarium Species Causing Maize Ear and Kernel Rot and Their Toxigenicity in Chongqing, China" Toxins 10, no. 2: 90. https://doi.org/10.3390/toxins10020090

APA Style

Zhou, D., Wang, X., Chen, G., Sun, S., Yang, Y., Zhu, Z., & Duan, C. (2018). The Major Fusarium Species Causing Maize Ear and Kernel Rot and Their Toxigenicity in Chongqing, China. Toxins, 10(2), 90. https://doi.org/10.3390/toxins10020090

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop